ID: 1155874271

View in Genome Browser
Species Human (GRCh38)
Location 18:31065508-31065530
Sequence ACAGCTAGTAAGGATAGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 3, 1: 1, 2: 3, 3: 42, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155874267_1155874271 29 Left 1155874267 18:31065456-31065478 CCTATAAGTAAGGAAACTAAGCA 0: 1
1: 0
2: 2
3: 18
4: 169
Right 1155874271 18:31065508-31065530 ACAGCTAGTAAGGATAGAGCCGG 0: 3
1: 1
2: 3
3: 42
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155874271 Original CRISPR ACAGCTAGTAAGGATAGAGC CGG Exonic
900535923 1:3177430-3177452 ACAGCTAGTCAGGAACGAGCTGG - Intronic
901749866 1:11399391-11399413 GCAGCTGGTAAGGAGCGAGCTGG - Intergenic
903440129 1:23381592-23381614 ACAGCTAATAATGGCAGAGCTGG - Intronic
903993737 1:27291787-27291809 ACTGCTAGTAAGTGCAGAGCTGG - Intronic
904271690 1:29354400-29354422 ACAGGTAGAAAGGTTAGTGCTGG + Intergenic
904282240 1:29428730-29428752 ATATCTGGTAAGGACAGAGCAGG + Intergenic
904483017 1:30805832-30805854 ACAGCTGCTAAGGGTAGAGTTGG - Intergenic
905211627 1:36378309-36378331 ACAGCCAGTAAGGGCAGAGCTGG - Intronic
905561085 1:38927905-38927927 ACAGCTAATAAGGGGAGGGCTGG + Intronic
907613529 1:55898835-55898857 AAAACTAGTAAGGATATAGAAGG - Intergenic
907799964 1:57754774-57754796 ACAGCTAGTGAGAGCAGAGCTGG + Intronic
907811159 1:57871449-57871471 ACAGCTAGTAAGCTTAGAGCTGG + Intronic
907837434 1:58123652-58123674 ACAGCTAGTAAGGGCACACCAGG - Intronic
908097913 1:60759516-60759538 ACAGCTGGTAAGGCCACAGCAGG - Intergenic
910532689 1:88258130-88258152 ACAGCTAGTAAGAAGGAAGCAGG + Intergenic
912560339 1:110547105-110547127 ACAGCTAGTAATGACATAGCTGG + Intergenic
912753198 1:112302481-112302503 ACAGATAATAATGACAGAGCTGG + Intergenic
915232842 1:154458603-154458625 ACAGCTAGTAAGAATAGGCCAGG + Intronic
917407851 1:174727518-174727540 ACAACTAGTAAAGATGGAGATGG + Intronic
917449086 1:175131819-175131841 ACAACTAGTAAGTATAGAACTGG + Intronic
917736406 1:177924855-177924877 ACAGCTAGTAAGGATGGAGCTGG - Intronic
917906865 1:179593391-179593413 ACAGATACTAAGGATAAAGAAGG + Intronic
920196356 1:204229861-204229883 ACAGCTATTAAGTACAGAGCTGG - Intronic
920249073 1:204610426-204610448 ACGACTAATAAGGTTAGAGCTGG - Intergenic
921734706 1:218613764-218613786 ACAGCAAATAAGTATAGAGGAGG - Intergenic
921819407 1:219600217-219600239 AGTGCTAGGAATGATAGAGCAGG + Intergenic
921932665 1:220767863-220767885 ACAGCTGGAAAGGATAGGACTGG - Intronic
922041171 1:221900254-221900276 ACAGCTAGTAAGCAAAGTGGGGG - Intergenic
923044875 1:230348409-230348431 ACAGCTGGTCAGCACAGAGCTGG - Intronic
923295166 1:232587605-232587627 ACAGCTAGTAAGTACAGTGTGGG - Intergenic
924094868 1:240540883-240540905 ACAGTTACTAAGGAGAGAGATGG + Intronic
1063096360 10:2912627-2912649 ACATCTAGCAGGGATAGGGCAGG - Intergenic
1063391333 10:5651629-5651651 ACACCTAGTAAGCACAGAGCAGG + Intronic
1067299002 10:44992654-44992676 GCAGCTAGGAAGGAAAGGGCAGG + Intronic
1067899815 10:50227941-50227963 ACAGAAAGTAAAGTTAGAGCAGG + Intronic
1068668242 10:59698336-59698358 ACAGCAAGTCAGGAAGGAGCAGG - Intronic
1068837669 10:61571967-61571989 ACAGCTAGCTAGAATAAAGCAGG + Intergenic
1070089239 10:73268641-73268663 AGAGCTAGTTAGGGGAGAGCTGG + Intronic
1070646087 10:78203405-78203427 AGAGCTGGTCAGGGTAGAGCAGG - Intergenic
1071978288 10:90977261-90977283 ACAGGAAGTAAGGATTGAGAAGG + Intergenic
1072829708 10:98644844-98644866 ACAGCTTGTAAGGGTAAAACTGG - Intronic
1073461136 10:103666606-103666628 AGAGCTAGTAAGGGCAAAGCAGG - Intronic
1073922411 10:108474101-108474123 ACACATAGTAAGTAGAGAGCTGG - Intergenic
1074287387 10:112110837-112110859 ACAGGTAGTTAGGTGAGAGCAGG - Intergenic
1075555834 10:123431210-123431232 ACAGCTAGCAAGTAGGGAGCTGG - Intergenic
1078179395 11:8998177-8998199 TCAGCTAGTAAGCAAAGAGAAGG - Intronic
1080083119 11:28245181-28245203 ACAGTGAGTAAGGGTAGAGCTGG - Intronic
1081525649 11:43925753-43925775 TCAGCTAGAAAGGGCAGAGCTGG - Intronic
1082815056 11:57502289-57502311 ACAGCTAGTAAGGCTGGTGGTGG - Intronic
1083869880 11:65480240-65480262 ACAGCTAGTAAAAATAAGGCAGG - Intergenic
1085044413 11:73344777-73344799 ACAGCCAGTAAGGGCAGTGCTGG + Intronic
1085260177 11:75200102-75200124 ACAGCCAGTTGGGGTAGAGCTGG - Intronic
1085833875 11:79931583-79931605 ACAGCTAATAAAGGGAGAGCTGG + Intergenic
1087677335 11:101178279-101178301 ACAGCTGGTAAGATGAGAGCTGG - Intergenic
1087873131 11:103324467-103324489 ACAGCAAGGATGGATGGAGCTGG - Intronic
1089994841 11:122896743-122896765 ACAGCAAGCAAGGCTAGTGCTGG + Intronic
1090766232 11:129878600-129878622 ACAGCTAGTAAAGAGAAAGCAGG - Intronic
1091940898 12:4480827-4480849 ACAGCTAGTAATGAAAGTGATGG + Intergenic
1092076208 12:5675714-5675736 ATAGCAAGTAATGACAGAGCTGG - Intronic
1092155141 12:6277307-6277329 ACAGCTAGGAAATATAGTGCAGG - Intergenic
1093543069 12:20310645-20310667 AAAGCTAGCAAGGTTAGAGAGGG + Intergenic
1095821273 12:46481158-46481180 CCAGGTACTGAGGATAGAGCAGG + Intergenic
1098641913 12:72849090-72849112 GTAACTAGTAAGCATAGAGCTGG + Intergenic
1098969753 12:76839287-76839309 ACTGCTAGTACAGGTAGAGCAGG + Intronic
1099344910 12:81487286-81487308 ACAGCTAAAAAAGATGGAGCTGG - Intronic
1100009988 12:89941300-89941322 AGAGCTAGTTAGGATATAGGAGG + Intergenic
1100545172 12:95595056-95595078 ACATCTAGTAAGTGCAGAGCAGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1101806148 12:108065561-108065583 ACAGCTAGAAAGAGCAGAGCTGG - Intergenic
1101918401 12:108913499-108913521 ACAGATAATAAGGATGGGGCTGG + Intronic
1102619723 12:114184339-114184361 ACAGCTAGTCAGGGCAGAGCTGG - Intergenic
1102919483 12:116781124-116781146 ACAGCTAGTCAGTGCAGAGCTGG - Intronic
