ID: 1155906060

View in Genome Browser
Species Human (GRCh38)
Location 18:31452725-31452747
Sequence ATGAAGAAACTGAAAGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 1, 1: 0, 2: 10, 3: 73, 4: 659}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155906058_1155906060 19 Left 1155906058 18:31452683-31452705 CCTATAAGGTAAGTAAAATTAAT 0: 1
1: 0
2: 3
3: 70
4: 597
Right 1155906060 18:31452725-31452747 ATGAAGAAACTGAAAGATTAAGG 0: 1
1: 0
2: 10
3: 73
4: 659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155906060 Original CRISPR ATGAAGAAACTGAAAGATTA AGG Intronic
902204701 1:14859533-14859555 ATGAAAGAAGTTAAAGATTAAGG - Intronic
902297439 1:15477673-15477695 TTGAGGAAACAGAAAGATTGGGG - Intronic
903133754 1:21295884-21295906 ATGAAGAAACTGAGACCTGAGGG - Intronic
903522848 1:23966124-23966146 ATGAAACAAGTGAAAAATTATGG + Intronic
904640273 1:31921755-31921777 AGGAAGAAACTGAAATATATAGG + Intronic
904761489 1:32807843-32807865 ATGAAGAGACTGAAGGAGAATGG - Intronic
905270921 1:36786913-36786935 ATGAGGAAACTGAAAGCCTAGGG + Intergenic
906350097 1:45051309-45051331 AAAATGAAACTGAAACATTAAGG - Intronic
906827948 1:49001923-49001945 ATGAAGAAACAGAGAGTTAAGGG - Intronic
906976677 1:50581780-50581802 ATGAAGAAAGAGTAAGATTATGG + Intronic
907071085 1:51535508-51535530 ATGAAGAAATAGAAACAGTATGG - Intergenic
907628919 1:56060542-56060564 GTGAAGAAACTGAGAGCTTCAGG + Intergenic
907694256 1:56705846-56705868 AAGAAAAAAGTGAAAGATAAAGG - Intronic
907824537 1:58002431-58002453 ATGAATAAAGTGGAAGAATATGG - Intronic
907951922 1:59191536-59191558 AGGAAGAAACTGAAGGCTTGTGG + Intergenic
908220232 1:61998682-61998704 ATGAAGGAACTGAAGGGTAAAGG - Intronic
908261913 1:62345666-62345688 ATGAGGAAACTGAAGGTCTAGGG - Intergenic
908285805 1:62599017-62599039 GTGAGGAAACTGAGAGATAAAGG - Intronic
908638321 1:66192906-66192928 ATGAAGAAACAAAAAGTTTAAGG + Intronic
908678207 1:66629965-66629987 ATGAAGAAACTGAGAAACAAAGG + Intronic
908848449 1:68349013-68349035 ATATGGAAACTGAAAAATTAAGG - Intergenic
908899851 1:68944140-68944162 ATGAGGAAACTGGAACATTAGGG - Intergenic
908985523 1:70014879-70014901 ATGAAGAAACTGCTAGAAAAGGG - Intronic
909285589 1:73812893-73812915 TTGATCAAACTGAAGGATTATGG - Intergenic
909745750 1:79095339-79095361 ATTAAGAAAATGAAAAATTATGG + Intergenic
910004137 1:82374409-82374431 ATTAAGAAAATGAATAATTAAGG - Intergenic
910863730 1:91768441-91768463 ATGAAGAAATTGATAGGTTTTGG + Intronic
911370635 1:96990748-96990770 ATGTAGAAACTGACAGTTGAAGG - Intergenic
911550331 1:99271030-99271052 ATGAAGAAACAGTAAGATAGTGG - Intronic
911818132 1:102380954-102380976 ATGAACAAAGAAAAAGATTAGGG - Intergenic
912194689 1:107383826-107383848 TTGAGGAAACAGAAAGTTTAGGG - Intronic
912968352 1:114257193-114257215 ATGATGGAACAGAAAGATTAAGG - Intergenic
