ID: 1155895389

View in Genome Browser
Species Human (GRCh38)
Location 18:31318687-31318709
Sequence CTAAATATCACAAGTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155895389 Original CRISPR CTAAATATCACAAGTGTGTC TGG Intronic
902116973 1:14129262-14129284 CCAAAGACCAAAAGTGTGTCCGG - Intergenic
904935300 1:34125948-34125970 CTGAATATCACTAGGATGTCAGG - Intronic
912296067 1:108472114-108472136 CCAAATATTAGAAATGTGTCAGG - Intergenic
912374528 1:109199517-109199539 CAAAATGTCACAAGTCTGTGGGG + Intronic
912514354 1:110208779-110208801 AGAAATATCCCAAGTGTGACTGG - Intergenic
913590160 1:120316708-120316730 AAAAACATCCCAAGTGTGTCTGG - Intergenic
913618024 1:120581656-120581678 AAAAACATCCCAAGTGTGTCTGG + Intergenic
914397431 1:147283962-147283984 CTGAATATTAAAAGTGTGTTTGG + Intronic
914572190 1:148928567-148928589 AAAAACATCCCAAGTGTGTCTGG - Intronic
914600648 1:149201698-149201720 AAAAACATCCCAAGTGTGTCTGG + Intergenic
921093927 1:211870777-211870799 ATAAATATCACTGATGTGTCAGG + Intergenic
924434245 1:244024683-244024705 CTAAATAGCAGGAGGGTGTCGGG - Intergenic
1063817479 10:9792172-9792194 CTAAATATCACAAATGGGATAGG + Intergenic
1065565706 10:27006512-27006534 CTAGATATTACTAGTGAGTCTGG + Intronic
1076544200 10:131232999-131233021 TTAAATATCACAAGTAGGTCTGG + Intronic
1077246031 11:1539029-1539051 CTAAATAATACACGTGTGGCCGG - Intergenic
1079275647 11:19034444-19034466 CTAAAAATCACATGGGTGGCCGG + Intergenic
1079914700 11:26353961-26353983 TTAAATATCAACTGTGTGTCAGG - Intronic
1080547798 11:33338160-33338182 CTACATATCCCAAGTGTGCTAGG + Intronic
1082735103 11:56846481-56846503 CAAAAGATCAAAAGTGTGTCTGG - Intergenic
1085693631 11:78685871-78685893 CATAATATCACAAGTGGGTTGGG - Intronic
1085940501 11:81201130-81201152 CTAAACATCACTGGTGAGTCAGG + Intergenic
1086810636 11:91305879-91305901 CTAAACTTCAAAAGTGAGTCTGG + Intergenic
1090050955 11:123378893-123378915 CTAAATGTAACAGGTGTGACAGG + Intergenic
1090603986 11:128402443-128402465 CTGAAGACCACAAGTGTGCCTGG + Intergenic
1090924481 11:131237385-131237407 CTCAATGTCACAAGTCTGGCAGG - Intergenic
1092333173 12:7604061-7604083 CTAAACATCACAGGTAAGTCAGG + Intergenic
1092447357 12:8569502-8569524 CAAAATATCACATGTGGGCCGGG + Intergenic
1092737312 12:11594789-11594811 CAAAAGATGACAAGTGTGACAGG + Intergenic
1096683618 12:53273341-53273363 CTAAATATAAAAAGTGAGTCAGG - Intronic
1097851089 12:64410616-64410638 TTAAATATCACTAATGTGGCCGG - Intronic
1099299824 12:80878417-80878439 TTGAATAAAACAAGTGTGTCTGG + Intronic
1106283118 13:28295215-28295237 CTAAAAAGCACCAGTGTGTTAGG + Intronic
1108112652 13:47092652-47092674 TTAAATATCACAGGTGGTTCAGG + Intergenic
1108935022 13:55872590-55872612 CTAAATGTCACTGGTGAGTCAGG - Intergenic
1110664818 13:78104515-78104537 CTAATTATCTCAAGTCTCTCTGG - Intergenic
1111969263 13:94893858-94893880 CTAAATATCCCAAGGGGGACTGG + Intergenic
1114873443 14:26686250-26686272 CTAAATGTCTCAGGTGTGTAAGG - Intergenic
1115338474 14:32267299-32267321 CTCAATATCAGAAGAGTATCTGG - Intergenic
1119895263 14:78214537-78214559 CTAAGCATCCCGAGTGTGTCCGG - Intergenic
1126976831 15:54192212-54192234 CTAAATATAAAAAGTTTTTCTGG - Intronic
1127558249 15:60109597-60109619 CTAAATTTGAGAAGTGTGTAAGG - Intergenic