1103559061 12:121782785-121782807 ACAGCCAGTGAGGGCAGAGCTGG - Intronic
1107070206 13:36260169-36260191 GCAGCTAATAATGGTAGAGCTGG + Intronic
1107980574 13:45730710-45730732 ACAGAGAGTAGGGAGAGAGCTGG - Intergenic
1108252710 13:48582932-48582954 ACAGCTGGGAAGTATAGAGATGG - Intergenic
1109036466 13:57268151-57268173 ACAGGTAGTAAGCATAGTACCGG + Intergenic
1109371268 13:61423038-61423060 ACAGCTAGTAAGGATACCTGAGG - Intronic
1110534952 13:76640151-76640173 ACAGCTAGCAAGGATGTGGCAGG - Intergenic
1110683658 13:78346505-78346527 ACAGCTGGTAATGACACAGCTGG - Intergenic
1111524466 13:89450891-89450913 ACAGGGAGTAAGTATAGATCTGG - Intergenic
1115105662 14:29758484-29758506 CAAGTTAGAAAGGATAGAGCAGG + Intronic
1115885774 14:37970161-37970183 AGAGCTAGTAAGATTAGAGAAGG - Intronic
1116017881 14:39428993-39429015 ACAACTAATAAGGATAAAGAAGG - Intronic
1117281324 14:54243993-54244015 GCAGCTAGTAATGGTAGAGGTGG - Intergenic
1118298180 14:64589730-64589752 ACAGCTACTCAGGCTAAAGCAGG - Intergenic
1119206024 14:72794098-72794120 ACAGCAAGTAAGCAAGGAGCTGG - Intronic
1121201145 14:92119427-92119449 ATAGCTATTAAGTACAGAGCTGG + Intronic
1121340171 14:93100280-93100302 ACAGCTGGTAGGGGCAGAGCTGG - Intronic
1122073151 14:99218402-99218424 ACAACTATTAACGATAGGGCGGG - Intronic
1124038417 15:26078169-26078191 ACAGATGGTGAGGATAGATCTGG - Intergenic
1125222366 15:37353869-37353891 ACCGCTAGTGGGGATAGAGGTGG + Intergenic
1128428825 15:67571762-67571784 ACAGCTAGTCAATAGAGAGCTGG + Intronic
1128536844 15:68498071-68498093 ACAGCTAGAAAGGGCAGAGCTGG + Intergenic
1130006876 15:80107993-80108015 ACAGCTAGTAAGTGAGGAGCTGG - Intronic
1130029686 15:80300728-80300750 TCAGGTAGTAAGCATAGTGCTGG + Intergenic
1131433257 15:92403220-92403242 ACAGCTAGTAAACATGGAGCTGG + Intronic
1133191130 16:4134325-4134347 CCTGCAAGTTAGGATAGAGCTGG + Intergenic
1133610191 16:7426277-7426299 ATTGCTAGTAAGGATTAAGCGGG - Intronic
1133614856 16:7466607-7466629 ACAGCTAGTGAGTGCAGAGCTGG - Intronic
1134782970 16:16915641-16915663 ACAGCTGGTAAGAGCAGAGCCGG + Intergenic
1135175227 16:20221866-20221888 TCAGCAAATAAGGATAGAGGAGG - Intergenic
1135716138 16:24769638-24769660 ACAGCTGGCATGGAGAGAGCAGG - Intronic
1135922864 16:26666862-26666884 ACAGCTAGTAAGGAGAAGGGTGG - Intergenic
1135932264 16:26748061-26748083 AGAACTAATAATGATAGAGCTGG - Intergenic
1137853145 16:51766549-51766571 ACAGAGATTAAGGAAAGAGCTGG + Intergenic
1138773535 16:59693104-59693126 ACAGCTAGTACTTACAGAGCTGG - Intergenic
1140239368 16:73187433-73187455 ATAGCTAGTTAGGAGAGGGCAGG - Intergenic
1140441785 16:74993461-74993483 GCAGCTAGTAAGAGCAGAGCTGG - Intronic
1140746974 16:77989083-77989105 CCAGCTAGTAACTATACAGCTGG - Intergenic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141155959 16:81597420-81597442 ACAGCTATTCAGGAGAGAGCTGG - Intronic
1141700083 16:85638469-85638491 ACAGCAAGGAAGGAAAGTGCTGG - Intronic
1144451549 17:15384192-15384214 GCAGCTGGTGAGGACAGAGCTGG + Intergenic
1144623647 17:16833553-16833575 ACAGCTGGTAAGGGCAGAGCAGG - Intergenic
1144882782 17:18439163-18439185 ACAGCTGGTAAGGGCAGAGCAGG + Intergenic
1144957549 17:19026752-19026774 ACAGCAAGAAAGGTCAGAGCTGG + Intronic
1144977607 17:19147764-19147786 ACAGCAAGAAAGGTCAGAGCTGG - Intronic
1145016948 17:19405276-19405298 ACAGCTATTAATGGCAGAGCTGG - Intergenic
1145149449 17:20505223-20505245 ACAGCTGGTAAGGGCAGAGCAGG - Intergenic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1147577978 17:41613485-41613507 ACAGTTGGTAAGGGCAGAGCAGG - Intronic
1148241263 17:46000767-46000789 ACTGCAAATAGGGATAGAGCTGG - Intronic
1148336286 17:46843634-46843656 CCAGCTAGTAAGCTTAGAACCGG - Intronic
1149454143 17:56773785-56773807 GCAGCTGGTGAGGACAGAGCCGG + Intergenic
1150818698 17:68417202-68417224 ACAGCTAGAGTGGCTAGAGCTGG + Intronic
1152879096 17:82805266-82805288 ACAGCAAGTAGGCGTAGAGCAGG + Intronic
1153747470 18:8194554-8194576 ACAGCTACCATGGATGGAGCTGG - Intronic
1155587541 18:27384753-27384775 ACAGCAAGTAAGGTCTGAGCAGG + Intergenic
1155874271 18:31065508-31065530 ACAGCTAGTAAGGATAGAGCCGG + Exonic
1156378214 18:36533343-36533365 ACAGCTAGAAGGGACAGGGCTGG + Intronic
1156718971 18:40046677-40046699 ACAGGAGGTAAGGATAGAGGTGG - Intergenic
1157113774 18:44844551-44844573 ACAGTTAATAAGGCCAGAGCTGG + Intronic
1157271917 18:46282819-46282841 ACAGCTGGTAAGGGCGGAGCAGG - Intergenic
1160918985 19:1510975-1510997 ACAGCCAGTCAGGGCAGAGCCGG - Exonic
1161266869 19:3368194-3368216 CCAGCTGGTGAGGACAGAGCGGG - Intronic
1161782557 19:6302938-6302960 ACAGATACTGGGGATAGAGCGGG + Intergenic
1163258762 19:16173831-16173853 ACAGCTAGTGGGCAGAGAGCTGG - Intergenic
1164527424 19:29022383-29022405 ACAGCTGGTAAGGGTGGGGCTGG + Intergenic
1165008358 19:32824473-32824495 ACAGCTAGGAGGGCAAGAGCAGG - Intronic
1168147558 19:54428592-54428614 ACAGCTAGAAGTGCTAGAGCTGG + Intronic
1168486530 19:56767377-56767399 ACAACTAGTAATGACAAAGCTGG - Intergenic
925219129 2:2123578-2123600 ACATCTTGTAAGGCCAGAGCAGG - Intronic
926317555 2:11722238-11722260 AAGGCTAGGAAGGATGGAGCTGG - Intronic
926468424 2:13220972-13220994 ACGGCTTGTAAGAATAGAACTGG - Intergenic
927275120 2:21255998-21256020 ACAGCCTGTAAGGATAGTGGAGG + Intergenic
927427598 2:22997928-22997950 AAAGGTAGGAAGGAGAGAGCTGG - Intergenic
928612872 2:33007921-33007943 ACAGCTAGTCAGTGTTGAGCTGG + Intronic
930316203 2:49799859-49799881 AAAGCTAGCAAGGCTGGAGCAGG - Intergenic
930895266 2:56439145-56439167 ACAGCTTGTATGGCTAGAGAAGG + Intergenic
932692002 2:73921283-73921305 ACAGCTGGTAAGCAGAGTGCGGG + Intergenic
932753645 2:74389465-74389487 GCTGCTAGCAATGATAGAGCTGG + Intronic
932850689 2:75181984-75182006 AGAGCTAGTCAGTTTAGAGCTGG + Intronic
935629859 2:105204480-105204502 ACAACTAGTAAGGGCTGAGCTGG - Intergenic
937064268 2:119005481-119005503 ACAGCTAGGAAGGGCAGAGCTGG + Intergenic
937843822 2:126555254-126555276 ACAGCTGGAAAGGAGAAAGCTGG + Intergenic
940663144 2:156572738-156572760 ATAGCTAGTGAGGCTAGAGGAGG + Intronic
941154404 2:161958321-161958343 ACAGCTAAAAATGCTAGAGCTGG + Intronic
941326843 2:164126230-164126252 AAAGGTAGTCAGGATAGAACAGG + Intergenic
942815508 2:180048823-180048845 ACAGCTAGGAGTGATAAAGCTGG + Intergenic
944984456 2:205159519-205159541 ACAGCTAGCAAGGACTGAGCTGG - Intronic
945197534 2:207251316-207251338 ACAGCTAGTAAGTGATGAGCCGG + Intergenic
945775648 2:214103329-214103351 ACAGGTAGTTAGGCAAGAGCTGG - Intronic
946109699 2:217403758-217403780 AAAGCTAGTAAGTGCAGAGCTGG + Intronic
946201274 2:218072225-218072247 ACAGCCAGTAAGGACAGGGCTGG + Intronic
946487026 2:220110608-220110630 ACAGATAGTAATGACAGAGCTGG + Intergenic
946762420 2:223007735-223007757 TCTGCTCGTAAGGAAAGAGCAGG - Intergenic
947019236 2:225656326-225656348 ACAGCTATTAAGTATACAGAAGG - Intergenic
947310637 2:228798053-228798075 ACAGATAGAAAGGACAGAGCAGG - Intergenic
947433847 2:230055101-230055123 ACAGCCAGTAAGTGTAGAACTGG - Intronic
948078789 2:235188599-235188621 ACAGCCAGCAGGGATAAAGCCGG + Intergenic
948454043 2:238096491-238096513 CCAGCTTGTAAGGAAGGAGCGGG + Intronic
948473347 2:238200967-238200989 ACAGTTAGTAAGCGAAGAGCTGG + Intronic
1169779180 20:9290981-9291003 ACACCTAGTTGGGACAGAGCTGG + Intronic
1170207958 20:13819775-13819797 ACAGCAAGTAAGAAAAGTGCTGG - Exonic
1172075150 20:32290395-32290417 AAAACTAGGAATGATAGAGCTGG + Intronic
1172900522 20:38331263-38331285 ACAGTTAGTAAGTATGGAGCAGG - Intronic
1173019423 20:39254655-39254677 ACAGCAAGTAAGTGCAGAGCTGG + Intergenic
1173132854 20:40410932-40410954 ACAGCTAGTAAGGATAGAGCTGG - Intergenic
1173898542 20:46569451-46569473 ACAGCTAGAAAAGATTAAGCTGG - Intronic
1174504310 20:51006967-51006989 ACAGCTAGAGAGGAGAAAGCAGG + Intronic
1175744031 20:61441360-61441382 ACAGCTAGTTGGGGCAGAGCTGG + Intronic
1178500387 21:33121343-33121365 CCAGCCAGTAAGTGTAGAGCTGG - Intergenic
1181889710 22:26051518-26051540 ATAGCTAATAAGGAAAGAGATGG + Intergenic
1182055399 22:27349555-27349577 ACAGGTAGTTAGGAATGAGCAGG - Intergenic
1183042132 22:35189909-35189931 ATAGCTAGTAATGGTAGAACTGG + Intergenic
1183105850 22:35614543-35614565 ACAGCAAGTAAGAAAGGAGCTGG - Intronic
1183355509 22:37356781-37356803 ACAGCTGGTAAGTCCAGAGCAGG + Intergenic
1183743681 22:39681569-39681591 ACAGCCAGGAATGACAGAGCAGG + Intronic
1183757002 22:39777020-39777042 ACAGCTACAAAGCAGAGAGCTGG + Intronic
1184249526 22:43252302-43252324 ACAGCTGGGCAGGACAGAGCCGG - Intronic
950964643 3:17137799-17137821 ACAGCTGGGAAGGAGAGAGCGGG + Intergenic
952377021 3:32776313-32776335 ATACCTAGTAAGGGTAGGGCAGG + Intergenic
955639974 3:61072079-61072101 AGAGCTAGAAAGTAAAGAGCTGG - Intronic
956785646 3:72640092-72640114 ACAGCTAGTAGTGGCAGAGCTGG + Intergenic
957590380 3:82189506-82189528 ACAGATAGAAAGGAAAGAACTGG - Intergenic
960168875 3:114435462-114435484 ACAGCTAGTAGGGACTAAGCTGG + Intronic
961109005 3:124267960-124267982 ACAGTTAATAAGCATAGGGCTGG + Intronic
961511192 3:127404808-127404830 ACAGCTAGTGAGTATGGAGCAGG - Intergenic
961889958 3:130122457-130122479 CCAGCTAATAAGGATAGGTCTGG + Intergenic
961945266 3:130680283-130680305 ACAGCTAGTAAACAGAAAGCTGG - Intronic
962076366 3:132086363-132086385 ACACCTATTAAGAATAGAACTGG - Intronic
962462396 3:135626652-135626674 ACAGCTAATAAAGATATATCAGG - Intergenic
964624802 3:158748780-158748802 ACAGCCAGGAAGGGTAGAGCTGG + Intronic
967017433 3:185494963-185494985 AGAGCTGGTAATGATGGAGCTGG + Intronic
969288474 4:6222932-6222954 ACAGCTAGTGAGAGAAGAGCTGG + Intergenic
969813480 4:9668415-9668437 CCAGCTAATAAGGATAGGTCTGG - Intergenic
970439710 4:16069897-16069919 ACAGCTAGATGGGATACAGCTGG + Intronic
971216198 4:24664297-24664319 ACAGCAACAATGGATAGAGCCGG - Intergenic
971328511 4:25663637-25663659 AGAGGTAGGAAGGAAAGAGCTGG + Intronic
971964600 4:33537012-33537034 ACATCTAGTTTGGTTAGAGCTGG + Intergenic
972053024 4:34764486-34764508 AGAGCTGGAAAGGATGGAGCAGG - Intergenic
972680844 4:41305604-41305626 GCAGCTAATGGGGATAGAGCAGG - Intergenic
974733976 4:65904150-65904172 ACAACTAGTAAACATAGAACTGG - Intergenic
975630730 4:76399658-76399680 ACAGCTATGAAGGAGAGATCAGG + Intronic
975831669 4:78375407-78375429 ACAGCTGGGAAGGTTAGAGGAGG + Intronic
976196873 4:82540958-82540980 ACAGCTAGTAGAGACAGAGCTGG - Intronic
976220117 4:82749979-82750001 ACAGCTAATAAACGTAGAGCTGG - Intronic
976873608 4:89827161-89827183 ACAGCTGGTAAGGAGTAAGCAGG + Intronic
977835548 4:101641744-101641766 ACAGTCACTAAGGAGAGAGCAGG - Intronic
979386346 4:120069348-120069370 ACAGCTTATAAGGATAAAGGAGG + Intergenic
979980258 4:127246568-127246590 ACAGCTAGTAAGGACAGACGTGG + Intergenic
981074807 4:140580373-140580395 ACAGCTGGTTAGGATAGTGTTGG + Intergenic
982127805 4:152199527-152199549 ACTGCTAGTAAGGGTGGAGCTGG - Intergenic
982460605 4:155665261-155665283 ACAGTCAGAAAGGATAGAGGAGG + Intergenic
987147337 5:15005153-15005175 AAAGAAAGAAAGGATAGAGCAGG - Intergenic
989749910 5:44881025-44881047 AGAACTTGTAAGTATAGAGCTGG + Intergenic
992483280 5:77171973-77171995 AAAGCTAGAAAGGATTGTGCTGG - Intergenic
995070193 5:107912306-107912328 ATAGCTAGTAAGTCCAGAGCTGG + Intronic
997302683 5:132817929-132817951 ACAGCTAGTAAATGCAGAGCTGG + Intergenic
997710617 5:136001179-136001201 ACAGCAAGTAAGCAGAGAACTGG + Intergenic
999115150 5:149156267-149156289 ACAGCTAATAAGGGTCAAGCTGG - Intronic
999273214 5:150310334-150310356 ACAGCTAGGAAGGGTGGAGCTGG - Intronic
999923642 5:156350907-156350929 ACAGCTAGTAAGTAAAACGCTGG + Intronic
1000129491 5:158282280-158282302 ACAGCTAGTAAGTGTAGAAGTGG + Intergenic
1001044456 5:168361189-168361211 ACAGCTAGGAAGGATGGAACTGG + Intronic
1001825349 5:174740658-174740680 ACAGCTAGTTTGGAAAGAGAGGG + Intergenic
1002576677 5:180177837-180177859 ACAGGAAGTAAGTATGGAGCTGG + Intronic
1002783668 6:385178-385200 GCATCTAGAAAGGACAGAGCAGG + Intergenic
1003520422 6:6853953-6853975 AAAGCTAATGAGGACAGAGCTGG + Intergenic
1003638378 6:7855486-7855508 ACAGCCAGCAAGGGCAGAGCTGG - Intronic
1006717230 6:36128342-36128364 ACAGCTGGTAAGGGCAGAGCTGG - Intronic
1006852583 6:37109722-37109744 ACAGCTAGTTAGGGCAGAGGTGG + Intergenic
1006921077 6:37627560-37627582 ACAGCTGCAAAGGCTAGAGCTGG - Intergenic
1007270815 6:40635566-40635588 ACAGCTAGAAAGGAGAGAGAGGG - Intergenic
1007812819 6:44498283-44498305 ACAGCTAGGAAGTAGGGAGCTGG + Intergenic
1009566245 6:65314375-65314397 AGTGCTAGGAATGATAGAGCAGG - Intronic
1010059526 6:71606553-71606575 GCAGCTGGGAATGATAGAGCTGG - Intergenic
1011063589 6:83299314-83299336 ACAGCTAGCAAGGAAAGCGAAGG - Intronic
1014298510 6:119650926-119650948 ACATCTAGTAGGGAAGGAGCTGG + Intergenic
1014946857 6:127509102-127509124 ACAGCAAGAAAGCATAGTGCTGG + Intronic
1018714926 6:166524832-166524854 ACAGCTCGTGGGGTTAGAGCTGG + Intronic
1019688848 7:2398413-2398435 GCAGCTAGAATGGATAGGGCAGG - Intergenic
1019856048 7:3609369-3609391 AGAGCTAGTCAGGGGAGAGCTGG + Intronic
1020004078 7:4772420-4772442 ACAGCTGGTAAGGACACAGTAGG - Intronic
1021346942 7:19540420-19540442 ACTGCTACTAAAAATAGAGCAGG + Intergenic
1022477302 7:30719972-30719994 AGGGCTAGGTAGGATAGAGCTGG - Intronic
1022525110 7:31032142-31032164 ACAGGGAGTAAGCATAGAGTTGG + Intergenic
1022872106 7:34490436-34490458 TCAGCTTGTAAGGAAAGAGTGGG - Intergenic
1022943673 7:35261772-35261794 ACAGCTGCTAAGGATGGAGTGGG - Intergenic
1025851367 7:65247414-65247436 ACAGCTACCAAGGAGAGAGATGG - Intergenic
1027045052 7:74985653-74985675 ACAGTTAGTGAGGGCAGAGCTGG - Intronic
1028526060 7:91788276-91788298 ACAGGTAGCAAGGATAAGGCTGG - Intronic
1029387803 7:100255257-100255279 ACAGTTAGCAAGGGCAGAGCTGG + Intronic
1031427351 7:121621692-121621714 AAAGCTTGTTAGGCTAGAGCAGG + Intergenic
1033972906 7:147065122-147065144 ATAGCTAATAAGGGAAGAGCTGG - Intronic
1034080960 7:148277344-148277366 ACAGCAAGTAAGCAAAGGGCAGG - Intronic
1034472537 7:151263127-151263149 AGAGCTAGTAGGGGTAGAGCTGG + Intronic
1037357609 8:18039139-18039161 ACTACTAGAAGGGATAGAGCAGG + Intergenic
1037411250 8:18600125-18600147 ACAGCTGGTCAGGATGCAGCAGG + Intronic
1038416459 8:27399832-27399854 ACAACCAGTAAGGATGGAGCAGG - Intronic
1039579065 8:38649186-38649208 CCATATAGCAAGGATAGAGCAGG + Intergenic
