ID: 1155889976

View in Genome Browser
Species Human (GRCh38)
Location 18:31255599-31255621
Sequence ATGGAGTCCTGGAAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155889976_1155889985 16 Left 1155889976 18:31255599-31255621 CCTTCCCTCTTCCAGGACTCCAT No data
Right 1155889985 18:31255638-31255660 TATGGTCCACACATGTCCACAGG No data
1155889976_1155889981 -2 Left 1155889976 18:31255599-31255621 CCTTCCCTCTTCCAGGACTCCAT No data
Right 1155889981 18:31255620-31255642 ATTCCAGCTCCCTGTCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155889976 Original CRISPR ATGGAGTCCTGGAAGAGGGA AGG (reversed) Intergenic
No off target data available for this crispr