1128778043 15:70338833-70338855 CAAAATAACACAAGAGTGTGGGG - Intergenic
1130425208 15:83790779-83790801 CTAAAACTAACAAGTGAGTCTGG + Intronic
1132954361 16:2583658-2583680 CTACAAATCACACGTGGGTCTGG - Intronic
1132959984 16:2616505-2616527 CTACAAATCACACGTGGGTCTGG + Intergenic
1141209546 16:81964290-81964312 CTAATTTACACAAGTGTGCCAGG - Intergenic
1146969537 17:37061542-37061564 CTAAAGATGACAAGTGGGGCCGG - Intergenic
1149386119 17:56144947-56144969 CTAAAAACCACAAGAGTGTTAGG + Intronic
1155895389 18:31318687-31318709 CTAAATATCACAAGTGTGTCTGG + Intronic
1157480244 18:48049370-48049392 CCAAATAACCCAAGTGTGCCTGG - Intronic
1160335164 18:78031958-78031980 CCAAATCCCACAAGTGTGTCTGG + Intergenic
1160602530 18:80024773-80024795 CTACCTGGCACAAGTGTGTCAGG - Intronic
928479207 2:31664675-31664697 TTAATTATATCAAGTGTGTCTGG - Intergenic
928755309 2:34517394-34517416 TTAAAAATAACAAGTGTGCCGGG + Intergenic
933028954 2:77301240-77301262 CAAAATATCATAACTGTGTCAGG + Intronic
933475044 2:82779070-82779092 CTAAATGTCACTAGTGAGTCAGG + Intergenic
934585333 2:95487938-95487960 CTCAATATCAGAAGAGTTTCTGG - Intergenic
934594132 2:95588818-95588840 CTCAATATCAGAAGAGTTTCTGG + Intergenic
934788650 2:97036864-97036886 CTCAATATCAGAAGAGTTTCTGG - Intergenic
935562701 2:104575342-104575364 ATAAATGTCACAGGTGTGTGGGG - Intergenic
939336341 2:140833503-140833525 CTTAATATTACAAGTGTTTTGGG + Intronic
943953126 2:194156167-194156189 CTAAATGTCACTAGTGAGCCAGG - Intergenic
945584564 2:211643115-211643137 TTAAAAATCACTAGTGTGTTAGG - Intronic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1169551419 20:6705379-6705401 CTAAGTATCACACGTTTCTCAGG - Intergenic
1171063501 20:21989542-21989564 CTAATTATCTCAGGAGTGTCAGG - Intergenic
1171143968 20:22765852-22765874 CTAAATATGACATGTTTGTTTGG + Intergenic
1172853354 20:37982505-37982527 CTAAATTTCCCCAGTGTGTTTGG - Intergenic
1182725376 22:32441127-32441149 CTGAATATCTCAAGTGTGCTGGG - Intronic
949576526 3:5343839-5343861 GTAATTATCTCAAGTGTCTCTGG - Intergenic
953810954 3:46112456-46112478 CTAAACATCACTGGTGAGTCAGG - Intergenic
958715826 3:97779195-97779217 CTAAATGTCTCAAGTGTATCGGG - Intronic
959143029 3:102508790-102508812 TTAAATATTTCAAATGTGTCAGG + Intergenic
963801759 3:149683390-149683412 CTAAATATCCTAAGTGAGGCAGG - Intronic
963961650 3:151315670-151315692 ATAAATATCAACAGGGTGTCTGG + Intronic
963967560 3:151389700-151389722 CAAAAGACTACAAGTGTGTCAGG - Intronic
964066325 3:152584211-152584233 ATAAATATAACAAATGTCTCTGG - Intergenic
967052103 3:185794294-185794316 CCTCATATCACAGGTGTGTCTGG + Intronic
970421701 4:15911054-15911076 TTAAATATCTCATCTGTGTCAGG + Intergenic
970448553 4:16144640-16144662 CAAAATATCACACGTGTTGCGGG + Intergenic
970697806 4:18698029-18698051 CTGTATATCACAACTGTGTAGGG + Intergenic
973157457 4:46974776-46974798 CTAAATAGCAGAACTGTGTTAGG - Intronic
974489680 4:62548576-62548598 CCAAATATAAGAAGTGTGTTTGG - Intergenic
978051749 4:104209265-104209287 TTAAATATCAGCTGTGTGTCAGG - Intergenic
978470441 4:109060817-109060839 CTAAATTTCACAAGAATGTGAGG - Intronic
979322273 4:119338151-119338173 CTAAATTTCCCAAGTGTGGATGG + Intergenic
981192913 4:141884433-141884455 CTAAATAACACCAGACTGTCAGG - Intergenic
