ID: 1155883698

View in Genome Browser
Species Human (GRCh38)
Location 18:31182242-31182264
Sequence CTTGAAGCTCGTTCTCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155883698_1155883702 14 Left 1155883698 18:31182242-31182264 CCAAAGGGAGAACGAGCTTCAAG No data
Right 1155883702 18:31182279-31182301 ACTATAGTCATTAGGATTCCTGG No data
1155883698_1155883703 27 Left 1155883698 18:31182242-31182264 CCAAAGGGAGAACGAGCTTCAAG No data
Right 1155883703 18:31182292-31182314 GGATTCCTGGATCAGACAAGAGG No data
1155883698_1155883700 6 Left 1155883698 18:31182242-31182264 CCAAAGGGAGAACGAGCTTCAAG No data
Right 1155883700 18:31182271-31182293 TAGTGGCCACTATAGTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155883698 Original CRISPR CTTGAAGCTCGTTCTCCCTT TGG (reversed) Intergenic
No off target data available for this crispr