ID: 1155866742

View in Genome Browser
Species Human (GRCh38)
Location 18:30974647-30974669
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155866738_1155866742 -9 Left 1155866738 18:30974633-30974655 CCTCCCTATGCTGACACTATGCA No data
Right 1155866742 18:30974647-30974669 CACTATGCACAGCTGGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155866742 Original CRISPR CACTATGCACAGCTGGTACC TGG Intergenic
No off target data available for this crispr