ID: 1155864678

View in Genome Browser
Species Human (GRCh38)
Location 18:30950623-30950645
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155864678_1155864683 -7 Left 1155864678 18:30950623-30950645 CCTACCTCCAACTGTGTGTCATG No data
Right 1155864683 18:30950639-30950661 TGTCATGGTAGGCAGAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155864678 Original CRISPR CATGACACACAGTTGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr