ID: 1155905919

View in Genome Browser
Species Human (GRCh38)
Location 18:31451020-31451042
Sequence AAATAAAAGCTATATTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608
Summary {0: 1, 1: 0, 2: 7, 3: 56, 4: 544}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155905919 Original CRISPR AAATAAAAGCTATATTTGGG AGG Intronic
900295090 1:1944900-1944922 AAATAAAAAGAATATTTGGCCGG - Intronic
901587113 1:10305594-10305616 AAATAAAAGTTAACTTTGGTTGG + Intronic
901722951 1:11215063-11215085 AAATGAAAGCTGTATTTTGCAGG + Intronic
902912506 1:19610568-19610590 AGAGACAAGGTATATTTGGGAGG + Intronic
902915907 1:19639246-19639268 AAATGAAAGCTATTTCAGGGAGG - Intronic
906038919 1:42771515-42771537 AAATAAACACTATATTTTGAAGG + Intronic
906333799 1:44910617-44910639 AAAAAAAAGCATTACTTGGGGGG - Intronic
907118113 1:51987437-51987459 AATTAAAACCTGTATATGGGAGG + Intronic
907707331 1:56844201-56844223 AAACAAATGATATATTTGAGGGG - Intergenic
907756565 1:57316410-57316432 AAATAAAATCTTCATTTGAGGGG - Intronic
910229473 1:84971311-84971333 AAATAATATGTACATTTGGGAGG + Intronic
910581314 1:88828399-88828421 AAATCAAAGCTATCTTTGGGAGG - Intronic
910921894 1:92357369-92357391 AAGTAAAAGATCTGTTTGGGGGG + Intronic
911076969 1:93885063-93885085 GAATATACGATATATTTGGGGGG - Intergenic
911723187 1:101213439-101213461 AAATAAAAGCAAAATTTGGTGGG - Intergenic
911795896 1:102075907-102075929 AAATAATAGATATATTTAGAAGG - Intergenic
911801082 1:102139292-102139314 TAATAAAAGCAATAATTTGGGGG - Intergenic
911829763 1:102535928-102535950 AATTAAAGGCGAGATTTGGGTGG + Intergenic
911969436 1:104412057-104412079 TAAAAAAACCTATATTTGGAAGG - Intergenic
912238927 1:107884604-107884626 AAATAAAAAATAAATTTGTGAGG - Intronic
912455855 1:109796785-109796807 AAATTCAAGAGATATTTGGGAGG - Intergenic
913008892 1:114663240-114663262 AAATAAAAGATAAATTTGAAGGG - Intronic
913120552 1:115736637-115736659 AAAAAAAAGCTATATTCTTGAGG + Intronic
913538031 1:119793020-119793042 AGATAAAAGATAAATTGGGGTGG - Intergenic
913574258 1:120154554-120154576 GCATAAAAGATATATTAGGGAGG - Exonic
914295529 1:146319357-146319379 GCATAAAAGATATATTAGGGAGG - Intergenic
914556568 1:148770138-148770160 GCATAAAAGATATATTAGGGAGG - Intergenic
914616266 1:149360092-149360114 GCATAAAAGATATATTAGGGAGG + Intergenic
914788670 1:150856464-150856486 AAATAAAAGAAATATTAGGCCGG + Intronic
914834107 1:151192911-151192933 AAATAAATTATATATTTGTGAGG + Intronic
915182080 1:154070706-154070728 AAATAACAGCCATATATGGAAGG - Intronic
915198851 1:154211297-154211319 AAATAACATCTATTTTTGGCCGG - Intronic
916513726 1:165496444-165496466 AAATAAAGGATATATTTCAGGGG - Intergenic
917113827 1:171581038-171581060 AAATAAAAGCCACATTTATGAGG - Intronic
917257936 1:173136129-173136151 AAATAAATCCTATGTTTTGGGGG + Intergenic
918390686 1:184057341-184057363 AAAACACAGCTCTATTTGGGTGG + Intronic
918606337 1:186431425-186431447 AATGAAGAGCAATATTTGGGAGG + Intergenic
918805335 1:189033853-189033875 AAACAAAAATTAGATTTGGGAGG + Intergenic
918877415 1:190066090-190066112 AAATAAAAGATATAGTTGTGGGG - Intergenic
918898024 1:190373131-190373153 AATTAAAATAGATATTTGGGAGG + Intronic
919632468 1:199972530-199972552 ATAGAAAAGCTATAGTTGGCTGG + Intergenic
920843143 1:209571639-209571661 AAATATAAGAAATATTTAGGAGG + Intergenic
921385037 1:214560207-214560229 AAAGAAAAGAAATATTTGGCTGG - Intergenic
922518481 1:226225469-226225491 AAATAAAAGCTGCTTTTGGTTGG - Exonic
922686615 1:227643815-227643837 AAATAAAAGCTAAATATAGATGG - Intronic
922859945 1:228807929-228807951 AAATGAAAGCTTAATTTGTGAGG + Intergenic
922896002 1:229100908-229100930 CTATAATAGCTATATTTGGCTGG - Intergenic
923306239 1:232691365-232691387 TACTAAAAGTTATTTTTGGGTGG - Intergenic
923675679 1:236078934-236078956 AAAAAAAAGTTATATTTAGCTGG + Intergenic
923804351 1:237242349-237242371 AAGTAAATGCTGTATTTAGGGGG + Intronic
923878573 1:238077164-238077186 ACATACAAGCTTTATTTAGGTGG - Intergenic
924023268 1:239807153-239807175 AAATAAAAGTCCTATTTAGGTGG + Intronic
924715796 1:246572645-246572667 AAATAAAACATACATTTGGCTGG - Intronic
1065009111 10:21405778-21405800 CAAAAAAAGCAACATTTGGGTGG - Intergenic
1065380662 10:25086874-25086896 AAATTAAATCTGTATTTTGGGGG - Intergenic
1066029373 10:31403155-31403177 AATGAAAAGCTTTATTTTGGAGG + Intronic
1066441771 10:35446406-35446428 AAAGAAAATCTATATTTAGTGGG - Intronic
1067129137 10:43545795-43545817 AAAAAATAGCTAGATTTGGAAGG - Intergenic
1067516212 10:46947607-46947629 AAATACAAGAGAAATTTGGGGGG - Intronic
1068304538 10:55189230-55189252 AAATGAATGCTAAATTTGGAAGG - Intronic
1068971715 10:62965296-62965318 AAACAAAAGCAATATTTGACTGG + Intergenic
1069433610 10:68359795-68359817 AAAAAAAAGATAGATTTGGAAGG + Intronic
1069439744 10:68417404-68417426 AAAAAAAAACACTATTTGGGAGG + Intronic
1069461849 10:68603016-68603038 AAATGAAACCTGTGTTTGGGAGG + Intronic
1069821016 10:71228870-71228892 CACTAAAAGCTAGATTAGGGTGG - Intronic
1071048659 10:81417637-81417659 AAATTAAAGGTATATTTTTGGGG + Intergenic
1071146156 10:82575081-82575103 AAATAAAAGCTAAGTATGAGAGG + Intronic
1071582632 10:86787413-86787435 AAATAAAAGATCTATTTGTAGGG + Intronic
1071683767 10:87733965-87733987 AACTGAAAGCTACATTTGGCAGG - Intronic
1073372084 10:102999376-102999398 AAATATAAGCAATTTTTGGCCGG - Intronic
1073704279 10:105964869-105964891 AAAAAAAAGATATATTTTGATGG - Intergenic
1073962427 10:108948263-108948285 AAAAAAAATCTATATTGGGAAGG - Intergenic
1074006470 10:109430116-109430138 AAAACAAAGCTATGTTGGGGTGG + Intergenic
1074616210 10:115070885-115070907 AAATATATGCTGTATTTGGGGGG + Intergenic
1074727459 10:116326238-116326260 AAATAAAAGGTAGTTTTAGGAGG + Intronic
1075485309 10:122817585-122817607 AAATAAAATCTATATTCTGTTGG - Intergenic
1075815001 10:125258161-125258183 AAATAAAAGATATATTTAAAGGG - Intergenic
1077776246 11:5274937-5274959 AAAGTAAAGCTATATTTCAGCGG - Intronic
1078020652 11:7653731-7653753 TAATAAAAGCAATATTTATGCGG + Exonic
1078262141 11:9719733-9719755 AAATAAAAACTGTACTTGGCAGG - Intronic
1078377817 11:10810403-10810425 AAAAAAAAACTATTTTGGGGTGG + Intergenic
1078439791 11:11354968-11354990 AAATTCAAGCTATATTTAGGAGG - Intronic
1079515667 11:21265289-21265311 AAATAAAAACTATATTCAGAAGG + Intronic
1079541328 11:21579179-21579201 AAATAAAAGGTTTATTTTTGAGG + Intergenic
1080164223 11:29217628-29217650 AAACAAAAGCAATGTTGGGGAGG - Intergenic
1081147634 11:39582934-39582956 AAATTAGAGATATATATGGGGGG + Intergenic
1081200148 11:40205348-40205370 AAATAAAAGCAATCTATGTGAGG + Intronic
1081474125 11:43408731-43408753 AAAAAAAAGGTATATTTTTGGGG - Intronic
1081910478 11:46696888-46696910 AAATAAAAGCTATGGCTGAGGGG + Intronic
1082559496 11:54601458-54601480 TATTAAAAGCTGTTTTTGGGAGG - Intergenic
1082651750 11:55802700-55802722 AAATAACAGCTAAATTTGAAGGG + Intergenic
1085596462 11:77814877-77814899 AAAAAAAAACCATATTTTGGGGG - Intronic
1086408311 11:86518671-86518693 CACTAAAAGCTATAATGGGGTGG + Intronic
1086473578 11:87145056-87145078 AAATAAAAGCCATATTTCTCTGG + Intronic
1086787309 11:90985075-90985097 AAATATAAGCTAAATTAGTGAGG + Intergenic
1087035644 11:93753346-93753368 AAAAAAAATCTATTTTGGGGTGG - Intronic
1087129053 11:94653119-94653141 ACATAAAAACTGAATTTGGGTGG - Intergenic
1087271158 11:96113456-96113478 AAATAAAAGTTAAATTGAGGGGG - Intronic
1087484515 11:98744896-98744918 AAATAAAAACTCTGTTTGGTGGG - Intergenic
1087633981 11:100682642-100682664 TAATAAAATCTAGATTTGGCAGG + Intergenic
1087816917 11:102668705-102668727 AATTAAAAAATATATTTAGGGGG + Intergenic
1088149088 11:106722355-106722377 TAAAAATAGCTAAATTTGGGAGG - Intronic
1088593757 11:111424510-111424532 AAATAAATGAATTATTTGGGTGG - Intronic
1088724247 11:112620387-112620409 AAAAAAAAGCCCTATTTTGGAGG + Intergenic
1089152109 11:116372236-116372258 AATTCAAGGCGATATTTGGGTGG - Intergenic
1089431511 11:118428698-118428720 ACAAAAAAGATATATGTGGGTGG - Intronic
1090297120 11:125598553-125598575 AAATATAAACTGAATTTGGGAGG - Intronic
1091404162 12:198594-198616 GAAAAAAAGTTATATTTGAGTGG + Intronic
1092267101 12:6990013-6990035 AAATAAAAAAAATAGTTGGGTGG + Intronic
1092296247 12:7201345-7201367 ACATATCAGCTATATTTGGGAGG + Intronic
1092393094 12:8098983-8099005 AAACAAAAAATATATATGGGAGG + Intergenic
1092578883 12:9818707-9818729 AAATAAAAGCAAAATTTAGGGGG - Intergenic
1092840393 12:12534812-12534834 AAAAAAAAGTTTTATTTTGGAGG + Intronic
1093216189 12:16363951-16363973 AACTCAAAGCTCTATTTGGCTGG - Exonic
1093429459 12:19067896-19067918 AGATACAGGATATATTTGGGTGG + Intergenic
1093720252 12:22433689-22433711 AAATTAAAAATATATTTAGGAGG - Intronic
1094235815 12:28164727-28164749 AAAAAAAATGAATATTTGGGTGG + Intronic
1094295856 12:28903856-28903878 AAATTCAGGCAATATTTGGGAGG - Intergenic
1094604061 12:31935577-31935599 AAAAAAAAGCTGTCTGTGGGTGG - Intergenic
1095209547 12:39476507-39476529 AAAAAAAAGCTATATTTGGCTGG - Intergenic
1095415527 12:41973006-41973028 AAATAAAAGCCATTCTTGGTTGG + Intergenic
1095627102 12:44328603-44328625 AACTAAAAGATATCTTTGGTTGG + Intronic
1095648523 12:44578614-44578636 AAAAAAAGGCTATATTTGCAAGG - Intronic
1096249387 12:50018774-50018796 AAAAAAAAGCTTTTTTAGGGGGG + Intronic
1096903672 12:54912563-54912585 AAATAAAAGATTTATGTGGTAGG + Intergenic
1097415615 12:59312787-59312809 ACATAAAAGTTAAATTTAGGTGG + Intergenic
1098375638 12:69810671-69810693 AAAGAAAAGTTAGATTGGGGTGG + Intronic
1098623246 12:72631745-72631767 AAATAAAATCCATTTTTGGTTGG + Intronic
1099255799 12:80309800-80309822 AAATGACAGATATATTTAGGTGG + Intronic
1099279322 12:80623829-80623851 AAAGAAAAGCTATAAAAGGGGGG + Intronic
1099362004 12:81714863-81714885 AAATAAAAGCTCTATTTATGAGG + Intronic
1099417982 12:82417207-82417229 AAAAAAAATCTATATTTTGTGGG + Intronic
1100106155 12:91175156-91175178 AAATAAATGCTATAATTAAGAGG + Intronic
1101582429 12:106053697-106053719 AAATAAAAGCTAACTTTGGCAGG + Intergenic
1101634465 12:106526862-106526884 ATATAATGGCTATATTTGTGAGG + Intronic
1103360141 12:120348541-120348563 AAAAAAAAGATATTTTTGGAGGG - Intronic
1104560299 12:129837858-129837880 AAATAAAATTTATAGTTTGGAGG + Intronic
1106673367 13:31931254-31931276 AAATTTAGGATATATTTGGGAGG + Intergenic
1107778836 13:43877713-43877735 AAATAAAAGCTGTTCTTTGGAGG - Intronic
1107799465 13:44090772-44090794 AAACAAAAGCTACATTTTGTTGG + Intergenic
1108073523 13:46654379-46654401 AAATAAAATATATATTTTGTTGG + Intronic
1108857889 13:54818757-54818779 AAAGAAAAGCTATATTAGGCCGG - Intergenic
1108916482 13:55619533-55619555 AAATTAAGGCTATATTTGTGGGG + Intergenic
1110000477 13:70192632-70192654 CACTTAAAGCTAGATTTGGGAGG - Intergenic
1110202291 13:72866337-72866359 AATTAAAAGGTATATGTGGTAGG - Intronic
1110903902 13:80861242-80861264 AACTAAAAGCTGTATTTGGTAGG + Intergenic
1110968223 13:81728220-81728242 AAATAACAGCTACATTTTGACGG + Intergenic
1110987343 13:81987073-81987095 CAGTAAAAGCTATAATTGAGAGG - Intergenic
1112396623 13:99039293-99039315 AAATAAAACCTATAATTGATGGG + Intronic
1112748764 13:102558450-102558472 CCATCAAAGCTATATTTAGGAGG - Intergenic
1112926863 13:104687214-104687236 ATATTAAGGCTTTATTTGGGAGG + Intergenic
1112976234 13:105321789-105321811 AAATAAAACCTACATTAGGAAGG - Intergenic
1113061549 13:106327855-106327877 AACTAAAAGCTATAATTAGTTGG + Intergenic
1113100181 13:106709194-106709216 AAATTAAGGCAATATTTGTGGGG + Intergenic
1114365358 14:22020870-22020892 GAAAAAAATGTATATTTGGGAGG - Intergenic
1114519409 14:23323666-23323688 AAATGAAGGCTAGATGTGGGTGG + Intronic
1114802019 14:25786714-25786736 AATTAAAAAATATATTTAGGAGG + Intergenic
1114893947 14:26962050-26962072 AAATCACAACTATAATTGGGTGG + Intergenic
1115044256 14:28971202-28971224 AAATAAAATATATATTTGCTAGG + Intergenic
1115182835 14:30649343-30649365 AACTAAAAAATATATTTAGGGGG - Intronic
1116099223 14:40410782-40410804 GGATAAAAGCAAAATTTGGGTGG + Intergenic
1116300174 14:43170009-43170031 AAAAACAAGCTATTTGTGGGTGG + Intergenic
1116644013 14:47503314-47503336 AAAAAAAAGGCATATTTAGGTGG + Intronic
1117238120 14:53799677-53799699 AAATAAAACCTACATTTGATTGG + Intergenic
1117687910 14:58274308-58274330 AAAAAAAAGCTATACTTGGTTGG - Intronic
1118041167 14:61918708-61918730 AAAAAAAAGTTATCTCTGGGGGG + Intergenic
1119374460 14:74178406-74178428 AAATCAAAGCTAGATTAGTGGGG + Intronic
1120076550 14:80165806-80165828 AAATAAAAGCTAAATCTGAAGGG - Intergenic
1120124659 14:80726989-80727011 AAATAAACTACATATTTGGGTGG + Intronic
1120591521 14:86379649-86379671 AAAGACAAGCTATATTTTGAAGG - Intergenic
1121163822 14:91772328-91772350 AAATACAAGCTCTATGAGGGCGG + Intronic
1121637689 14:95464921-95464943 AAATATAAGCTATATCTGGGAGG + Intronic
1122161078 14:99784419-99784441 AATTAAAAGCAATATTTGCTTGG - Intronic
1122170291 14:99867953-99867975 TAATAAACGCCATATTTGAGTGG - Intronic
1124044403 15:26135251-26135273 AAATAAAAGCATGCTTTGGGAGG + Intergenic
1125026644 15:35036871-35036893 AAATAAAAGATAGCTTTGGCTGG - Intergenic
1125343336 15:38695857-38695879 AAAGGAATGCTATATTTGTGGGG + Intergenic
1125974715 15:43940717-43940739 AAATTAAATCAATATTTAGGTGG + Intronic
1127100838 15:55563296-55563318 AAATAAAAGATACATTTGGAGGG - Intronic
1127148771 15:56052322-56052344 ATATGAAAGCTAAATTTGGTAGG + Intergenic
1127885396 15:63194930-63194952 AATTAAAAACTATTTTTGGTTGG + Intronic
1128594985 15:68936680-68936702 AAATAAAAGGTAAATTATGGAGG + Intronic
1129494384 15:75963968-75963990 AAATAAAAAATATATATGGTGGG + Intronic
1130148094 15:81290694-81290716 AAATATAAGCTAAATTTAGCTGG - Intronic
1130428581 15:83823551-83823573 AATTAAAAGTAATCTTTGGGAGG - Intronic
1131610957 15:93963186-93963208 AAAGAAAAGTTATATGTGGTAGG - Intergenic
1131678313 15:94694540-94694562 CAATAAAAGATATAATTTGGTGG - Intergenic
1132944491 16:2525352-2525374 AAAAAAAAGCAACATTTGGCTGG - Intronic
1133280461 16:4662216-4662238 AAATAATAGTAATATTTGGCCGG + Intronic
1134562791 16:15225082-15225104 AAATGAAAGCAATCTTTTGGGGG + Intergenic
1134923329 16:18136715-18136737 AAATGAAAGCAATCTTTTGGGGG + Intergenic
1135359806 16:21803046-21803068 AAAAAAAAGTGAGATTTGGGTGG - Intergenic
1137680659 16:50341658-50341680 AAATTAAATATGTATTTGGGGGG + Intronic
1137932897 16:52605402-52605424 AGGTAAAAGCTTTATTTTGGTGG - Intergenic
1137950378 16:52778163-52778185 AAATAAAAACCATTTTTGGGTGG - Intergenic
1139032847 16:62906313-62906335 AAATAAAATCTATATTTAATAGG + Intergenic
1139133555 16:64175232-64175254 AAATAAAACATTTATTTTGGTGG + Intergenic
1139555941 16:67710374-67710396 AAACAAAGGCTAACTTTGGGAGG - Intronic
1140100479 16:71912135-71912157 AAAGGTAAGCAATATTTGGGGGG - Intronic
1140640050 16:76960990-76961012 AAACATAAGCCATATTTGGCTGG + Intergenic
1141050415 16:80757281-80757303 AAGCAAAAAATATATTTGGGAGG + Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1142748628 17:1974053-1974075 AAAAAAAAGCTATCCTTAGGAGG + Intronic
1142796301 17:2310194-2310216 AAAAATAAGATATATTTTGGAGG - Intronic
1143230576 17:5350766-5350788 ACATAACAGCTACATTTGAGGGG + Intronic
1144136868 17:12303529-12303551 AAATAAGAGCTGTCTTTGGGTGG - Intergenic
1144307500 17:13982657-13982679 AAATAAGAGCTTTCCTTGGGAGG - Intergenic
1144539016 17:16120849-16120871 AAAAAACAGCTATATTGGGGTGG + Intronic
1144600436 17:16608184-16608206 AAATAAAGTCTATATTTTCGAGG + Intergenic
1144818407 17:18053314-18053336 AAATAAAAGGTATTTTAGGCTGG + Intronic
1145868257 17:28254459-28254481 AAAAAAAAGCTATGTGTGGGTGG + Intergenic
1147887630 17:43695327-43695349 AAATAAAAGCTTCCTTTGGGAGG - Intergenic
1147903378 17:43806136-43806158 AAATAAAAGCCATGTGTTGGAGG - Intronic
1147950820 17:44106858-44106880 ACATAAAAGCTACTTTTGGCCGG - Intronic
1148550784 17:48549903-48549925 AAAAAAAATCAAGATTTGGGGGG + Exonic
1149335911 17:55635706-55635728 AAATAAGTGCTATAGTTGGTAGG - Intergenic
1149504242 17:57180399-57180421 AAATAACATTTACATTTGGGAGG - Intergenic
1149962318 17:61124333-61124355 AAGTAAAAGCTATATCTTGGTGG - Intronic
1150715402 17:67568654-67568676 ATAGTAAAGCTATATTTTGGGGG + Intronic
1151197170 17:72439899-72439921 AAATAAATGCTGTGTTTGTGTGG + Intergenic
1151300493 17:73221192-73221214 AATTAAAATCTAAATTTGGCTGG - Intronic
1152400965 17:80065877-80065899 AAGAGAAAGCTATCTTTGGGAGG + Intronic
1152415076 17:80154509-80154531 AAAAAAAAGCTATCTTTTGTGGG - Intergenic
1153081357 18:1229601-1229623 AAATAAAAGCAATATTTAAAAGG - Intergenic
1153118259 18:1687382-1687404 AAATAAAATATATATTGGGATGG - Intergenic
1153130792 18:1853695-1853717 AAAGAAAAGCCAGCTTTGGGGGG + Intergenic
1154931908 18:21007238-21007260 AAATTAAATATATATTAGGGAGG - Intronic
1155482626 18:26305661-26305683 AAACAAAACAAATATTTGGGAGG - Intronic
1155712355 18:28898664-28898686 AAATAAAAGCTTTTTTTGTGAGG - Intergenic
1155795353 18:30029178-30029200 AAATATAAAATATATTTGGAGGG + Intergenic
1155905919 18:31451020-31451042 AAATAAAAGCTATATTTGGGAGG + Intronic
1156150717 18:34239321-34239343 GAATAAAAGGTACATTTGGAGGG - Intergenic
1156196409 18:34778780-34778802 AAATAAAAGCTATATATATAGGG + Intronic
1156319734 18:36007950-36007972 AAATAAAAACTAAATTTGCCAGG + Intronic
1157968595 18:52239004-52239026 TAATCAATGCTATATCTGGGGGG - Intergenic
1159774480 18:72587068-72587090 ATATAAAAAATATATTAGGGAGG + Intronic
1162615833 19:11799488-11799510 AAAAAAAAGCTCTATGGGGGCGG - Intronic
1163082775 19:14955636-14955658 AAAAAAAAGATATTTTTGGCCGG + Intronic
1165020967 19:32923946-32923968 TAATTAAAGCTAGATTTGGTGGG + Intronic
1165207345 19:34201635-34201657 CAACAAAAGCTAAATTTGGCTGG - Intronic
1165342217 19:35221027-35221049 AAATAAAAGCTTTATATTGCAGG - Intergenic
1168031229 19:53681584-53681606 AAATATAAGGTATATGTGGTAGG + Intergenic
1168202577 19:54827110-54827132 GGATATAAGCTATGTTTGGGAGG + Intronic
1168649072 19:58081518-58081540 AAATGAAAGCCAAATTTAGGGGG + Intronic
1168683006 19:58329657-58329679 TAATAAAAGCTATATTAATGTGG - Intronic
925803720 2:7627900-7627922 AAGGAAAATCTATATTTGGTAGG - Intergenic
926191232 2:10729469-10729491 TAATAATAGTTATATTTGGATGG - Intronic
926526764 2:13991370-13991392 AAATTCAAGATAAATTTGGGTGG + Intergenic
926536652 2:14121646-14121668 AAATAAAAACAATTTTTGGAAGG - Intergenic
927225150 2:20757372-20757394 GAATCAAAGCTATCTTTGGAGGG - Intronic
927242313 2:20929764-20929786 AAATCAAGACTAAATTTGGGTGG + Intergenic
927523374 2:23715928-23715950 AAATAAAGGCTATTTGTGGTGGG - Intergenic
927563358 2:24089585-24089607 AAATAGAGGCTATCTGTGGGTGG - Intronic
927851127 2:26500249-26500271 CAGTAACACCTATATTTGGGTGG + Intronic
928112848 2:28524626-28524648 AAATAAATTCTAGATTTTGGAGG + Intronic
928778991 2:34797841-34797863 AAATGAAAGCTGCATTTGAGTGG - Intergenic
929098561 2:38286913-38286935 CCATAAAATCTAGATTTGGGAGG + Intergenic
929565949 2:42984911-42984933 AAATAAAAGTGATACCTGGGTGG + Intergenic
929757994 2:44784143-44784165 AAATGCAAGCTATGTGTGGGCGG - Intergenic
930194100 2:48491614-48491636 CAATTATAGCTACATTTGGGTGG - Intronic
930363103 2:50406796-50406818 AAATAAATGGTCTACTTGGGAGG + Intronic
930419117 2:51128264-51128286 AAATAAAATCAATATTTGTTTGG + Intergenic
931095305 2:58933308-58933330 TAATAAAAGGAATATTTGTGGGG + Intergenic
931164348 2:59730320-59730342 AAATAAAAGTTATTTGGGGGAGG + Intergenic
931858907 2:66333364-66333386 AAATAAAAAATATTTTTGGCTGG + Intergenic
932287787 2:70551586-70551608 AAAGTAAAGCTATATGTGGGAGG + Intronic
933799323 2:85947677-85947699 AATGAAAAGTTTTATTTGGGAGG - Intergenic
935451864 2:103219022-103219044 AAAGAAAAATTATATTTGTGGGG - Intergenic
935459446 2:103311390-103311412 CAATAAAATTAATATTTGGGGGG + Intergenic
936773074 2:115938434-115938456 AGATAAAAGCTTTCTCTGGGAGG + Intergenic
937601617 2:123743088-123743110 AAATAAAAGCTACATATAGAAGG + Intergenic
937712895 2:124998048-124998070 AAACCATAGCAATATTTGGGAGG + Intergenic
937913688 2:127088568-127088590 AATTAAAAACTATTTTTGGTAGG - Intronic
937995484 2:127691050-127691072 AAAGAAAAGCTAATTTTCGGGGG - Intergenic
938111150 2:128566058-128566080 AAATATAACTTTTATTTGGGAGG + Intergenic
938819673 2:134943404-134943426 AAAAAAAAGTTATTTTTGTGGGG + Intronic
938891318 2:135708288-135708310 AAACATAAGCAATATTTGCGGGG - Intronic
939519106 2:143206736-143206758 AAATAAATGCTTTATTTGTTTGG + Intronic
939764871 2:146235134-146235156 ATATAAAAAATATATTTGTGTGG - Intergenic
939820765 2:146954578-146954600 AAATTCAGGCGATATTTGGGAGG + Intergenic
940273636 2:151917084-151917106 AAAGGAAAGCTATATTTGTTTGG - Intronic
940485892 2:154295235-154295257 GCATAAAAGCAATAATTGGGGGG - Intronic
941653678 2:168120749-168120771 TAATAATAGCTATGTTTGGGAGG - Intronic
941865097 2:170326118-170326140 AAAAAAAAGCTTTATATGTGTGG - Intronic
942887468 2:180944345-180944367 AAATAAAAAATATTTTAGGGAGG - Intergenic
943019061 2:182551157-182551179 AAATAATAGCTACAATTGGGGGG + Intergenic
943235302 2:185310337-185310359 AAATCAAGGTTATATTTGTGAGG + Intergenic
943436974 2:187877089-187877111 AGATAAAAGCTGTACTTGGAAGG + Intergenic
943572925 2:189595168-189595190 AAATAAATGCTTTCTTTTGGAGG - Intergenic
943959531 2:194244174-194244196 TAATAAAAACTATAATTGGGAGG - Intergenic
944034943 2:195283299-195283321 AAATAAAAGCTTTGTTTGGCAGG - Intergenic
944833743 2:203558041-203558063 AAATCAGAGCTTTCTTTGGGTGG - Intergenic
944835490 2:203575212-203575234 AAAAAAAATCTATATTTGGAAGG - Intergenic
944986458 2:205183094-205183116 TAGTAAAAGTGATATTTGGGTGG + Intronic
945699160 2:213149783-213149805 AAATAAAAGTTTTTTTTTGGGGG - Intronic
947228006 2:227858576-227858598 AAAGAAAAGCAATATTTGTTAGG - Intergenic
947350962 2:229244644-229244666 TAATAAATGCATTATTTGGGGGG - Intronic
948313342 2:237007161-237007183 AAATAGAAGCTATAATTGGCCGG + Intergenic
1171355979 20:24545641-24545663 AAATAAAAGCTAGGAATGGGTGG + Intronic
1172278300 20:33693201-33693223 AAAAAAAAACTATGTTTGGAGGG + Intergenic
1172476721 20:35244176-35244198 AAACAAAAGCTATAGCTAGGAGG + Intronic
