ID: 1155868323

View in Genome Browser
Species Human (GRCh38)
Location 18:30994193-30994215
Sequence TTCTGCTAATGTAATAAATT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 357}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155868322_1155868323 16 Left 1155868322 18:30994154-30994176 CCTAATTGTAGCACTGTGACATT 0: 1
1: 0
2: 1
3: 15
4: 165
Right 1155868323 18:30994193-30994215 TTCTGCTAATGTAATAAATTTGG 0: 1
1: 0
2: 2
3: 50
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155868323 Original CRISPR TTCTGCTAATGTAATAAATT TGG Exonic
900231462 1:1560925-1560947 TTCTGATAATTAAATAAATTAGG - Intronic
901561220 1:10072500-10072522 TTCTGCTGATTTTATGAATTTGG + Intronic
902121108 1:14166581-14166603 TGCTGCTTTTGTTATAAATTTGG + Intergenic
905605809 1:39298707-39298729 ATCTGTTAATTTAATTAATTTGG + Intronic
907900246 1:58734645-58734667 TGCTGCTAAGGTAATATGTTTGG - Intergenic
908079065 1:60555505-60555527 TTCTGTTACTGTAATTAGTTTGG - Intergenic
909941702 1:81618425-81618447 TTCTCAGAATGTAAAAAATTTGG - Intronic
911200813 1:95041916-95041938 TGCTGCTAGTGTAATAAATAGGG - Intronic
911423542 1:97677188-97677210 ATTTGCTTATGTAATTAATTTGG + Intronic
911747498 1:101455523-101455545 GTTTGCTAAAGTAATGAATTGGG - Intergenic
911840886 1:102680414-102680436 TTCTGCTAAGGTAACATATTTGG - Intergenic
911953415 1:104205886-104205908 GTCTGTTTATGTATTAAATTAGG + Intergenic
916287484 1:163125624-163125646 CTCTGCTTATGTAATAGAATAGG + Intronic
917112969 1:171570670-171570692 TTCTGCTATAGTAATAATTATGG - Intronic
917189999 1:172405634-172405656 TTTTGATAATGGAATTAATTAGG - Intronic
917382468 1:174428892-174428914 TTAATCTAATGTTATAAATTAGG + Intronic
917653034 1:177097670-177097692 TTATGCTAATGAGATAAATGGGG + Intronic
918515694 1:185360138-185360160 TTATGCTAATGAAATAAGTCAGG - Intergenic
918909672 1:190550539-190550561 TGCAGCTAATGGAATAAATATGG - Intergenic
920841651 1:209560520-209560542 CTCTGCCAATGTTATAAAGTGGG + Intergenic
920947461 1:210543190-210543212 TTCAGCTAATTTCATAAATGTGG + Intronic
921652693 1:217697480-217697502 TGATCATAATGTAATAAATTTGG - Intronic
921843004 1:219847908-219847930 TTCTGCTAATATGACAAAATAGG + Intronic
923060895 1:230472922-230472944 TTCTGTTTATGTGATAGATTAGG + Intergenic
923378929 1:233395126-233395148 TTCTTCTAAGGCTATAAATTCGG - Intergenic
924288837 1:242516365-242516387 GTTTACTAATCTAATAAATTGGG + Intronic
924764258 1:247017144-247017166 CTCTACAAATGTAATAAATGTGG + Intergenic
1064069998 10:12220456-12220478 TTCTGCTATTATAAATAATTGGG + Intronic
1065313511 10:24439491-24439513 TGTTGCTGCTGTAATAAATTAGG + Intronic
1065691493 10:28338559-28338581 TCCTGCAAATGTAAGTAATTTGG - Intergenic
1065710414 10:28511525-28511547 GTCTTCTAATGTAATAACTTTGG + Intergenic
1065950339 10:30645815-30645837 TTCTGTTAAAGAAATAATTTTGG + Intergenic
1066309459 10:34181952-34181974 TTATCCTAATGTGATAAACTGGG - Intronic
1066718363 10:38311510-38311532 TTCTACCAATGGAATAGATTGGG - Intergenic
1068033426 10:51731254-51731276 TTCTGCTAATGTTATTACTTTGG - Intronic
1068133524 10:52925905-52925927 TGCTTCTAATTTAATAAATATGG + Intergenic
1069322915 10:67195239-67195261 TTTTACTAATGAAATAAATATGG + Intronic
1069327093 10:67244626-67244648 ATATGCTAAAATAATAAATTTGG + Intronic
1069354226 10:67564783-67564805 TTCTGCTTATGTAATGTATCAGG - Intronic
1069355338 10:67578910-67578932 TTCTGCTTATGTAATGTATCAGG + Intronic
1070484834 10:76920337-76920359 TTTTGCTCACGTAATAACTTCGG + Intronic
1072836323 10:98717681-98717703 TGCTGCTATTGTAATTATTTTGG - Intronic
1072840143 10:98764101-98764123 TTCAGATAATGTTATAATTTTGG + Intronic
1073183373 10:101600366-101600388 TTCTGGTAATGGAGAAAATTTGG - Intronic