982490897 4:156028272-156028294 ATAAAATTCATAAGTGTGTCAGG + Intergenic
982795627 4:159640363-159640385 CTGAATACCACATGTGTGCCAGG - Intergenic
983240251 4:165223763-165223785 CTAAATTTCCCAAGTGTGGATGG + Intronic
990113175 5:52353329-52353351 ATAAATATCACAAGTGAATTTGG + Intergenic
993072568 5:83183977-83183999 GTAAATATTACAAGTTTTTCAGG + Intronic
993389208 5:87297779-87297801 GTAAAATTCACAAGAGTGTCAGG + Intronic
995142903 5:108753442-108753464 CAAAATATCTCCAGTTTGTCTGG + Intronic
996662072 5:126016022-126016044 CCAAATAGCACAAGTGCCTCAGG - Intergenic
998171548 5:139874873-139874895 CAAAATACAACAAGTGTCTCAGG + Intronic
998734889 5:145125920-145125942 CTAAATACCACCATTGTGTGAGG - Intergenic
1000101015 5:158016263-158016285 CTAAACAGCAAAAGTGTGTGTGG + Intergenic
1001380200 5:171301109-171301131 CTAACCATCACGAGTGAGTCTGG - Intergenic
1002405529 5:179027365-179027387 CTAAGTATTTCAAGTGTTTCTGG - Intronic
1003522759 6:6872632-6872654 CTAAATATCACCATTGTGTGTGG - Intergenic
1003697011 6:8418003-8418025 CTAAATATCTGCTGTGTGTCAGG + Intronic
1003906259 6:10702477-10702499 TTAAAGCTCACAAGTGAGTCGGG + Exonic
1008335094 6:50294121-50294143 CTAAAAAGCACAAGTAGGTCAGG + Intergenic
1009456522 6:63863134-63863156 CCAAATATCACAAGTGTCAAAGG + Intronic
1012648788 6:101724706-101724728 CTAAATATTGGAATTGTGTCTGG - Intronic
1012991382 6:105929950-105929972 CCAAAGATCACAACTCTGTCAGG + Intergenic
1013416293 6:109927745-109927767 CTAAATATCAACTATGTGTCAGG + Intergenic
1013636028 6:112030160-112030182 GTAAATATCATAATTGTGTTTGG + Intergenic
1013658493 6:112270373-112270395 CCCAATATCAACAGTGTGTCTGG + Intergenic
1013790475 6:113830823-113830845 CTCAATTTCACAAATTTGTCTGG - Intergenic
1017213048 6:151878307-151878329 CTAAAAATAATAACTGTGTCTGG + Intronic
1018749892 6:166795219-166795241 CCATATATCACAAATGGGTCTGG - Intronic
1021331795 7:19347181-19347203 GTAAATCTCACAAGAGTGTGAGG + Intergenic
1021522073 7:21548710-21548732 CTAAACATCACGAGTGAGTCAGG - Intronic
1025189686 7:56887168-56887190 CCAAATAATACAAGTGTGGCAGG - Intergenic
1025682252 7:63689749-63689771 CCAAATAATACAAGTGTGGCAGG + Intergenic
1026470180 7:70688404-70688426 ATAAATAACAGATGTGTGTCTGG - Intronic
1036538342 8:9675033-9675055 CAAAATAATACAGGTGTGTCTGG + Intronic
1046884249 8:119345809-119345831 TTAAATATCCCAAGTATGTGGGG + Intergenic
1051186794 9:14468990-14469012 CCAGGTATCAGAAGTGTGTCTGG + Intergenic
1052531056 9:29684672-29684694 CTAAATATCAATATTGTCTCTGG + Intergenic
1057337848 9:94171038-94171060 TTAACTATCACAAGTATATCTGG + Intergenic
1058844569 9:108944122-108944144 CTAGATATAAAAAGTCTGTCAGG + Intronic
1059856917 9:118409570-118409592 CTAAATAACAGAAGTTTTTCTGG + Intergenic
1186741670 X:12524593-12524615 TTAAATATCATTAGTGTGCCTGG + Intronic
1188499884 X:30813621-30813643 TTAAATATCAAAAGTTTGTAAGG - Intergenic
1188663115 X:32784926-32784948 CTATATACTCCAAGTGTGTCAGG - Intronic
1194541930 X:95184265-95184287 CAAAAAATGACAAGTGTGTGAGG - Intergenic
1194799466 X:98254029-98254051 CTACATATCACAAGTGTATGTGG + Intergenic
1194993416 X:100569219-100569241 CTAAATGTCACTGGTGAGTCAGG - Intergenic
1200843595 Y:7808897-7808919 GTAAATTTCACAAGTGAATCTGG - Intergenic