ID: 1155864338

View in Genome Browser
Species Human (GRCh38)
Location 18:30945770-30945792
Sequence TCATCGGAATCTCAGAGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155864338_1155864342 -4 Left 1155864338 18:30945770-30945792 CCCCGACTCTGAGATTCCGATGA No data
Right 1155864342 18:30945789-30945811 ATGAGAGACTGAATCCACAAAGG No data
1155864338_1155864343 -3 Left 1155864338 18:30945770-30945792 CCCCGACTCTGAGATTCCGATGA No data
Right 1155864343 18:30945790-30945812 TGAGAGACTGAATCCACAAAGGG No data
1155864338_1155864344 4 Left 1155864338 18:30945770-30945792 CCCCGACTCTGAGATTCCGATGA No data
Right 1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155864338 Original CRISPR TCATCGGAATCTCAGAGTCG GGG (reversed) Intergenic
No off target data available for this crispr