1073671916 10:105600616-105600638 TTCTGCTAAAGGTAGAAATTTGG - Intergenic
1073976601 10:109108922-109108944 TCTGGCTAATGTAATTAATTGGG + Intergenic
1075454312 10:122575127-122575149 TTCTGCTAATGTGAAAAACAAGG + Intronic
1076658077 10:132037391-132037413 GTCTGCAAATGTAAGAAATGGGG + Intergenic
1078504544 11:11924463-11924485 TTGGGCTCATGTAATAAGTTAGG + Intronic
1078586178 11:12591576-12591598 TTCTGTTAATGTAATTACTTTGG - Intergenic
1080145103 11:28972723-28972745 TACTGGAAATGTAATAAAATAGG - Intergenic
1081515705 11:43826512-43826534 TTTTCCTTTTGTAATAAATTTGG - Intronic
1084391589 11:68880760-68880782 TTATGCTAATGAGATAAATTAGG - Intergenic
1086516065 11:87614810-87614832 TTGTGATAATAAAATAAATTGGG - Intergenic
1086545998 11:87968189-87968211 TTTTACTTATGTTATAAATTTGG + Intergenic
1086777068 11:90850154-90850176 TTCTCCCAATGAAATTAATTAGG - Intergenic
1086829002 11:91535621-91535643 TTCTGATAATGGAATAAAAGAGG - Intergenic
1088679703 11:112228468-112228490 GTGAGCTAAAGTAATAAATTGGG + Intronic
1088942171 11:114470525-114470547 TTTTGCTCATTTAAAAAATTGGG + Intergenic
1090449753 11:126796116-126796138 TTTTGCTAATGCAATAAAGTTGG + Intronic
1090496505 11:127217867-127217889 TTCTGTTGTAGTAATAAATTTGG - Intergenic
1090558819 11:127906612-127906634 TTTTGCTCATTTAATAAATGAGG - Intergenic
1091170678 11:133517452-133517474 TACTGCTAGTGTAATAAAAGCGG + Intronic
1092604476 12:10103230-10103252 TTCTGTTAATATGATAAAATGGG + Intronic
1092646082 12:10573834-10573856 TTCTGATAATGGAATAATTCTGG - Intergenic
1093099885 12:15014975-15014997 TTCTGCTTATTTAAGAAGTTAGG + Intergenic
1093569285 12:20647560-20647582 TTCAGCTAATTAAATAAATGAGG - Intronic
1094169351 12:27475868-27475890 TTTTGCTCATTTAAAAAATTGGG + Intronic
1094237034 12:28179943-28179965 TTATGCTATTATTATAAATTTGG + Intronic
1095706771 12:45245280-45245302 TTCTTCTAAAGTATTAAATGTGG + Intronic
1095851102 12:46807684-46807706 TTCTGCTATTTGAATAATTTAGG - Intronic
1097084617 12:56458058-56458080 TTATGCTAATCTAATCTATTCGG - Intronic
1097296440 12:57968630-57968652 CCCGGCAAATGTAATAAATTTGG + Intergenic
1097325196 12:58268637-58268659 TTCACCTAATGTAACACATTAGG - Intergenic
1097860034 12:64509506-64509528 TTCTGCCTATGTAATAGTTTTGG - Intergenic
1098447151 12:70577683-70577705 TCCTTCTAATGTAATATGTTCGG + Intronic
1098806653 12:75028031-75028053 TTCTGTTAAAATAATTAATTTGG - Intergenic
1099142085 12:78990744-78990766 TTCTGAAAATGTAATAAAGAAGG + Intronic
1099678927 12:85798977-85798999 TTGTGTTACTGTCATAAATTAGG - Intergenic
1099770344 12:87044390-87044412 TTCTTATAATGTAAGATATTTGG - Intergenic
1100670733 12:96809858-96809880 TTCTCAGAATGTAGTAAATTAGG - Intronic
1103855625 12:123968239-123968261 TTCTGATAAAGCAGTAAATTGGG + Intronic
1104541278 12:129667637-129667659 TTTTGCTAATCTAAAATATTAGG - Intronic
1105224670 13:18419822-18419844 CTCTAAGAATGTAATAAATTTGG + Intronic
1106694157 13:32152923-32152945 TTCTGCCCATTTAAAAAATTGGG - Intronic
1107111033 13:36698425-36698447 TGCTGCTATTGTAATAAACTTGG + Intergenic
1107686769 13:42908776-42908798 TTTTGCTAATTTTAAAAATTAGG - Intronic
1108064051 13:46559274-46559296 TTCTGCTATTGAATTAAATTTGG + Intronic
1108285479 13:48903625-48903647 TTCTACTAAAGTAATACATGTGG - Intergenic
1108900414 13:55397793-55397815 TTATGCTAATGTGACTAATTGGG - Intergenic
1109578740 13:64297506-64297528 TTCTGACAATGTAATGATTTGGG + Intergenic
1109634797 13:65101055-65101077 TTCTTCTAATGTTATTATTTGGG + Intergenic
1109946471 13:69439809-69439831 TTGTGCTCATCTAATAATTTTGG + Intergenic
1110691833 13:78439686-78439708 TTCTGCTCATTTTATAAATTTGG - Intergenic
1110753245 13:79140636-79140658 TTCTGATAATCTAATAAGGTTGG + Intergenic
1110917496 13:81041038-81041060 TTCTCCTAATGTCATAACTTAGG + Intergenic
1110950670 13:81486106-81486128 CTCTGATAATGTATTAAATAAGG - Intergenic
1111272731 13:85908489-85908511 TTGTGCTGATGTTATCAATTAGG + Intergenic
1111308638 13:86450663-86450685 TTATGCTAATGAAATGAATTAGG - Intergenic
1111796016 13:92921188-92921210 TTATGCTTATGTTATAAAATGGG - Intergenic
1112727656 13:102323049-102323071 TTCTGCTCATAAAGTAAATTTGG + Intronic
1113095522 13:106660050-106660072 TTCTTCTAATTTATTCAATTTGG + Intergenic
1113178341 13:107594512-107594534 TTCTGCTAAAGTAATCAGTGTGG + Intronic
1115135026 14:30097597-30097619 TTATGCTAATGAAATAAGTCGGG + Intronic
1115175255 14:30554733-30554755 TTTTGCTAATCCAATAAACTTGG + Intergenic
1115501305 14:34052419-34052441 GTCTGCTGATGGAATAAATGTGG - Intronic
1116569259 14:46494741-46494763 TTATGTAAATGCAATAAATTCGG + Intergenic
1116580395 14:46633805-46633827 TTCGGCTCATGGAATGAATTAGG + Intergenic
1117345690 14:54829837-54829859 CTCTGATAATGTACTGAATTTGG - Intergenic
1117882567 14:60326736-60326758 TTCCACTGATTTAATAAATTTGG + Intergenic
1117938296 14:60933259-60933281 TTCTTCTAATTTGATCAATTAGG + Intronic
1118155947 14:63241914-63241936 TTCTGCCAAAGTACTACATTTGG - Intronic
1119755596 14:77116475-77116497 TTTTTCCAATGGAATAAATTTGG - Exonic
1120728575 14:87976256-87976278 TTCTGAGAATGTAATCAAATGGG + Intronic
1120897051 14:89542924-89542946 TGCTGTTAATGTAATAGCTTTGG - Intronic
1125036423 15:35129749-35129771 TTCTGCTCTTTTAAAAAATTGGG + Intergenic
1126035799 15:44544396-44544418 TTCTACTAATTTAAGAAACTGGG - Intronic
1126292889 15:47101399-47101421 CTCTACTAATGTAATTCATTTGG + Intergenic
1126749599 15:51863445-51863467 GTCTGGAAATGTAATCAATTCGG - Intronic
1127481190 15:59378909-59378931 TTCTCCAAATCTAAAAAATTTGG + Intronic
1129781340 15:78273946-78273968 TGAAGCTAAAGTAATAAATTTGG + Intronic
1130609295 15:85346336-85346358 TCCTGCAATTGTAATTAATTGGG - Intergenic
1130736851 15:86559263-86559285 TTCTGATAAGGAGATAAATTTGG + Intronic
1131790821 15:95963158-95963180 TTTTACTAAAGTAATAATTTTGG - Intergenic
1131891773 15:96979776-96979798 TTATTCCAATATAATAAATTAGG + Intergenic
1133856314 16:9552384-9552406 TTCTGTTAATCAAATAAACTAGG - Intergenic
1135167508 16:20153155-20153177 CTCTGCTAATATATTAAATCAGG - Intergenic
1135380258 16:21990101-21990123 TTCTGTTAATGCACTGAATTTGG - Intronic
1138892542 16:61162743-61162765 TTCTTCTCAGGTAATAATTTTGG - Intergenic
1139044874 16:63045081-63045103 TTCTGTTAATGTAATGTATCAGG + Intergenic
1140343898 16:74193439-74193461 TTCTGCTAAACTAATAATTTGGG - Intergenic
1141117623 16:81324150-81324172 TTCTGTAAATGTGATTAATTGGG - Intronic
1141283505 16:82650197-82650219 TTCAGCAATTGTAATAAATGAGG + Intronic
1142005722 16:87688807-87688829 TTCTCCTAATGGAATAAAGTCGG + Intronic
1143062777 17:4216878-4216900 TTCTGCTAATGTAAATAACTTGG - Intronic
1143813526 17:9492233-9492255 CTCTGCTGATTTAAAAAATTGGG - Intronic
1144141123 17:12349236-12349258 TTTTGCTCATGTAACAAATGAGG + Intergenic
1144471877 17:15550834-15550856 TTTTTCTAATGTCATTAATTTGG + Intronic
1151843098 17:76631712-76631734 TTCTGCTAGAGTGAAAAATTGGG - Intronic
1151857420 17:76731665-76731687 TTCTGCAAATGTGATAAAATTGG - Intronic
1152971177 18:162752-162774 ATTTGCTAATGTCATAAAATTGG - Intronic
1152976161 18:221248-221270 TTCTCAGAATTTAATAAATTTGG - Intronic
1153077403 18:1180591-1180613 TTCTGTTAATATAAAAAAATAGG - Intergenic
1154203563 18:12318099-12318121 TTCTGCTATTTTAATGAAATAGG + Intronic
1154528686 18:15319628-15319650 CTCTAAGAATGTAATAAATTTGG - Intergenic
1155868323 18:30994193-30994215 TTCTGCTAATGTAATAAATTTGG + Exonic
1155874416 18:31068033-31068055 TTCTGCTAGTGTCCTAAATTTGG + Exonic
1155879751 18:31130532-31130554 CTTTGCTAATGTCCTAAATTTGG + Exonic