1172935934 20:38620235-38620257 AAACATCAGCTATATTTGTGAGG + Intronic
1173444084 20:43102447-43102469 AAATAAAATAAATATTTTGGTGG - Intronic
1173777691 20:45724525-45724547 AAAAAAAAACCACATTTGGGTGG + Intronic
1174274889 20:49396525-49396547 AAATTCAAGTTATATTTTGGAGG + Intronic
1176993769 21:15529579-15529601 AAAACAAAGCTATATTGAGGAGG + Intergenic
1177492232 21:21842049-21842071 AAATAAAAGATATATGTGTTGGG - Intergenic
1177724168 21:24945591-24945613 AAATAAAGTCTATTTTTGGTCGG + Intergenic
1178364543 21:31978302-31978324 AAATAAATGATAAATTTGTGTGG - Intronic
1178688721 21:34732908-34732930 ACACAAAAGCCATTTTTGGGAGG - Intergenic
1179107969 21:38420649-38420671 AAATAAGAGAGATATTTGTGTGG - Intronic
1179230313 21:39498195-39498217 ACATAAAAGCTATTTTAAGGGGG - Intronic
1179293581 21:40041365-40041387 AAATAAAACCCATCTTTAGGTGG - Intronic
1180620967 22:17161570-17161592 AAAAAAAAGCTGGAGTTGGGTGG + Intronic
1181364790 22:22367549-22367571 GAATAAAAGGTATTTTTGAGGGG + Intergenic
1182465179 22:30511219-30511241 AAATAAAAGCTTCTCTTGGGAGG - Intergenic
1183800619 22:40160484-40160506 AAAAAAAAGAGATATTTTGGTGG + Intronic
1183826280 22:40390300-40390322 AAATAAAGGCTACATGTTGGGGG - Intronic
1183925632 22:41203974-41203996 AAATACAGGATATATTTTGGAGG + Intergenic
1185243838 22:49762550-49762572 AAATAAACTCTATATTCTGGAGG - Intergenic
949483673 3:4517454-4517476 AAATAATAGCTATAATTGAAAGG - Intronic
949735985 3:7172225-7172247 AAATGAGAGCTAAATCTGGGAGG + Intronic
949973421 3:9431674-9431696 AAATAAAATGTATATTGTGGAGG - Intronic
950027530 3:9830798-9830820 AAAAAAAAAAGATATTTGGGGGG - Intronic
951107650 3:18763884-18763906 ACATTAAAGCTATAATTGAGGGG + Intergenic
951427916 3:22570089-22570111 AATTAAAAACTATATTTTTGGGG - Intergenic
951820271 3:26800929-26800951 AAATAAAAGGTATGTTTTGGTGG - Intergenic
951824009 3:26847039-26847061 AGATGAAAGGTATATTTTGGAGG - Intergenic
952167414 3:30765909-30765931 ATAATAAAGCAATATTTGGGAGG - Intronic
952215279 3:31272103-31272125 AAATAAGGGCCACATTTGGGAGG - Intergenic
952787225 3:37167302-37167324 AAATAAAATCTCTAATAGGGTGG - Intronic
952870710 3:37898406-37898428 AAATAATAGCAATATTAGGTTGG + Intronic
952899997 3:38104468-38104490 AAAAAAAATCTTTTTTTGGGGGG - Intronic
953230330 3:41058808-41058830 AAATAAAGGATTTATCTGGGAGG - Intergenic
953584071 3:44184272-44184294 AAATAAAAGCTATTTTGAGGTGG - Intergenic
953709288 3:45256579-45256601 AAAGAAAAAATATATATGGGCGG + Intergenic
954856465 3:53648067-53648089 AAAAACAAGCTTTGTTTGGGAGG + Intronic
954893639 3:53956383-53956405 AATGAAAAGATACATTTGGGGGG - Intergenic
955325302 3:58005559-58005581 ATATAAAAGATAAAATTGGGCGG - Intergenic
955454838 3:59108790-59108812 AAATAAAAGCTTTATTGTTGTGG - Intergenic
955678086 3:61470537-61470559 ATATAAAAGTTATATCTAGGTGG + Intergenic
955866423 3:63389213-63389235 AAATAAATAGTATATTTGAGTGG + Intronic
955871815 3:63447027-63447049 AAAAAAAAGTCATAATTGGGTGG + Intronic
956062520 3:65362037-65362059 GAATATAAGCTCTATTTGAGTGG - Intronic
957156698 3:76552696-76552718 ATATATAATCTATATTTGAGTGG + Intronic
957760865 3:84554457-84554479 TAATAAAAGATATATTTTAGCGG + Intergenic
957805062 3:85136275-85136297 AAATAAAAGCTACATTTAGGAGG - Intronic
957992075 3:87639004-87639026 AAATAAAAGCAAAATATTGGTGG - Intergenic
958052756 3:88369090-88369112 AAATAAAATTTATTTTTGGAGGG + Intergenic
958649965 3:96926333-96926355 CAATTAGAGATATATTTGGGTGG + Intronic
958855810 3:99383859-99383881 AAATGAAAGATATCTTGGGGAGG - Intergenic
959005432 3:101014205-101014227 AAAAAAAAGAAATATTTGGCTGG + Intergenic
959103239 3:102038062-102038084 AGATGAAAGCTTTAATTGGGGGG - Intergenic
959131180 3:102357896-102357918 AAATAAAAGATATATTTTATGGG + Intronic
959145578 3:102540534-102540556 AAATATAAGCTGGGTTTGGGTGG + Intergenic
960131605 3:114062067-114062089 ACATAAAAGCCATAATTGGATGG + Intronic
960427531 3:117527205-117527227 AATTTAAATTTATATTTGGGGGG - Intergenic
960660188 3:120049658-120049680 AAATAAAAGATTCATATGGGGGG + Intronic
961685886 3:128630746-128630768 AAATGACAGCTGTGTTTGGGTGG + Intronic
962222587 3:133575843-133575865 AAGTAAGTGCTATATTTTGGAGG + Intronic
962584244 3:136825536-136825558 TAATAAAAGCCATATATGGCTGG - Intronic
963000782 3:140679881-140679903 CAATAAAATCAATGTTTGGGGGG - Intronic
963120404 3:141771680-141771702 AAAAAAAAAATAGATTTGGGAGG - Intergenic
963200449 3:142580806-142580828 AATTTAATGTTATATTTGGGTGG + Intergenic
963346813 3:144104656-144104678 AAATAAAATGTATATTTTGCTGG - Intergenic
963464395 3:145660194-145660216 AAATAAAGTCCAGATTTGGGAGG + Intergenic
963646833 3:147925576-147925598 AAGTACAAGCTATATTTTGTGGG + Intergenic
964307945 3:155361125-155361147 AAATAAAGACTATTTCTGGGAGG - Intergenic
964826630 3:160835516-160835538 GAATAAAAGCTATAGATGTGAGG - Intronic
965094087 3:164200461-164200483 AAATAAAAGCTAAAAGTAGGTGG + Intergenic
965421101 3:168459395-168459417 AACTCAGAGCTATATTTGTGCGG - Intergenic
965457362 3:168919560-168919582 AAAAAAAAGCCATGTTTGTGTGG - Intergenic
966020014 3:175197489-175197511 AAAGAAAATCTGTATTTGAGGGG + Intronic
966445076 3:179993481-179993503 AAATAAAATAAATATATGGGAGG - Intronic
966645032 3:182236233-182236255 AAATAAAAGCCTCAGTTGGGTGG + Intergenic
966671235 3:182528480-182528502 AAATAAATGCTAAATTTCTGAGG - Intergenic
967738628 3:192981085-192981107 TTATAAAAGCTAAATTTGGTGGG + Intergenic
967795876 3:193598107-193598129 AAATAAAAAATAAATATGGGAGG + Intronic