1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG + Intronic
1042655256 8:71088776-71088798 ACAGCCAGGAAGAATGGAGCTGG - Intergenic
1042864939 8:73348929-73348951 ACGGCTAGTAAGTTTGGAGCTGG + Intergenic
1042937158 8:74071089-74071111 ACAGCTAGCAAGCATAGGGCAGG + Intergenic
1043196852 8:77305051-77305073 ACAGCTAGTAAGGATAGAGCTGG + Intergenic
1044343613 8:91076631-91076653 ACAGCTGGTAAGAGCAGAGCAGG - Intronic
1044384621 8:91572885-91572907 ACACCTAGTAAGGGAATAGCTGG - Intergenic
1046918349 8:119700929-119700951 ACACCTAGAAAGCAGAGAGCTGG + Intergenic
1047298780 8:123594803-123594825 ACAGCTAATAATGGTAGAACTGG - Intergenic
1048269129 8:133014179-133014201 ACAGCTAATGATGATGGAGCTGG + Intronic
1048743956 8:137592408-137592430 ACAGCTTGAAAGGGCAGAGCTGG - Intergenic
1049414767 8:142490128-142490150 ACAGCTAGAAAGGACAGGGCTGG - Intronic
1050255197 9:3786479-3786501 AGAGCTATTAAGGATAGAAAAGG - Intergenic
1050981918 9:12030055-12030077 ACAGCAAGTAAGGAAAGAATCGG - Intergenic
1056435263 9:86569680-86569702 ACAGCTAGTCAGGCATGAGCAGG - Intergenic
1056739286 9:89239479-89239501 TCAGCTAGTAAGTACAGAGCTGG - Intergenic
1057931078 9:99193656-99193678 ACCACTAGAAAGGATAGAACTGG - Intergenic
1058453766 9:105120430-105120452 ATAGCTAGTAAGGACAGGCCAGG + Intergenic
1059050188 9:110916290-110916312 ACAGCTAGGAATGACGGAGCTGG + Intronic
1059410121 9:114126688-114126710 TCAGCCAGTCAGGAAAGAGCAGG - Intergenic
1059541183 9:115132143-115132165 ATAGCTAGTAAGGACTGAGATGG - Intergenic
1060297706 9:122354620-122354642 ACAGCTAGTAAGGGCCGAGGCGG + Intergenic
1187601794 X:20839422-20839444 ACTGCTAGCAGGGAGAGAGCAGG - Intergenic
1187972145 X:24669685-24669707 CAAGATAGCAAGGATAGAGCTGG - Intronic
1187993496 X:24901049-24901071 ACAGCCAGTAGGTATACAGCAGG + Intronic
1188415158 X:29924004-29924026 ACAGCTAGTAAGAACAGAGTTGG - Intronic
1188442256 X:30223932-30223954 ACTGCTAGTAATGACAGGGCTGG + Intergenic
1188961132 X:36492952-36492974 ACAGGTAATAAGGACAGAGTTGG - Intergenic
1189785447 X:44555196-44555218 AAAGCTAGGAAGGACAGAGCTGG - Intergenic
1189785912 X:44558677-44558699 AAAGCTAGGAAGGACAGAGCTGG + Intergenic
1191869565 X:65734456-65734478 ACAGCTAAAAATGGTAGAGCTGG + Intronic
1192019394 X:67369205-67369227 ATAGCTAGTAATGGTAGTGCTGG - Intergenic
1192232605 X:69276373-69276395 ACAGCTAGTAATGGCAGAGCTGG + Intergenic
1192961247 X:76133399-76133421 ATAGCTAGTAATGATATTGCTGG - Intergenic
1195990089 X:110673664-110673686 ACGGCTGGTAAGTACAGAGCTGG + Intergenic
1197394539 X:125910595-125910617 AAAGCTATTAAGAATAGAGAAGG + Intergenic
1198581097 X:138065437-138065459 ACAGCTAGTAAGAACAGAGCTGG + Intergenic
1199676264 X:150191809-150191831 ACAGCTAATAAAAACAGAGCTGG + Intergenic
1202327890 Y:23711318-23711340 ATAGCTAGTATGGATAGAAATGG + Intergenic
1202542880 Y:25958734-25958756 ATAGCTAGTATGGATAGAAATGG - Intergenic