1155906132 18:31453967-31453989 ATTTGCTAATATAATAATTTTGG - Intronic
1156135900 18:34037063-34037085 TTCTGCAATTCTACTAAATTTGG - Intronic
1156630539 18:38963090-38963112 TTCTACTTATCTAATACATTAGG + Intergenic
1158116145 18:53997829-53997851 TTCTGCTAATGTAACTGATAAGG - Intergenic
1159120727 18:64166400-64166422 TTTTGATAATTAAATAAATTTGG + Intergenic
1159397990 18:67888955-67888977 TTCTGCTCATCTGAAAAATTAGG - Intergenic
1159436792 18:68428645-68428667 TTCTGTTAGTGTAAGACATTTGG + Intergenic
1159469232 18:68828607-68828629 TACTTCTAATGTAAGAATTTAGG - Intronic
1159588407 18:70304614-70304636 TTTTGCTCATTTAAAAAATTAGG + Intronic
1160761839 19:789407-789429 TTCTGCAGATGTAATTAGTTAGG - Intergenic
1162660895 19:12168422-12168444 TTCTGTTAATGTAAAAATTCTGG + Intronic
1163868221 19:19793413-19793435 TCCTGCAAATATAATGAATTTGG - Intronic
1163902782 19:20120488-20120510 TCCTGCAAATGTAGTGAATTTGG + Intronic
1163911586 19:20199400-20199422 TCCTGCAAATGTAATGAGTTTGG + Exonic
1163954432 19:20622922-20622944 TCCTGCAAATGTAATGAATTTGG - Exonic
1163961395 19:20697451-20697473 TCCTGCAAATGTAATGAATTTGG + Intronic
1164002782 19:21119590-21119612 TCATGCAAATGTAGTAAATTTGG + Exonic
1164009314 19:21184998-21185020 TTGTGCAAATATAATAAATTTGG + Exonic
1164012746 19:21220984-21221006 TCTTGCAAATGTAATAAATTTGG - Intergenic
1164032981 19:21426643-21426665 TCTTGCAAATGTAATAAATTTGG + Exonic
1164035847 19:21454268-21454290 TTGTGCAAATGTAATAAATTTGG - Intronic
1164045783 19:21539030-21539052 TCCAGCAAGTGTAATAAATTTGG + Intronic
1164059446 19:21656739-21656761 CCCTGCAAATGTAATAAATTTGG + Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164075144 19:21809414-21809436 TTCTGCAAATGTGAAAAATGTGG - Exonic
1164092373 19:21969602-21969624 CCCTGCAAATTTAATAAATTTGG - Intronic
1164140169 19:22453117-22453139 TTCTGCCATTGTAATTAATGTGG + Intronic
1164174118 19:22753471-22753493 ACCTGCAAATGTAATAAATTTGG - Intergenic
1164183943 19:22845293-22845315 TTCTGCCATTGTAATTAATGTGG + Intergenic
1164223614 19:23221430-23221452 CTCTGCAAAGGTAGTAAATTTGG - Intergenic
1164252374 19:23491179-23491201 CCCTGCCAATGTAATAAATTTGG - Intergenic
1164278224 19:23743131-23743153 CCCTGCAAATGTAATAAATTTGG - Exonic
1164287596 19:23833933-23833955 CCCTGCAAATATAATAAATTTGG + Intergenic
1164298282 19:23936076-23936098 CCCTGCAAATGTAATGAATTTGG + Intronic
1164546383 19:29167790-29167812 TTCTGCTTTTGTAAAAAAGTAGG - Intergenic
1166019823 19:40016758-40016780 TTCTGTTAATGTAATGAACATGG + Exonic
1167858803 19:52266338-52266360 TTCAGCTAATTCAAAAAATTAGG - Intergenic
926557379 2:14374798-14374820 ATCTGCTTATGTAAGATATTTGG + Intergenic
927659279 2:24979174-24979196 TTTTGCTAATGTATGAATTTTGG - Intergenic
929271952 2:39982335-39982357 TTCTCCTAATGAAATAAAATAGG + Intergenic
931545529 2:63380945-63380967 TTTTGGCAATGTAATAAAGTGGG + Intronic
932041994 2:68309612-68309634 TTCTGGTAATGTGATAAGATAGG - Intronic
933021285 2:77196042-77196064 TTCTTCCAAGGTAATATATTTGG - Intronic
933468990 2:82695852-82695874 TTCTACTAATGCCACAAATTAGG + Intergenic
933874491 2:86605087-86605109 TTTTGTTAATGTAGAAAATTGGG - Exonic
934742469 2:96734961-96734983 TTTTTCTACTGTAATAAATTAGG - Intronic
936748915 2:115616563-115616585 TTTTGCTAATGTTACAAACTGGG - Intronic
937019951 2:118641011-118641033 ATCTGCTCATGAAATTAATTTGG + Intergenic
937172886 2:119894850-119894872 TTTTGCTAATCTGATAAAATTGG - Intronic
939232128 2:139442057-139442079 TTTTGCCAATCTAATATATTTGG + Intergenic
939535829 2:143427164-143427186 TTATGCTATTGTAACATATTTGG - Intronic
941031302 2:160514918-160514940 TACAGCTATTGTAAGAAATTAGG + Intergenic
943078280 2:183225093-183225115 TTCTTCTAATGTATTCAAGTTGG + Intergenic