967823640 3:193861274-193861296 AGATAAAAGTTATTTTTGGTGGG + Intergenic
968816066 4:2822663-2822685 AAAGAAGAGGTAGATTTGGGGGG - Intronic
970327127 4:14937548-14937570 AAATAAAGGATCTGTTTGGGAGG + Intergenic
970835644 4:20402640-20402662 AAACAAAAGCTATATTAGTTGGG - Intronic
970970130 4:21973221-21973243 AATTAGAAGCTATATTCTGGAGG - Intergenic
971769533 4:30878590-30878612 ATATAAAAGAAATATTTGGGGGG + Intronic
972093909 4:35324393-35324415 AAATCAAGGCTATTTTTGGGTGG + Intergenic
972361951 4:38334424-38334446 ATATTAAAGCTTTCTTTGGGAGG - Intergenic
972446316 4:39147517-39147539 AAATAAAGGCTATTTTAGGCTGG - Intergenic
972685228 4:41346048-41346070 ACAAAGAAGCTTTATTTGGGAGG + Intergenic
974468217 4:62285287-62285309 AAATAAAAGCTATACTGAGATGG - Intergenic
974725166 4:65789396-65789418 AAATGAAAGATATGTTTGTGTGG + Intergenic
974816089 4:67005283-67005305 AAGTAGAATCTATATTTGTGGGG - Intergenic
974822684 4:67087586-67087608 AAATAAAAGCTATGTATTGAGGG - Intergenic
974927273 4:68315605-68315627 AAATAAAAGTACTATTGGGGGGG + Intronic
975546410 4:75564698-75564720 AAATAAAATCTTTAAATGGGTGG + Intronic
975793080 4:77976469-77976491 AGATAAAAGATTTTTTTGGGGGG - Intergenic
976257781 4:83117103-83117125 AAATAAAAAATATGTCTGGGCGG + Intronic
976925024 4:90485524-90485546 AAATAAAAGTTAAATTGGGGGGG - Intronic
977220307 4:94330420-94330442 AAAAAAAAGCTATTTCTGAGTGG - Intronic
977720041 4:100229350-100229372 AAATAAAAATAATAATTGGGTGG + Intergenic
977854168 4:101867784-101867806 AAATAAAAGCTATAAATGGTAGG + Intronic
978580853 4:110229769-110229791 AAAGAAAAATTATATTTGGCTGG - Intergenic
978704085 4:111684346-111684368 TAATAAAAGCTATATGAGAGGGG - Intergenic
978763785 4:112383309-112383331 AAATAAAAAATATATTTGTTAGG + Intronic
979123982 4:116943722-116943744 TAATGAAAGCTGTATTTGTGAGG + Intergenic
979147749 4:117266682-117266704 CAATAAAAGATAAAGTTGGGTGG - Intergenic
979404304 4:120290342-120290364 ACATTAAATCTATATTTGTGTGG - Intergenic
979475115 4:121147560-121147582 AAATAATAGTAATATTTGAGTGG + Intronic
979866747 4:125765107-125765129 AAGTAACAGTTAAATTTGGGTGG + Intergenic
980234970 4:130093028-130093050 AAATAAAAGCTGCCTTTGGGTGG - Intergenic
980962315 4:139487601-139487623 AAAACAAAGCTGCATTTGGGAGG + Intergenic
981050287 4:140303141-140303163 AAAAAAAAGCTTTCTTTAGGGGG + Intronic
981362122 4:143859204-143859226 AAATAAAAACTACATGTGAGGGG - Intergenic
981372858 4:143980041-143980063 AAATAAAAACTACATGTGAGGGG - Intergenic
981381947 4:144083281-144083303 AAATAAAAACTACATGTGAGGGG - Intergenic
982604655 4:157499126-157499148 AAACAAATGCTATAGTTTGGAGG + Intergenic
982902003 4:161018213-161018235 AACTAAAAACTATTTTTGGATGG - Intergenic
983148704 4:164249317-164249339 AAATCAAACCTATATTTTGAAGG - Intronic
983180367 4:164641556-164641578 AAATATATGGTATCTTTGGGAGG + Intergenic
983311887 4:166075360-166075382 ATATACAAGATATTTTTGGGAGG - Intronic
984117265 4:175697100-175697122 AGATAAAGACTGTATTTGGGTGG - Intronic
984207566 4:176804001-176804023 AAATAAAAGCTATCCTTGAAAGG - Intergenic
1202757557 4_GL000008v2_random:79327-79349 AAAAAAAAGCTAGATTTAGAAGG - Intergenic
986226661 5:5821970-5821992 AAAGAGAAGTTATTTTTGGGTGG + Intergenic
986643848 5:9897152-9897174 AAATAACAGCTAGATATGGCTGG + Intergenic
986761849 5:10887127-10887149 AATTAAAAGTGAGATTTGGGTGG + Intergenic
986828264 5:11545373-11545395 ATAGAAAAGCTACATTTGGCTGG + Intronic
987192373 5:15491407-15491429 AGATTAAAGATGTATTTGGGGGG - Intergenic
987793895 5:22604221-22604243 AAATATCAGCTATTTCTGGGGGG + Intronic
987871964 5:23631105-23631127 AAATAAAAGCTTCACATGGGTGG - Intergenic
988095868 5:26609279-26609301 AAATAAAAGCTCCATTAGGATGG + Intergenic
988146813 5:27319765-27319787 ACATAAAAGATATAATTTGGGGG + Intergenic
988254712 5:28807576-28807598 AAATAGAAACTAGATTTGTGAGG + Intergenic
988542154 5:32120275-32120297 AAATTAAAGTTATTTTTGGAGGG + Intergenic
988903984 5:35765629-35765651 AAATAAATGGTATATTGGTGTGG - Intronic
989327974 5:40222221-40222243 AAATAAAAGCCAACTTTGGTGGG - Intergenic
990660319 5:58006988-58007010 AAAAAAAAGCTATATTTGGCAGG + Intergenic
991330390 5:65486797-65486819 AAATAGAAGCTATATTAGTCAGG + Intergenic
991345766 5:65665979-65666001 AAATGAAAGCTATATTCAGAAGG + Exonic
991440558 5:66643488-66643510 AAACAAAATCAATATTTGAGAGG + Intronic
991571574 5:68059913-68059935 AAATAAAAACTTTATTTGGGAGG - Intergenic
991643048 5:68773541-68773563 AAAAAAAAGCTCAAGTTGGGGGG + Intergenic
991727542 5:69550849-69550871 AAATATAAGCTCTTTTAGGGTGG - Intronic
991867415 5:71077025-71077047 AAATATAAGCTCTTTTAGGGTGG + Intergenic
992064875 5:73097501-73097523 ATATACAAGCTATATTTGCAGGG + Intergenic
992248518 5:74853982-74854004 AAATAAAAGATATATTGGGTAGG - Intronic
992560465 5:77947480-77947502 AAATATAAGCAAAAATTGGGTGG + Intergenic
992603763 5:78434018-78434040 AAACAAAAGCTTTATGTGGGAGG - Intronic
992782282 5:80138734-80138756 AAATAAAAGATATATATCTGTGG - Exonic
993894733 5:93520822-93520844 AAATCACAGCTTTCTTTGGGGGG - Intergenic
995615520 5:113958989-113959011 TAATTATAGCTATATTTGGAGGG + Intergenic
995822901 5:116257730-116257752 AAATAAAAGGAATATTATGGTGG + Intronic
995953505 5:117746080-117746102 AAAATAAAACTATTTTTGGGGGG - Intergenic
996108153 5:119531345-119531367 AAGTAAATGCTGTATTTGAGTGG + Exonic
996332775 5:122349776-122349798 AAATAAAGACTATATTTGTGTGG - Intronic
997018555 5:129967472-129967494 AAATAAATGCCATATTTAGCAGG - Intronic
998814451 5:145998618-145998640 ATATAAAAGTTGTATTTGGCTGG + Intronic
998885105 5:146685895-146685917 ACATACAAGCTAGATTTTGGTGG - Intronic
999589780 5:153132253-153132275 AATTCAAAGTGATATTTGGGTGG + Intergenic
1000578657 5:163008675-163008697 AAAGAAAACCTATATTTGGCCGG - Intergenic
1000658540 5:163911484-163911506 GAATCAAAGCTATATTTCTGAGG + Intergenic
1000899778 5:166898547-166898569 AAATAAAACCTATATTTCTTGGG - Intergenic
1001836287 5:174835550-174835572 AATTCAAAGTGATATTTGGGTGG - Intergenic
1002034101 5:176452731-176452753 AAATTAAAGCCAGATTTTGGAGG + Intronic
1002144430 5:177167539-177167561 AAAAAAAAAATATATTTGTGAGG + Intronic
1002555163 5:180031490-180031512 AAAAAAAAGTTAAATTTGGGGGG + Intronic
1004438805 6:15626229-15626251 TAATAAAAGCTACTTTTGTGGGG + Intronic
1005079427 6:21942017-21942039 AAATAAAAGTTAATTCTGGGTGG - Intergenic
1006853880 6:37119132-37119154 AAAAAAAAATTATTTTTGGGGGG + Intergenic
1007041967 6:38730664-38730686 CAATAAAAGATATACTTGGCAGG - Intronic
1008133645 6:47747071-47747093 AAATAGAAGCTACTTTTAGGAGG - Intergenic
1008485477 6:52030548-52030570 AAAAACAAGCATTATTTGGGTGG + Intronic
1009321848 6:62300808-62300830 AAATTAAAGATATATTTTGGAGG + Intergenic
1009759436 6:67984381-67984403 CAATAAAAGATATCTTTGGGTGG + Intergenic
1009809168 6:68638865-68638887 AGGTAAATGCTATATTTGGTTGG - Exonic
1009894035 6:69724725-69724747 TAATAAAAGCCATATATGTGAGG + Intronic
1010194696 6:73227306-73227328 AAATAAAAGCTGTCCTTGGCTGG + Intronic
1010196399 6:73243793-73243815 AAATAAAAGCTGTCCTTGGCTGG + Intronic
1010278585 6:73997654-73997676 AAATAAAAGCTTTGCTTGGCTGG - Intergenic
1010543422 6:77121172-77121194 AAATAAGGGATATTTTTGGGGGG - Intergenic
1010923519 6:81714490-81714512 AAATAAAAACTATTTTGAGGTGG + Intronic
1011580077 6:88853209-88853231 TAATAAAAGTTAGATTTGGCTGG + Intronic
1011977934 6:93329983-93330005 GAAGAAAAACTATATTTTGGAGG + Intronic
1012309402 6:97703129-97703151 AAATAAACACCATTTTTGGGGGG - Intergenic
1013004168 6:106055951-106055973 AAATTAAAGCTGTGTGTGGGAGG + Intergenic
1013550712 6:111205103-111205125 AGATTAAAGCCATATTTAGGAGG + Intronic
1014023535 6:116617917-116617939 AAATTAAAGCTATAATGGGATGG - Intronic
1014504423 6:122236364-122236386 AATTAAAAAGTATATTTGTGAGG + Intergenic
1014901981 6:126976988-126977010 AAATAAAAGTGAAATTTGGAGGG - Intergenic
1015207276 6:130654355-130654377 AGATACAAGCTAATTTTGGGAGG + Intergenic
1015611336 6:135023627-135023649 AAATAAAAGCTTTATTTGAAGGG + Intronic
1015847956 6:137541271-137541293 AAACAAAATCTATATGTGGCTGG - Intergenic
1015884165 6:137899339-137899361 ACATAAAAAATAAATTTGGGTGG - Intergenic
1015951633 6:138559076-138559098 AAACAAAAGCAATGTTTTGGTGG - Intronic
1016219143 6:141645609-141645631 AAATAAAAATGAGATTTGGGTGG - Intergenic
1017052228 6:150403953-150403975 AAATAAAAATAATACTTGGGAGG + Exonic
1017781437 6:157718571-157718593 AAATAAAAGCTAGATTGGTTTGG + Intronic
1020155122 7:5717055-5717077 AAATAAAAACTAAGTTTGGCCGG + Intronic
1021073756 7:16274952-16274974 CTATAAAACCAATATTTGGGAGG + Intronic
1021364455 7:19759407-19759429 AACTAAAAGCTTTATTTCGGTGG + Intronic
1021893544 7:25211857-25211879 AAAAAAAAGATATATTTTGGAGG - Intergenic
1021952863 7:25792281-25792303 ACAGAAAAGCTAAATTTTGGGGG - Intergenic
1022251379 7:28611710-28611732 AAATAAAATATATATGTGCGAGG + Intronic
1022791818 7:33696651-33696673 AAATAAAGTCAAGATTTGGGGGG - Intergenic
1022801198 7:33779232-33779254 AAACAAAAGGTAAATTTGGTTGG + Intergenic
1022858809 7:34343684-34343706 AAATAAAACCTCTATTTAGGAGG + Intergenic
1023566803 7:41531466-41531488 AAATATAATTTGTATTTGGGTGG - Intergenic
1024371602 7:48590464-48590486 AAATAAAATCAATATCTGGAAGG - Intronic
1024708284 7:51985773-51985795 AAAAAAAAGCTATTTTTTGAAGG - Intergenic
1024716371 7:52083891-52083913 AAATTAAAGATATAGTTGGAAGG - Intergenic
1024864312 7:53887120-53887142 GGATAAAAGTTATATTTAGGTGG + Intergenic
1025924317 7:65944618-65944640 AAGAAAAAGCAATATTTGGCTGG + Intronic
1026289407 7:68992631-68992653 AAAAAGAAGCTATATTTTTGGGG + Intergenic
1026356899 7:69565747-69565769 AAATAAAAGATATATTTGGCTGG - Intergenic
1027620704 7:80481603-80481625 AAATAAAAGCTGTCTTTTGTGGG + Intronic
1027709904 7:81587084-81587106 AATAAGAAGCTATATTTAGGTGG - Intergenic
1028369831 7:90078663-90078685 AAATACAAGCTAAATTTAAGAGG + Intergenic
1030700842 7:112638611-112638633 CAAGAAAAGCTATCTATGGGAGG - Intergenic
1030950220 7:115781486-115781508 AAATAAAAGGTATGTTTAGGGGG + Intergenic
1031159897 7:118153971-118153993 AAAAAAAAATTATATATGGGAGG - Intergenic
1031490940 7:122387414-122387436 AACAAAAAGCTTCATTTGGGTGG - Intronic
1031706658 7:124988932-124988954 AAATTAAAAATATATTTGGAGGG + Intergenic
1032244663 7:130199721-130199743 AAATAAAAATTATATTTTGGTGG + Intronic
1032271116 7:130407168-130407190 GAACAAAAGTTAAATTTGGGAGG - Intronic
1032975378 7:137216961-137216983 CAATAAAGGTGATATTTGGGTGG - Intergenic
1033177379 7:139137196-139137218 AAAGAAAAGCCTTATTTTGGAGG - Intronic
1033193920 7:139310315-139310337 AAAAAAAAGTTATATTTGGTAGG + Intergenic
1033373978 7:140739503-140739525 AAACAAAAGCTCTTTGTGGGGGG + Intronic
1033504972 7:141990865-141990887 AAATCAAAGCCATAGCTGGGTGG - Intronic
1035869183 8:3118608-3118630 AAATAAAGCTTATATTTGTGAGG + Intronic
1036488500 8:9201732-9201754 AAATAAATACTTTTTTTGGGGGG - Intergenic
1036709538 8:11069247-11069269 AAAAAAAATCTACATTTGGAGGG + Intronic
1037679548 8:21084563-21084585 AAAGAAAAGCTACACATGGGGGG - Intergenic
