ID: 1155888974

View in Genome Browser
Species Human (GRCh38)
Location 18:31242969-31242991
Sequence CTTGAGCTGCACAGAGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155888972_1155888974 11 Left 1155888972 18:31242935-31242957 CCACCTGAAACTAACTAGCACAC No data
Right 1155888974 18:31242969-31242991 CTTGAGCTGCACAGAGACCCAGG No data
1155888973_1155888974 8 Left 1155888973 18:31242938-31242960 CCTGAAACTAACTAGCACACAAT No data
Right 1155888974 18:31242969-31242991 CTTGAGCTGCACAGAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155888974 Original CRISPR CTTGAGCTGCACAGAGACCC AGG Intergenic
No off target data available for this crispr