943562659 2:189482485-189482507 TTCTGCCAAGGTCATGAATTAGG - Intergenic
943600462 2:189913400-189913422 TTCTAGTAATTTAATAAATCTGG - Intronic
943963057 2:194292535-194292557 CGCTGCTAATGTAATCACTTAGG - Intergenic
944557825 2:200905542-200905564 TTTTGCTGATTTAATAAATAAGG + Intergenic
944825273 2:203476941-203476963 TTTTGCTAATTTATTAAGTTTGG + Intronic
945158741 2:206866495-206866517 GCCTGCTAATGTAAAAAAATGGG + Intergenic
946423383 2:219577890-219577912 TTCTGCTAACGCAGCAAATTAGG + Intergenic
947288666 2:228546767-228546789 TTCTGCTGCTGGAAAAAATTGGG - Intergenic
947709463 2:232303575-232303597 TTCTGCTGATGGATTGAATTTGG - Intronic
1168899190 20:1346262-1346284 TTTTGCCCATGTAAAAAATTAGG + Intronic
1171536490 20:25897181-25897203 CTCTACTAATGTAATTCATTTGG - Intergenic
1171727389 20:28637594-28637616 TTCTGCAAATAAAATAAAATTGG - Intergenic
1171804617 20:29663977-29663999 CTCTACTAATGTAATTAATTTGG + Intergenic
1173133273 20:40414640-40414662 TCCTTCAAATGTAATAAAATTGG + Intergenic
1173986214 20:47263563-47263585 TACTGTTAATGTAATATAGTGGG + Intronic
1176768722 21:13048883-13048905 CTCTAAGAATGTAATAAATTTGG + Intergenic
1177277642 21:18934741-18934763 TTCTGCTAAGGTAAAGAATATGG - Intergenic
1178018910 21:28386486-28386508 GTTTGCTAATTTAATAAATAAGG + Intergenic
1183832805 22:40427746-40427768 TTATGCTAATGTGATAATCTGGG + Intronic
950891161 3:16405682-16405704 TTCTGCTAATTTAAAACATTTGG + Intronic
951292907 3:20895859-20895881 TTTTCCTAATGTAATCACTTGGG - Intergenic
951406841 3:22311400-22311422 TTCTACTACTTTAATAAATGTGG + Intronic
951658835 3:25039684-25039706 CTCTTTTATTGTAATAAATTTGG + Intergenic
952521601 3:34164548-34164570 CTATGCTGATGTACTAAATTTGG - Intergenic
952651449 3:35732088-35732110 TTCAGCTAATGTCATATATTTGG + Intronic
953738777 3:45518430-45518452 TTCTGTTAATGTAACATATGCGG - Intronic
955173620 3:56589823-56589845 TTCTGCCAATTAAAAAAATTGGG - Intronic
956321635 3:68004091-68004113 GACTTCTAATGTAATAAATCAGG + Intergenic
956390914 3:68771625-68771647 ATCTTTTAATGAAATAAATTTGG - Intronic
956965650 3:74456347-74456369 TCATGCTACTGCAATAAATTTGG - Intronic
958134678 3:89472922-89472944 GTCTGCTTATGTTTTAAATTAGG - Intronic
958498554 3:94875799-94875821 TTCTGCTAATTGGATATATTAGG + Intergenic
958760694 3:98304406-98304428 TTTTGCTTATTTAATAAAATTGG - Intergenic
958992065 3:100858051-100858073 TTCTGATGATGCAATAAAATTGG - Intronic
959035342 3:101356743-101356765 TCCTGCAAATGTAATGAATTTGG - Intronic
959302578 3:104621737-104621759 TTTTGCTTATGTAAGAATTTTGG + Intergenic
959767950 3:110055728-110055750 TTTTGCTCATGTAAAAAATCAGG - Intergenic
960188220 3:114670647-114670669 TTCTGGTACTGTAAAATATTTGG + Intronic
960960892 3:123069343-123069365 TTTTGCTATTGTAAAAAATGTGG - Intronic
961259692 3:125591699-125591721 TGCTGCTAATATATTAAATTTGG + Intronic
962432633 3:135334286-135334308 GTCTGCTTATGTTTTAAATTAGG + Intergenic
962593245 3:136913209-136913231 ATCTGCTAATGTGATAACTCTGG + Intronic
963809371 3:149759822-149759844 TTCTGCCTATTTAAAAAATTGGG - Intergenic
964732203 3:159879096-159879118 TTCATCTAATGTAATAATATTGG + Intronic
964883344 3:161449336-161449358 CTGTGCTACTGTAATAATTTTGG + Intergenic
965685998 3:171303331-171303353 TCATGCTAATGTCATATATTAGG - Intronic
965895135 3:173566488-173566510 TTCTGTCAAATTAATAAATTTGG + Intronic
966369727 3:179236731-179236753 TTCTTCTAATAGAATTAATTTGG - Exonic
967473856 3:189892853-189892875 TTCTGCTACAGTAAGAGATTAGG + Intronic
967645891 3:191923158-191923180 TTCTGGTAATATGATAAATGAGG - Intergenic
968388080 4:162739-162761 TTTTACAAATGTAATAAATTTGG + Intronic
968409452 4:375380-375402 TCCTACAAATGTAATAAATGTGG + Intronic