1038369573 8:26974676-26974698 ACTTAAAAGCCATACTTGGGAGG + Intergenic
1039309977 8:36306969-36306991 AAAAGAGAGCTCTATTTGGGAGG + Intergenic
1039409789 8:37343081-37343103 AAATAAAAGGTACATTAAGGCGG - Intergenic
1039569158 8:38573293-38573315 AAATAACAGCTATATATGTATGG - Intergenic
1040687811 8:49896772-49896794 AAATAAAAGATAAATTGGGCTGG + Intergenic
1040718481 8:50288006-50288028 ATATAAATGCCATATTTGGAGGG - Intronic
1040853668 8:51926977-51926999 AAATAAAACCTAAATTTGTGTGG - Intergenic
1041476715 8:58275528-58275550 AAATAAAAGCTATGTCTTGGTGG + Intergenic
1042132804 8:65605598-65605620 AAAACCAAGCTATATTTTGGAGG + Intronic
1042323837 8:67507354-67507376 AAATAATAGCTATATTTTATAGG + Intronic
1042584473 8:70319564-70319586 AAATAAAAGCTCTATTTAGCTGG + Intronic
1042711965 8:71727319-71727341 AAATAAAAGCAGTCTTTGTGTGG + Intergenic
1042784564 8:72534280-72534302 AAGTAAAAACAATCTTTGGGGGG - Intergenic
1042809583 8:72809618-72809640 TAATAGAAGTCATATTTGGGGGG - Intronic
1043075353 8:75692092-75692114 AAAAAAAATCTATATTTATGTGG - Intergenic
1043159386 8:76826934-76826956 AAACAAAGGCTATTATTGGGTGG + Intronic
1044299617 8:90568368-90568390 AAATCAAAGAAACATTTGGGAGG - Intergenic
1044545387 8:93453698-93453720 AAATAAAATATAAATTTGGCTGG + Intergenic
1044825244 8:96189794-96189816 AAATAAAAAGTATATCTGTGGGG - Intergenic
1044990872 8:97794684-97794706 AAATAAAAGCTATTAATGGCAGG - Intronic
1045045006 8:98266303-98266325 AAAAAAAAGTTATATTAGGCTGG + Intronic
1045235942 8:100352464-100352486 AAATAAACGGTATATTTGTTTGG + Intronic
1046232913 8:111381029-111381051 AAATAAATGCTATTAGTGGGGGG + Intergenic
1046599518 8:116300033-116300055 AAATACAAGATATATTCTGGAGG + Intergenic
1046873856 8:119232071-119232093 AAAAAAAAGATAATTTTGGGAGG + Intronic
1047264168 8:123290257-123290279 AAGTAAATGCTGTATTTGAGTGG + Intergenic
1048014747 8:130487237-130487259 AAATAAAAGGTATAGTTTGATGG - Intergenic
1048552339 8:135445167-135445189 AAATAAAAGCTATTTGTAAGAGG + Intergenic
1048822412 8:138392234-138392256 GAGTAGAAGCTAGATTTGGGTGG - Intronic
1050200108 9:3135602-3135624 AAAAATAAGCTTTATTTGGCTGG - Intergenic
1051055957 9:12986246-12986268 AAAAAAAAGCCATTTTGGGGGGG - Intergenic
1051087389 9:13365759-13365781 AAAGAAAGGCTATATTTTGGTGG + Intergenic
1052156683 9:25201878-25201900 AATTAAAAGTGAGATTTGGGTGG + Intergenic
1053318173 9:37070688-37070710 AGATAAATGCTATATATGAGAGG - Intergenic
1055015342 9:71611020-71611042 AAATAAAAGCTGTATTGACGAGG + Intergenic
1055281063 9:74675219-74675241 AAATAATAGTTAGATTTGGCTGG + Intronic
1055871703 9:80888327-80888349 ACATACAAGCTATATTTAGAAGG + Intergenic
1055909646 9:81334045-81334067 AAATAAAAGCTATAATTCCATGG - Intergenic
1056168147 9:83958058-83958080 AAAAAAAAGCTCCATTTGGGAGG - Intergenic
1056560235 9:87723531-87723553 AAATAAAAACAATATTTCTGTGG - Intergenic
1058032685 9:100216816-100216838 AAACAAAGGCACTATTTGGGTGG + Intronic
1058368778 9:104240010-104240032 AAATAAAACATATTGTTGGGTGG - Intergenic
1058512537 9:105735987-105736009 AAATACCAGCTATTTTTGAGAGG - Intronic
1058997051 9:110309315-110309337 AAATAAAATTAATTTTTGGGGGG - Intronic
1059044115 9:110845624-110845646 AAATAAAAGCCCGATTAGGGTGG + Intergenic
1060076920 9:120599306-120599328 TAATAAAAGAAGTATTTGGGAGG - Intergenic
1060274444 9:122171751-122171773 AAATAAAGTCTATATTTCAGAGG - Intronic
1060537538 9:124402782-124402804 AAATAAAAGCAATACTTTGATGG + Intronic
1061517889 9:131100022-131100044 AACAAAAAGCTAAATTTGGGCGG - Intronic
1061702447 9:132426158-132426180 AAATAAAAGATAACATTGGGTGG - Intronic
1186529450 X:10280419-10280441 AAAAAAAAGCCATTTCTGGGTGG - Intergenic
1186925742 X:14331373-14331395 AGAGAAAAGCCATATTTGTGAGG + Intergenic
1187251085 X:17598453-17598475 AAATAAAAGTTTTCTTTGTGGGG - Intronic
1187855698 X:23634547-23634569 AAAAAAAAGCTATATGGAGGTGG - Intergenic
1188557771 X:31431267-31431289 AAATATAAGCTATAATTCAGAGG + Intronic
1188649315 X:32612060-32612082 AAATAAATGGTTTATTTGGAGGG + Intronic
1190761663 X:53442274-53442296 GACTAAAGGCTAAATTTGGGCGG + Intergenic
1191070475 X:56395220-56395242 AAACAAAAACTATTTTTGAGAGG + Intergenic
1192070894 X:67940324-67940346 AAAAAAAAGTTATATTTTGTAGG - Intergenic
1192986463 X:76405187-76405209 AAATAAAAGCATCATTTTGGGGG - Intergenic
1193541986 X:82783206-82783228 AATTCAAAGTGATATTTGGGTGG + Intergenic
1194215601 X:91127317-91127339 AAATATAAGTAATGTTTGGGGGG - Intergenic
1194388473 X:93287328-93287350 AAATAAAAGTTATTATTGCGAGG - Intergenic
1194906335 X:99580798-99580820 AAAAAAAAGATATATTTTTGAGG - Intergenic
1195297136 X:103490110-103490132 AATAGAAAGCTATATTTGAGAGG + Intergenic
1195616491 X:106916582-106916604 ACAAAAAAGCTAAATTTTGGAGG + Intronic
1196311254 X:114168480-114168502 GGACAAAAGCCATATTTGGGGGG - Intergenic
1197322764 X:125053010-125053032 AAATAAAAGGTAACTTTGTGAGG - Intergenic
1197632534 X:128878029-128878051 TAATCAAAGCTTTATTTTGGGGG + Intergenic
1197966293 X:132065937-132065959 AAATAAATGCTATCATTTGGGGG + Intergenic
1199043775 X:143145305-143145327 AAATAAAGGGTATAATTGGATGG + Intergenic
1199056318 X:143299193-143299215 AAAGAAAAGATAAAATTGGGGGG + Intergenic
1199302136 X:146224974-146224996 ATATAAAAGCCATATTAGGGAGG - Intergenic
1199473618 X:148222096-148222118 AAATAAAACCAATATTTTGGTGG - Intergenic
1201270978 Y:12253327-12253349 AAAAAAAAGCTATTTTCTGGTGG + Intergenic
1201557521 Y:15279560-15279582 AATTAAAAGTGAGATTTGGGTGG + Intergenic