ID: 1155880887

View in Genome Browser
Species Human (GRCh38)
Location 18:31146701-31146723
Sequence CATGAACACTTATATGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155880887_1155880890 -6 Left 1155880887 18:31146701-31146723 CCAATGGCATATAAGTGTTCATG 0: 1
1: 0
2: 5
3: 22
4: 174
Right 1155880890 18:31146718-31146740 TTCATGGACCATTTTTGAATGGG 0: 1
1: 0
2: 3
3: 48
4: 497
1155880887_1155880889 -7 Left 1155880887 18:31146701-31146723 CCAATGGCATATAAGTGTTCATG 0: 1
1: 0
2: 5
3: 22
4: 174
Right 1155880889 18:31146717-31146739 GTTCATGGACCATTTTTGAATGG 0: 1
1: 0
2: 2
3: 18
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155880887 Original CRISPR CATGAACACTTATATGCCAT TGG (reversed) Intronic
901539695 1:9907976-9907998 CAAGAACAGTTAGAGGCCATTGG - Intronic
910663994 1:89704800-89704822 CAGGAACACTTTTATGCTATTGG + Intronic
911789851 1:102000660-102000682 CATGGACACTTCTATGATATGGG - Intergenic
911800840 1:102135666-102135688 CAGGAACACTTTTACACCATCGG + Intergenic
911814580 1:102330039-102330061 CAAGAACAGTTATATCCCTTTGG - Intergenic
912950990 1:114120171-114120193 CATCAACACCTCTATGCCTTCGG - Intronic
914415163 1:147473512-147473534 CTTGAACACTTAGAGGCCATTGG - Intergenic
916330320 1:163608924-163608946 CATTAAAACTGATTTGCCATTGG - Intergenic
916774043 1:167941281-167941303 TATGATTACTTATATGCCTTTGG - Intronic
917214199 1:172661037-172661059 CAAGACCACTGGTATGCCATTGG + Intronic
917374319 1:174332702-174332724 CAGGAACTCTTATATGCTATTGG + Intronic
918556148 1:185801741-185801763 CTTGCACACTTTTATTCCATAGG - Intronic
919296023 1:195701429-195701451 CATGCACATTTGTCTGCCATGGG - Intergenic
919488873 1:198179556-198179578 CATGAACACTTCTATTCTGTTGG - Intronic
921749987 1:218781153-218781175 TATGAACAATTATAAGGCATTGG - Intergenic
1063771695 10:9210623-9210645 AATGAACATTTATGTGCCAAAGG - Intergenic
1064837390 10:19548794-19548816 CTTGAACACTTAAAGACCATTGG - Intronic
1066399902 10:35066147-35066169 TATGAACTCTATTATGCCATGGG + Intronic
1068285220 10:54924557-54924579 AAAGAACACTTATATGCTATGGG - Intronic
1068416314 10:56727483-56727505 TAGGAACACTTTTATACCATTGG - Intergenic
1068532152 10:58201637-58201659 ATTGAACACTTAGAGGCCATTGG - Intronic
1068699618 10:60005972-60005994 GATGAAAACTCAAATGCCATTGG - Intergenic
1071877298 10:89854815-89854837 CATGAACACTTACAACCCAGGGG - Intergenic
1075179501 10:120197175-120197197 TTTGAACACTTAGAGGCCATTGG + Intergenic
1084388230 11:68857816-68857838 TATGTACACATATATCCCATAGG - Intergenic
1086338750 11:85826101-85826123 CATGAACATTGATATTCCCTGGG + Intergenic
1088119716 11:106353479-106353501 CATGAACACTAAAATTTCATTGG - Intergenic
1088425892 11:109702002-109702024 AAGGAACATTTATATGCTATTGG + Intergenic
1093502157 12:19825803-19825825 AGGGAACACTTATATACCATTGG + Intergenic
1093708038 12:22296878-22296900 CATGAACACCTATACTCCACTGG + Intronic
1094779954 12:33779255-33779277 AATGAACACTTAAATGGAATAGG - Intergenic
1095194827 12:39301553-39301575 CATGGATACTTTTATGCCAGTGG - Exonic