968416543 4:441005-441027 TCCTACAAATGTAATAAATGTGG - Intronic
968799899 4:2735364-2735386 TTCTGCTAATTTTAAAATTTAGG - Intergenic
970220912 4:13809844-13809866 TTATGCTCATGAAATATATTTGG + Intergenic
970267710 4:14307313-14307335 TTATGCTAATTTTACAAATTAGG + Intergenic
971983147 4:33781267-33781289 TTCTGTTAAGGAAATAAAGTAGG + Intergenic
973300259 4:48574315-48574337 TTCTGCTAATTGAAAAAAATAGG - Intronic
974195433 4:58568422-58568444 TTCTAAATATGTAATAAATTGGG - Intergenic
974904955 4:68044263-68044285 TCATGCTAATGTACTAGATTAGG + Intergenic
975450675 4:74522065-74522087 TTCTTCTAAAATAATCAATTTGG + Intergenic
975604235 4:76137311-76137333 TTCTGGTAATGGAATTAATTTGG - Intronic
977197376 4:94080418-94080440 TTCAGCAAATGGAATAAAATTGG - Intergenic
977277767 4:94999556-94999578 TGCTGTTTATGTAATTAATTTGG + Intronic
978153885 4:105467950-105467972 TGCGGCTAATGTTATAAATTGGG + Intronic
978204137 4:106059491-106059513 TGCTGCTATTGTAATTACTTTGG + Intronic
978282426 4:107034902-107034924 TTCTGCTAATGAAGTAATTGAGG - Intronic
979505698 4:121494203-121494225 TTTTGCTCATTTAAAAAATTGGG - Intergenic
980197398 4:129608407-129608429 TTCTGAAAATGTAATACTTTCGG + Intergenic
980511708 4:133799277-133799299 TTCTGCAAATTTACTAAGTTGGG - Intergenic
980533535 4:134086150-134086172 TCCTGGTAATGTAAGAAGTTGGG + Intergenic
981675136 4:147334253-147334275 TTCTGCCTATTTAAAAAATTTGG - Intergenic
981798048 4:148621042-148621064 TTCTGTTAATGTGATAAATTAGG - Intergenic
982172676 4:152677039-152677061 TTCTGCTCATGGAGTAAAGTGGG - Intronic
982285096 4:153725711-153725733 TTATCCTCATGTTATAAATTAGG - Intronic
983108023 4:163714412-163714434 TACTGCTAATGAAATCAGTTTGG + Intronic
983254370 4:165380481-165380503 TTCTGCTTAGGAAATAATTTGGG + Intronic
983295138 4:165857403-165857425 TTTTCCTAATTTAATAAACTGGG - Intergenic
984505888 4:180618103-180618125 TTTTTCTCATGTAATAAATAAGG - Intergenic
984711883 4:182892694-182892716 TTTTGCAAATGTAACAACTTTGG - Intronic
984957650 4:185061334-185061356 TTTTGCTCATATAAAAAATTTGG - Intergenic
985202595 4:187499229-187499251 TTCTCATAATTCAATAAATTTGG + Intergenic
985433216 4:189901453-189901475 TTCTGCAAATAAAATAAAATTGG + Intergenic
985707872 5:1412073-1412095 TTTTGCTAATTTTAGAAATTAGG - Intronic
987971904 5:24957360-24957382 TTCAGCTAATTTAATGAAATGGG + Intergenic
988366023 5:30300943-30300965 GTCTGGTACTGTAAAAAATTAGG - Intergenic
988403536 5:30794345-30794367 TTCTGCTAATGTAATGCTGTTGG - Intergenic
989148894 5:38278424-38278446 TTCTGGTAATTTAATAGTTTTGG - Intronic
989597948 5:43174327-43174349 TTCTGTAAATGTTATAAATATGG - Intronic
990315153 5:54576642-54576664 CACTGCTACTGTAATAAAGTGGG - Intergenic
990433811 5:55767069-55767091 TCATGCTAATGAAATAATTTGGG - Intronic
993257434 5:85610433-85610455 TTCTGCTATTAAAATAAATTAGG - Intergenic
993526719 5:88974290-88974312 TTTTCCTAATCTCATAAATTTGG + Intergenic
993856555 5:93083487-93083509 TTCTAGTAATGTAATTAAATAGG - Intergenic
994049554 5:95347129-95347151 TGCTGCTAAAGGAATAAACTTGG + Intergenic
994368935 5:98947423-98947445 TTATGCTAATGAGATAATTTAGG + Intergenic
994550564 5:101230250-101230272 TTCTGGTAATGTGACAAAATAGG - Intergenic
994862664 5:105218344-105218366 TTTTCTTAATGTAAGAAATTGGG + Intergenic
994909117 5:105879061-105879083 TGCTGCTAATGAAAAACATTGGG - Intergenic
995138218 5:108703291-108703313 TTCATCTAAAGTAATTAATTAGG + Intergenic
995170103 5:109098747-109098769 TCCTGGTAATTTAATATATTTGG + Intronic
995886199 5:116896814-116896836 TGCTGATAATGTATTAAAATTGG - Intergenic
996476219 5:123925275-123925297 TTCTGTTAATGTAACTATTTGGG + Intergenic
996508454 5:124293091-124293113 ATCTGCTAACATAATACATTGGG + Intergenic
996817392 5:127589025-127589047 TTATGCTAATGAAGTAACTTTGG - Intergenic
