ID: 1155873910

View in Genome Browser
Species Human (GRCh38)
Location 18:31061434-31061456
Sequence CTCACTGATGTGCCTCCGTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155873910_1155873913 28 Left 1155873910 18:31061434-31061456 CCATACGGAGGCACATCAGTGAG 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1155873913 18:31061485-31061507 AGAATTTAGGATATACCAAATGG 0: 1
1: 0
2: 0
3: 13
4: 273
1155873910_1155873911 15 Left 1155873910 18:31061434-31061456 CCATACGGAGGCACATCAGTGAG 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1155873911 18:31061472-31061494 CTCACGTATACCTAGAATTTAGG 0: 1
1: 0
2: 0
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155873910 Original CRISPR CTCACTGATGTGCCTCCGTA TGG (reversed) Exonic
900590850 1:3459138-3459160 CGTGCTGATGTGCCCCCGTAGGG - Intronic
900590858 1:3459202-3459224 CTTGCTGATGTGCCTCGGTAGGG - Intronic
906559876 1:46748626-46748648 CTCACTGATGTTCCACCCTCTGG + Intergenic
915648958 1:157293718-157293740 CTCACTGATGTGGATCCTGAAGG - Intergenic
916004690 1:160648855-160648877 CTCTCTGATGGGCCTCCCCATGG + Intergenic
921482555 1:215679487-215679509 CTCTCTGATGTTCCTCCCCAAGG - Intronic
924541743 1:244987005-244987027 GCCACTCTTGTGCCTCCGTAGGG + Intronic
1064580339 10:16787144-16787166 CTCACTGTTGTGGCTCCAAAGGG - Intronic
1070645093 10:78196276-78196298 ATCACTGATGTGCCCCGGCAGGG - Intergenic
1096515028 12:52151041-52151063 GTCACTGATGTGCCTTCTTTGGG + Intergenic
1102023235 12:109698379-109698401 CTCACTGATGCTCCTCCATGAGG - Intergenic
1104914523 12:132257885-132257907 CTCACAGCTGTGCCTCCGCAGGG - Intronic
1104944373 12:132409162-132409184 CTCACTGAGGGGCCTCTGTGGGG - Intergenic
1109715798 13:66220356-66220378 CTCACTGCTGGGCTTCCCTAAGG - Intergenic
1114733641 14:25020934-25020956 CTCACGAATCTGCCTGCGTATGG - Intronic
1121513161 14:94528975-94528997 CTCCCTGAGGTGCCTCAGTGGGG - Intergenic
1121518903 14:94572192-94572214 CTCACCCATGTACCTCTGTAGGG - Intronic
1129479502 15:75811736-75811758 CTCACTGCTGTTCCTCCATAAGG - Intergenic
1138617499 16:58181826-58181848 CACAATGACGTGCCTTCGTATGG - Intronic
1143731281 17:8884374-8884396 CTCCCTGAGGTGCCTCTGGAAGG + Intronic
1143858471 17:9870438-9870460 CTTAATGATGGGCCTCCTTAAGG + Intronic
1151969898 17:77452201-77452223 CTCACTGACATGCCTCTGCATGG - Intronic
1154040672 18:10852733-10852755 CTCTCTGCTGTGCCTCTGGATGG - Intronic
1155873910 18:31061434-31061456 CTCACTGATGTGCCTCCGTATGG - Exonic
1159029675 18:63218366-63218388 CTCTCTGCTGTGCCCCAGTAGGG - Intronic
1159598168 18:70403353-70403375 CTCACTGGTGTGCTTCCTAAGGG + Intergenic
1161593433 19:5139292-5139314 CTCAGTGATGTGCCACCATGTGG + Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
928256192 2:29725058-29725080 CTCACTGTTGTGCCTTGGGAAGG - Intronic
