ID: 1155864344

View in Genome Browser
Species Human (GRCh38)
Location 18:30945797-30945819
Sequence CTGAATCCACAAAGGGATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155864338_1155864344 4 Left 1155864338 18:30945770-30945792 CCCCGACTCTGAGATTCCGATGA No data
Right 1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG No data
1155864339_1155864344 3 Left 1155864339 18:30945771-30945793 CCCGACTCTGAGATTCCGATGAG No data
Right 1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG No data
1155864340_1155864344 2 Left 1155864340 18:30945772-30945794 CCGACTCTGAGATTCCGATGAGA No data
Right 1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG No data
1155864337_1155864344 12 Left 1155864337 18:30945762-30945784 CCTCGGTGCCCCGACTCTGAGAT No data
Right 1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155864344 Original CRISPR CTGAATCCACAAAGGGATAG TGG Intergenic
No off target data available for this crispr