997383456 5:133454062-133454084 TTATCCTCATGTAATATATTTGG - Intronic
997562344 5:134858656-134858678 ATTTGCTAATATAATAAATAAGG - Exonic
998603947 5:143614779-143614801 TTTGGCTAATTTAATAACTTAGG + Intergenic
1000112125 5:158118789-158118811 TTTTGCTAAAATAAAAAATTTGG + Intergenic
1000219114 5:159194867-159194889 TTCTTTTATTGTAATTAATTGGG - Intronic
1000830627 5:166096899-166096921 TTCTGCATCTGTAATTAATTCGG + Intergenic
1000925052 5:167183902-167183924 TACTGTTAATGTATAAAATTAGG - Intergenic
1001084235 5:168688787-168688809 TTCTGCTACTGTGTTAAACTTGG + Intronic
1001420760 5:171585446-171585468 TTCTCCTAAGGTCATAGATTTGG - Intergenic
1002844084 6:930853-930875 TTTTTCTAATGTAATTATTTAGG - Intergenic
1002867947 6:1140377-1140399 TACTTTTAATGTAATTAATTTGG - Intergenic
1003575425 6:7289670-7289692 TTTTTCTAAAGTAACAAATTTGG - Exonic
1003993461 6:11512672-11512694 TTCTGCTTATGTAATATAGTTGG + Intergenic
1004356940 6:14937941-14937963 TTCTACTAATTTCATAGATTGGG + Intergenic
1004737992 6:18427530-18427552 TTCTGCTACTGTAATGGAATGGG + Intronic
1008047074 6:46862310-46862332 TTCTGTCAATGTAAAAAAATGGG - Intronic
1008140416 6:47825419-47825441 TTTTCTTAATGTAATAAGTTAGG + Intronic
1008855346 6:56079260-56079282 TTCTGTCAATGTAATAACCTTGG + Intronic
1008907024 6:56689690-56689712 TTATTCTAATGTAATAGATAAGG - Intronic
1009542164 6:64974566-64974588 TTCTACAAATGTCAAAAATTTGG + Intronic
1011225296 6:85097947-85097969 TTCTAGTAATGTAACAAAATAGG + Intergenic
1011865241 6:91817531-91817553 TTCACATAATTTAATAAATTTGG + Intergenic
1012532863 6:100259514-100259536 TTCTGCTTAGATAATAAAATTGG + Intergenic
1013346039 6:109261726-109261748 TTTTGGTAATGTACTCAATTTGG - Intergenic
1015069724 6:129076981-129077003 TTATACTAATATAATAAGTTAGG + Intronic
1015277185 6:131395474-131395496 TTCTGCTAAAGCAATAATTAGGG + Intergenic
1015899966 6:138054034-138054056 TTCTGATAATATAACAAAATAGG + Intergenic
1018572513 6:165225902-165225924 TTCTACTCATGTAATATATCAGG + Intergenic
1020539705 7:9444962-9444984 TTTTTCTAATGAAATAAATAAGG + Intergenic
1020813918 7:12880718-12880740 TTCTGCAAATATAATAGATGGGG - Intergenic
1020988859 7:15170639-15170661 CTCTGCTAATGTAATTAAATTGG - Intergenic
1021351895 7:19603683-19603705 TACTCCCAATGTGATAAATTGGG - Intergenic
1022893310 7:34723271-34723293 CTCTGCTATTGTAAGTAATTGGG - Intronic
1023270670 7:38458573-38458595 TTCTGTTGATGTGATATATTAGG - Intronic
1023321295 7:39000638-39000660 TTCTCCCAATGCTATAAATTGGG + Intronic
1023561629 7:41479864-41479886 TTGTCCTAGTGTTATAAATTAGG + Intergenic
1025287959 7:57683892-57683914 CTCTACTAATGTAATTCATTTGG - Intergenic
1025623339 7:63195128-63195150 TTGTGCTTCTGTATTAAATTTGG + Intergenic
1025767655 7:64471423-64471445 TCTTGCAAATGTAATAAATTTGG + Intergenic
1025772183 7:64520624-64520646 TCCTGCAAATGTAATGAATTTGG - Exonic
1025814287 7:64896310-64896332 TTCCGCAAATGAAATATATTTGG + Intronic
1025822151 7:64975959-64975981 AACTGCAAATGTAATATATTTGG - Exonic
1025867619 7:65400381-65400403 CCCTGCAAATGTAATAAATATGG + Exonic
1026256241 7:68714334-68714356 TTCTGTTTATGTGATAAATTAGG - Intergenic
1026390095 7:69892123-69892145 TTTTGCTTATTTAAAAAATTGGG + Intronic
1028705046 7:93832309-93832331 TTCTGCTACTCTGATAAATTAGG - Intronic
1030525033 7:110642310-110642332 AACTGCAAATGTAAGAAATTGGG + Intergenic
1030788195 7:113688600-113688622 TTCAGCTAATGTAATAATTAGGG + Intergenic
1030791556 7:113735688-113735710 TTCTTCTAATGTACTATGTTTGG + Intergenic
1031160761 7:118165164-118165186 TTCTGTTTATGTGGTAAATTAGG + Intergenic
1031630703 7:124039514-124039536 TTCTGATAATTTAATTAATGGGG + Intergenic
1034022372 7:147658826-147658848 TTCTGTTAATGTACTCAATCAGG + Intronic