931303585 2:61005596-61005618 CTCACTGATGTGCCATCTTCTGG - Intronic
932216486 2:69969544-69969566 CTCACAGATGTGGCTCCCTGAGG + Intergenic
937869454 2:126777002-126777024 CTCACTGCTGTCCCTCTGTTCGG + Intergenic
943661853 2:190567452-190567474 CTCAATGATGTGCCTTGGTGTGG - Intergenic
1172532222 20:35640009-35640031 CTCACTGATGTGAGCCCCTAAGG + Intronic
1175322407 20:58098521-58098543 CCCTCTGATGTGCCTCCAGAAGG - Intergenic
950113370 3:10434811-10434833 CTCACTCATCTGCCTCCTTCTGG - Intronic
952654119 3:35763454-35763476 CTCATTGATGTGCCTCACCAAGG + Intronic
959948088 3:112148878-112148900 CTCACTGGTGTGCCTGGGCATGG + Intronic
960940918 3:122933517-122933539 CACACTGATGTGCCTTAGGACGG + Intronic
964045971 3:152327218-152327240 ATCATTAATGTGCCTCTGTATGG + Intronic
968760909 4:2442463-2442485 GTCACTGCTGTGCCTCCCCAGGG - Intronic
970986982 4:22170478-22170500 CTCACTGTAGTGCCTCCACAGGG + Intergenic
974329727 4:60462630-60462652 TTCACTTATGTGCCTCAGTGTGG - Intergenic
976502118 4:85803222-85803244 CTCACACATGGGCCTCAGTAAGG - Intronic
979338271 4:119488876-119488898 CTCACTCCTGTGTCTCCATATGG - Intergenic
980981343 4:139657057-139657079 TTCACTGATGTGCATCTGTAGGG + Intergenic
987852546 5:23375211-23375233 CTCACTGATGTAGCTACTTAAGG - Intergenic
997742744 5:136271597-136271619 CTAACTGCTGTGCATCCATAGGG + Intronic
1002789185 6:425132-425154 CTCCCTGGTGTGCCTCCGCCAGG + Intergenic
1011830677 6:91367719-91367741 CTTAATGATGTGCTTCTGTAAGG + Intergenic
1017397101 6:154014128-154014150 CTCACTTATTTACCTCCTTAAGG - Intronic
1017873046 6:158502620-158502642 CTCACGGTTGTTCCTCCGCAGGG - Exonic
1021733127 7:23616744-23616766 CTCAGTGATGTGACTGGGTATGG + Intronic
1023072564 7:36451175-36451197 CTCACTGATGTGTTTCCTTACGG + Intronic
1023240367 7:38139487-38139509 CACACTGATGTGGCTCCTAAAGG + Intergenic
1035623797 8:1056004-1056026 CTCCCTGAGCTGCCTCCATAAGG - Intergenic
1036501526 8:9318978-9319000 CTCTCTGTTGTTCCTCCCTAGGG + Intergenic
1042626043 8:70758213-70758235 CTCAAAGCTGTGCCTCCCTAAGG - Intronic
1042865513 8:73353505-73353527 CTCAGGGATGTGCCTCAGTAAGG - Intergenic
1042988080 8:74605360-74605382 CTCACTGATTTGATTCCTTAGGG + Intronic
1046547181 8:115667817-115667839 CTCAGAGACGGGCCTCCGTATGG - Intronic
1051148815 9:14058709-14058731 CTGATTTCTGTGCCTCCGTAGGG - Intergenic
1051674771 9:19547769-19547791 CTCCCTGATTTTCCTCCCTAGGG + Intronic
1055289391 9:74767125-74767147 GTCACAGATGTTCCTCAGTAAGG + Intronic
1056810753 9:89762137-89762159 CACACTGATGTGTCTGCATAGGG - Intergenic
1057004731 9:91547214-91547236 CTCATTGCTGTGCCTCCCGATGG + Intergenic
1185501461 X:599861-599883 CTCACTGATGAGTCTCCGTTGGG + Intergenic
1192222143 X:69204507-69204529 CCCACTGATGTGCCTACATGGGG - Intergenic