1096033606 12:48443563-48443585 CATGATCACTTACATAGCATTGG - Intergenic
1097521383 12:60674800-60674822 AATGGACACTTATATGCTGTTGG - Intergenic
1097659503 12:62413945-62413967 CCTGAACATTTAGAGGCCATTGG + Intronic
1099052313 12:77794981-77795003 CTTGAACACTTAGAGGCCACTGG - Intergenic
1099432630 12:82606093-82606115 CATTTACACTTATTTGGCATGGG + Intergenic
1099692235 12:85971515-85971537 GATAAACACTTTTCTGCCATGGG - Exonic
1100076677 12:90793200-90793222 CAGGAACGTTTTTATGCCATTGG - Intergenic
1100791186 12:98131965-98131987 CTTGAACACTTAGAGGCCATTGG + Intergenic
1105295978 13:19088253-19088275 TATGAGTACTTATATGCCCTAGG - Intergenic
1106164181 13:27227609-27227631 CATCTACACTTATATGCAATAGG - Intergenic
1106350774 13:28928610-28928632 GGGGAACCCTTATATGCCATTGG + Intronic
1106878618 13:34104673-34104695 CCTGAACATTTAGATCCCATGGG + Intergenic
1110300164 13:73916983-73917005 CATGCACACTAATATTCCGTAGG + Intronic
1110603796 13:77407863-77407885 CATGACCAGTGATATGCCATAGG - Intergenic
1112286395 13:98108227-98108249 CATGCACACTTCTATGCCACTGG + Intergenic
1112604786 13:100893649-100893671 CACGAACACTTTTATACGATTGG + Intergenic
1116605418 14:46987191-46987213 GATGAACACTAATATGCCCACGG + Intronic
1121976928 14:98413551-98413573 CATGAACTTTTATATTCCAATGG - Intergenic
1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG + Exonic
1126646815 15:50883013-50883035 GATGAACACATATATGACAGTGG + Intergenic
1128203081 15:65826801-65826823 CTTGAACACCTATATGCAAAAGG - Intronic
1129154339 15:73708503-73708525 CATGCACACTTATGTGTCTTGGG + Intronic
1135172531 16:20198958-20198980 AAGGAACACTTATATGCTGTTGG - Intergenic
1138087160 16:54143691-54143713 CATGTCCACTCATATGCCTTTGG + Intergenic
1141998640 16:87650446-87650468 CATGAACACTTAGAGACCATTGG - Intronic
1145717559 17:27036602-27036624 CATGAACAATTAGAGGCCACTGG + Intergenic
1146092970 17:29900656-29900678 TAGGAACACTTTTATGCTATTGG + Intronic
1146423708 17:32715189-32715211 CAGGAACACTTTTATACTATTGG + Intronic
1148956063 17:51354743-51354765 CATGACCAGTTACAGGCCATTGG + Intergenic
1149058999 17:52399516-52399538 AGGGAACACTTATATGCAATTGG + Intergenic
1149400685 17:56293003-56293025 CATGCCCATTTATATGCCAATGG + Intronic
1153175445 18:2367065-2367087 CTTGAACACTTAGATGCCATGGG - Intergenic
1154471022 18:14701538-14701560 CATGAACACTTAGAGGCCACTGG - Intergenic
1155880887 18:31146701-31146723 CATGAACACTTATATGCCATTGG - Intronic
1156414573 18:36874301-36874323 CAGGAACACTTTTACACCATTGG - Intronic
1158206191 18:54995745-54995767 TCTGAACACTTAAATGTCATTGG - Intergenic
1159332110 18:67009294-67009316 CTTGAACACTTAGAGGCCATTGG + Intergenic
1160053925 18:75462073-75462095 CATGCACACATAGATGCCCTTGG + Intergenic
926368470 2:12155722-12155744 TATGAACAATTCTATGGCATCGG + Intergenic
930811851 2:55550678-55550700 CATGAAAACTTATGTCCTATAGG + Intronic
931720679 2:65065554-65065576 CATGACCAGAAATATGCCATAGG - Intronic
931848570 2:66230365-66230387 CTGGAACACTTCTAGGCCATGGG + Intergenic
933323043 2:80801054-80801076 CAAGAACTGTTCTATGCCATGGG + Intergenic
933706290 2:85293131-85293153 CATGTCCACTAATATTCCATTGG + Intronic
936838514 2:116739888-116739910 CATGAAGACTTAGATCCAATGGG + Intergenic
937768399 2:125689074-125689096 TATGAACCCTTCTATGACATGGG + Intergenic
940024029 2:149186052-149186074 CTTGAACACTTAGAGGCCATAGG - Intronic
940040515 2:149355071-149355093 CAGGAACAGTTTTATCCCATAGG - Intronic
941378132 2:164756137-164756159 CATGAGCACTTATTTTCCTTTGG + Intronic
943611519 2:190040137-190040159 AAGGAACACTTATACGCCGTTGG - Intronic
943875219 2:193058692-193058714 AAGGAACACTTATATGCTGTTGG - Intergenic
944026569 2:195176818-195176840 CAGGAACACTTTTATGCTGTTGG - Intergenic
944529611 2:200654458-200654480 CATAAACACTTGTATGCACTGGG + Intronic
945148064 2:206759550-206759572 AAGGAACACTTATAGGCTATTGG - Intronic
946140426 2:217685798-217685820 TATGCACACTTATGTGACATAGG - Intronic
946671637 2:222110924-222110946 CATGCACATTTATTTGCCTTGGG - Intergenic
947522997 2:230862920-230862942 CAAGAATACATATATTCCATTGG - Intergenic
948346810 2:237305626-237305648 CATGTACCCTTACATGTCATTGG - Intergenic
1169956047 20:11104111-11104133 AATGAACACTTACATGCTGTTGG + Intergenic
1173272327 20:41549020-41549042 CAGGAACACTTTTACACCATTGG + Intronic
1174886725 20:54343922-54343944 CATGAACACTTATTTATCTTTGG + Intergenic
1175022984 20:55871207-55871229 AAGGAACACTTATATGCTGTTGG + Intergenic
1176803462 21:13456396-13456418 CATGAACACTGAGAGGCCACTGG + Intergenic
1177691712 21:24518724-24518746 AAGGAACACTTTTATGCTATTGG + Intergenic
1178336193 21:31745641-31745663 CATGTTCACTCATATCCCATTGG + Intergenic
1181132924 22:20744329-20744351 AACAAACACTTACATGCCATAGG - Intronic
1181773572 22:25144053-25144075 CCTGAACAATTCTATGACATTGG - Intronic
949252231 3:1999613-1999635 CATGAACATTTAAATGACCTTGG - Intergenic
949270202 3:2207254-2207276 CTTGAACACTTCAAGGCCATTGG - Intronic
949615394 3:5748311-5748333 CATCAACTCTTATGTGTCATGGG + Intergenic
951306639 3:21071196-21071218 CCTGAACACTTACATGCCATTGG - Intergenic
955019739 3:55107660-55107682 AATAAGGACTTATATGCCATTGG - Intergenic
956384946 3:68706488-68706510 CAAGAACACCTTTATGCCCTGGG - Intergenic
956707861 3:72014838-72014860 CATGACCACTAATATGCCACTGG - Intergenic
958519343 3:95163723-95163745 TATGAACCCTTTTATGCTATTGG + Intergenic
959866932 3:111281583-111281605 CATGAATACTGACATGACATAGG + Intergenic
960646165 3:119886416-119886438 AGGGAACACTTATATGCTATTGG + Intronic
960756006 3:121013308-121013330 AGGGAACACTTATATACCATTGG - Intronic
960984959 3:123271967-123271989 GAAGAACAGTCATATGCCATTGG + Exonic
961366802 3:126405321-126405343 CACATACACTTATATGCCCTTGG - Intronic
963206766 3:142644155-142644177 CATTAATGTTTATATGCCATGGG - Intronic
963587796 3:147214909-147214931 AATAAACACTTATATCCCGTTGG - Intergenic
964984232 3:162719318-162719340 CAAGAACATGTATATGCCAATGG - Intergenic
965565247 3:170109303-170109325 CATTTACAGTCATATGCCATTGG - Intronic
970732861 4:19127616-19127638 TATGTATACTTATACGCCATAGG - Intergenic
970925427 4:21446151-21446173 CAGGAACACTTTTATGCTGTTGG + Intronic
973056247 4:45662651-45662673 CATGAACAATTTTATTTCATTGG + Intergenic
973203098 4:47527764-47527786 CTTGAACACTCATATGCTACTGG + Intronic
973911506 4:55585821-55585843 TATGAACAGTTACATGCCAATGG - Intronic
976485137 4:85593069-85593091 AAGGAACCCTCATATGCCATTGG - Intronic
976517290 4:85983389-85983411 TAGGAACACTTTTATGCTATTGG - Intronic
976916743 4:90385344-90385366 AAGGAACACTTATATACTATTGG - Intronic
977143039 4:93399570-93399592 CATGAAGACTGATAAGGCATGGG + Intronic
978131224 4:105200157-105200179 AAGGAACACTTATATGCTATTGG - Intronic
979837027 4:125383280-125383302 CATGAACACTTAGAGGCCATTGG + Intronic
980314207 4:131175260-131175282 CATGAACATTTAGATGGCAGAGG + Intergenic
982063716 4:151631338-151631360 CATGAGCAACTATATGCCAAAGG + Intronic
982982061 4:162150756-162150778 CATGAACACTTTTAAGTAATAGG - Intronic
983177112 4:164602873-164602895 AAGAAACACTTATATACCATTGG + Intergenic
984883817 4:184432334-184432356 AAAGAACACTTGTCTGCCATAGG - Intronic
985214665 4:187638096-187638118 AAGGAACACTTTTATACCATTGG - Intergenic
988192275 5:27954664-27954686 CTTGAAGACTTTTTTGCCATTGG + Intergenic
988431618 5:31125617-31125639 CTTGAACACTTAGAGACCATTGG - Intergenic
988434257 5:31154983-31155005 CAAGAAAACTTATATGCAAGGGG - Intergenic
988714769 5:33814611-33814633 CATCTACACTTATATTCCCTGGG - Intronic
990144770 5:52746724-52746746 CATGAAAACTTATATCCAAATGG + Intergenic
991123762 5:63046271-63046293 CATGACCAGAAATATGCCATAGG - Intergenic
993071223 5:83166434-83166456 CAGGAACACTTATATACTGTTGG - Intronic
994281794 5:97913047-97913069 AATGAACTCTTAGATGCCACAGG + Intergenic
997290021 5:132724174-132724196 CAGGAACACTTTTACACCATTGG + Intronic
998729644 5:145060331-145060353 AATGAACGCTTATATGCTGTTGG - Intergenic
1000203267 5:159032714-159032736 CATGAACAGTATTATGACATTGG + Intronic
1005178086 6:23070866-23070888 AGGGAACACTTATATACCATTGG - Intergenic
1008855882 6:56086809-56086831 CATGGACACTTCTATGATATGGG - Intronic
1009678183 6:66854735-66854757 CATATACACTTATATCCCATTGG + Intergenic
1010073109 6:71767568-71767590 CATTAACACTTAGATGTGATAGG + Intergenic
1011804441 6:91055375-91055397 GAAGAACACTCATATGCTATTGG - Intergenic
1011878766 6:91996613-91996635 AATGAACACTTATACACTATTGG + Intergenic
1012518539 6:100092636-100092658 CATCACCACTTATGTGCTATGGG - Intergenic
1012813053 6:103985430-103985452 CTTGAACACTTGTATGTAATGGG - Intergenic
1017461025 6:154650568-154650590 CTTGAACACTTAGAGGCCACTGG + Intergenic
1017674963 6:156803948-156803970 AATGAACACTTATTTCACATTGG - Intronic
1018957504 6:168419932-168419954 CACGAACTATTATATGCCACTGG - Intergenic
1021401379 7:20213302-20213324 AAGGAACGCTTATATGCCATTGG + Intronic
1022688793 7:32624618-32624640 CAGGAACACTTTTATACTATTGG + Intergenic
1028097325 7:86777504-86777526 CAACAACTCTTACATGCCATGGG - Intronic
1028305519 7:89259046-89259068 CATGAACCCTTCTATGATATGGG - Intronic
1029820850 7:103145372-103145394 CATGTACATTTATATACAATCGG + Intronic
1030446155 7:109648290-109648312 TATGAATACTTAAATTCCATAGG + Intergenic
1030512107 7:110495184-110495206 CATGAACACTTCTAGGCCAATGG - Intergenic
1032415286 7:131730888-131730910 CACAAACACTTATACACCATTGG - Intergenic
1033046429 7:137966696-137966718 GATGAACTCTCATATGGCATAGG - Intronic
1037599599 8:20382878-20382900 CATGCACCCTCATAAGCCATGGG - Intergenic
1037954650 8:23045298-23045320 TATGAACAATTATATGCCAAAGG + Intronic
1038945909 8:32359920-32359942 CATCAACACTCATATGCCATTGG - Intronic
1039801694 8:40963110-40963132 AAGGAACACTTATATGCTGTTGG + Intergenic
1040383838 8:46899485-46899507 TAGGAACACTTTTATGCTATTGG + Intergenic
1040942543 8:52847327-52847349 CAGGAACACTTTTATGCCGTTGG - Intergenic
1042419407 8:68567950-68567972 CTTGAATACTTAGAGGCCATTGG + Intronic
1044123063 8:88422157-88422179 CATAAACAATTATATGCTAAGGG - Intergenic
1044773187 8:95659250-95659272 CATGAACAGGTAGATGCCAGAGG - Intergenic
1044874737 8:96654014-96654036 CATGAACGCTTCTATGATATGGG - Intronic
1046005725 8:108480910-108480932 TATGAAGACTTCTAGGCCATTGG + Intronic
1046041979 8:108916746-108916768 AAGGAAGAGTTATATGCCATGGG + Intergenic
1046233276 8:111386434-111386456 CAGGAACACCTATATTTCATAGG + Intergenic
1046261111 8:111768895-111768917 GATGAAGACTTCTATGGCATTGG + Intergenic
1050003617 9:1104254-1104276 AAGGAACACTTACATACCATTGG - Intergenic
1051312368 9:15790213-15790235 CAGGAACACTTTTACACCATTGG - Intronic
1051820379 9:21159001-21159023 TATGAAAACCTAGATGCCATTGG - Intergenic
1052291218 9:26843746-26843768 CATAAACAATTATACTCCATTGG + Intronic
1052707850 9:32014785-32014807 AAGGAACACTTATACACCATTGG - Intergenic
1059852383 9:118358066-118358088 CATGAACAATTGTATGCCTAAGG + Intergenic
1060897684 9:127228417-127228439 CAGGCACACTCATATGCCCTTGG - Intronic
1186118074 X:6326160-6326182 TATGAACATTTATATGCAAAAGG + Intergenic
1186395300 X:9202273-9202295 CATGAACACTTAGACGCCATTGG - Intergenic
1187264767 X:17720854-17720876 CATGAACACTTGTATGCACATGG - Intronic
1188343558 X:29035696-29035718 CATGAACATTAATATAGCATTGG + Intronic
1190795018 X:53732834-53732856 CATGGACCCTTCTATGACATGGG + Intergenic
1191816397 X:65250550-65250572 TAGGAACACTTTTATGCCATTGG - Intergenic
1192697046 X:73428368-73428390 AGTGAACACTTATAAACCATTGG - Intergenic
1193514842 X:82450929-82450951 CAAGAACACTTTTACACCATTGG + Intergenic
1193867260 X:86749389-86749411 CTTGAACACTTAGAGGCCACTGG + Intronic
1195857377 X:109345869-109345891 CATGAACATTTATGTGTTATGGG + Intergenic
1195867315 X:109447153-109447175 CAGGAACACTTTTACACCATTGG + Intronic
1198150818 X:133907151-133907173 CATGAACACTTTTAGGTCAGGGG - Intronic
1198546810 X:137701265-137701287 CATGAACACATGCATCCCATAGG + Intergenic
1198884511 X:141319670-141319692 CATGAACATTTATCTACCATTGG - Intergenic
1199685299 X:150260045-150260067 CATGAGCTTTTATATTCCATGGG + Intergenic
1199844834 X:151683930-151683952 AATGAACACTTTTATGCACTGGG + Intergenic
1201479503 Y:14424575-14424597 CATGAACATTTATATGCAAAAGG - Intergenic