1035248128 7:157578225-157578247 TCCTGTGAATGGAATAAATTTGG - Intronic
1035487945 7:159243044-159243066 TTTTGTTCATGTAAAAAATTAGG - Intergenic
1036088738 8:5641447-5641469 TTATTCTAATGTTATAGATTTGG + Intergenic
1038882943 8:31634896-31634918 CTCTGCTTATTTAATAAATAAGG + Intergenic
1039128199 8:34228794-34228816 TTCTGATAATGCTAGAAATTTGG - Intergenic
1039132241 8:34279360-34279382 TACTGCAAATGTAATGGATTTGG - Intergenic
1040645925 8:49396611-49396633 TTTTGTTCATGTAATAAATTTGG - Intergenic
1043567007 8:81559584-81559606 TTCTGCAACTATAATAAATCTGG + Intergenic
1044133655 8:88558149-88558171 TACAGCTACTGTAATAAATGTGG + Intergenic
1044543652 8:93435614-93435636 TTATGCTAATTTTATAAATGAGG + Intergenic
1045914932 8:107457527-107457549 TTCTGCTAATGGCACTAATTTGG - Intronic
1046899389 8:119507695-119507717 TTCTGCTCCTGTAAAAAATTTGG + Intergenic
1047163256 8:122405898-122405920 GTCTGCAGATGTGATAAATTTGG - Intergenic
1047281985 8:123453800-123453822 TTCTCCTCATGTTACAAATTAGG + Intronic
1047811890 8:128419628-128419650 TTCTGCAAATATAGGAAATTTGG + Intergenic
1048471208 8:134705837-134705859 TTGGGCTATTTTAATAAATTGGG - Intronic
1049266890 8:141672397-141672419 TACTGCTAATGTGACACATTTGG - Intergenic
1050040937 9:1492723-1492745 TTCAGCAAATCTAATCAATTAGG + Intergenic
1050905950 9:11005977-11005999 TTCAGCTGTTGGAATAAATTTGG - Intergenic
1051039575 9:12790966-12790988 TGCTACTTAGGTAATAAATTAGG - Intronic
1051738012 9:20222914-20222936 TTCTTCTTATTTAATAAGTTAGG - Intergenic
1052230969 9:26152253-26152275 TTCTGCTACTTTAAAAACTTGGG + Intergenic
1052655324 9:31351272-31351294 TTCTGCTTTTGTAATAATTGTGG - Intergenic
1053722352 9:40959509-40959531 TTCTGCAAATAAAATAAAATTGG + Intergenic
1054343617 9:63892489-63892511 TTCTGCAAATAAAATAAAATTGG - Intergenic
1055014887 9:71605776-71605798 TTTTTGTAATGTAATAAAATAGG + Intergenic
1057736509 9:97667012-97667034 TTCTGCTTCTGCATTAAATTGGG - Intronic
1058811864 9:108647469-108647491 TACTCCTCATGTAATAGATTTGG + Intergenic
1059183889 9:112246878-112246900 GTCTCCTAATGTAATGAAGTAGG + Intronic
1059851691 9:118348298-118348320 TTTTTCTAATTTAATAAATGAGG + Intergenic
1060902977 9:127277574-127277596 TTTTGCTTATGAAATAAAGTAGG + Intronic
1186241157 X:7568068-7568090 TTCTGCTTATCTAATCAAATGGG + Intergenic
1186359602 X:8826527-8826549 TTCTGCTATTGTAAGATATTTGG - Intergenic
1187167400 X:16817163-16817185 TTCTGCTACTGATAGAAATTTGG + Intronic
1188343954 X:29040947-29040969 TTCTTCTAATATATTATATTTGG + Intronic
1188739211 X:33756441-33756463 TTCTGGTAATTTAATAGTTTTGG + Intergenic
1189554780 X:42130714-42130736 TTCTGCTGATGTAACTACTTGGG - Intergenic
1189589072 X:42492872-42492894 TTTTGTTCCTGTAATAAATTTGG - Intergenic
1190960817 X:55245313-55245335 ATCTGTTTATGTGATAAATTAGG - Intronic
1193449686 X:81650323-81650345 TTCTGGTAAAATAATAAATTTGG + Intergenic
1194296866 X:92136846-92136868 ATCTGCTATGATAATAAATTTGG + Intronic
1195118140 X:101720495-101720517 ATCTACAAATGTAATAAATGTGG - Intergenic
1197163970 X:123355717-123355739 TTGTGCTAATGAAACAAAATTGG - Intronic
1197434170 X:126405042-126405064 TTTTAATAATGTAATTAATTTGG + Intergenic
1198591767 X:138190913-138190935 TTCTGCAAATCTATTAAAGTAGG - Intergenic
1199091457 X:143697800-143697822 TTATGCTAATGTTATAATTGAGG - Intergenic
1199394522 X:147319314-147319336 TTCTGATAAGGGCATAAATTAGG - Intergenic
1200614380 Y:5361421-5361443 ATCTGCTATGATAATAAATTTGG + Intronic
1200791163 Y:7300442-7300464 TTCTAATAATGCAATAAATATGG - Intergenic
1200899929 Y:8419698-8419720 GCCTGTCAATGTAATAAATTTGG - Intergenic
1201927442 Y:19303397-19303419 ATGAGCTAATGTAATAAATTTGG + Intergenic
1202049096 Y:20762510-20762532 TTCTGCTTTTGTAAGGAATTTGG + Intronic