913459792 1:119072219-119072241 ATGAACAAACTGAAGCATTATGG + Intronic
913613620 1:120533482-120533504 ATGAGAACACTGAAAGTTTAGGG - Intergenic
914576647 1:148977399-148977421 ATGAGAACACTGAAAGTTTAGGG + Intronic
915688665 1:157663698-157663720 ATGAAGAAAGTGCAAAATAATGG + Intergenic
916517233 1:165530887-165530909 TGGAAGAAACAGAAAGAGTATGG + Intergenic
916892184 1:169122707-169122729 ATGTAGAACCTGAAGAATTATGG - Intronic
916898908 1:169199864-169199886 ATGATAAAACTGAAAGACTTTGG + Intronic
917289553 1:173458463-173458485 ATGTAGAAAGAGAAAGAGTAGGG + Intergenic
917568681 1:176239209-176239231 AGGAAGAAATTGAAAGAGTCGGG - Intergenic
917689372 1:177451604-177451626 CTGAAGAGACTGACAGATCAAGG + Intergenic
918301771 1:183210789-183210811 ATGAAGAAACTGAACTTTCAGGG + Intronic
918357575 1:183720043-183720065 TTAAAGAAACTGGAAGATGAAGG + Intronic
918889810 1:190252462-190252484 ATGAGGATATAGAAAGATTAAGG + Intronic
921310647 1:213839773-213839795 ATGAAGAAACTGAAGCATGGAGG - Intergenic
921327892 1:214005818-214005840 ATGAATAAAGTGACAGATTCAGG + Intronic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
922323012 1:224504035-224504057 ATGAAGAAACTGAGACTTAAAGG - Intronic
924685900 1:246289168-246289190 ATGAAAAAAGAAAAAGATTAGGG + Intronic
924820419 1:247484505-247484527 ATGAAAAAAATGGAAGCTTATGG + Intergenic
1064634465 10:17349684-17349706 TAAAAGAAAATGAAAGATTAGGG + Intronic
1065482809 10:26212248-26212270 AAGAACAAAGTGATAGATTAGGG - Exonic
1066321099 10:34304695-34304717 ATGAAGAAACTAAAACATAAAGG - Intronic
1066974587 10:42355273-42355295 AGGAAGAAAATGAAACATTTAGG + Intergenic
1067139128 10:43641342-43641364 ATGAGAAAAATGAAACATTATGG - Intergenic
1067195628 10:44115390-44115412 ATAAAGAAATTGAGAGATGAAGG - Intergenic
1068008368 10:51417396-51417418 ATGAAGAATATGAAAGATAGAGG + Intronic
1068243895 10:54340190-54340212 AAGAAAAAAATGAAAGTTTAAGG - Intronic
1068313249 10:55306940-55306962 ATAGAGAAACTAAAATATTAAGG + Intronic
1068336836 10:55644074-55644096 AAGAATAAGCTGAAAAATTAAGG - Intergenic
1068347838 10:55807109-55807131 ATGAAGAAAGTGAAAGCCTATGG + Intergenic
1068387271 10:56347773-56347795 ATGAAGTCACTGAAATATTGAGG - Intergenic
1068428089 10:56893513-56893535 ATGTAGAAAGTTAAATATTAAGG - Intergenic
1068489846 10:57709441-57709463 ATGAAGAAAGTGAATTATCAAGG + Intergenic
1068735547 10:60409928-60409950 ATGATGAAGCTGAGAGACTAGGG - Intronic
1069275904 10:66590237-66590259 CTGAAGAATCTGAGAGTTTAAGG + Intronic
1070305733 10:75238153-75238175 ATCAAGAAACTGCAAGTTTCTGG - Intergenic
1070495248 10:77015442-77015464 ATGAAGAGACTGTAAAGTTATGG - Intronic
1071102054 10:82050210-82050232 ATGAAGAAAATTAAAAATGAAGG - Intronic
1071237372 10:83664870-83664892 TTGAAGAAATTGAAGGATAATGG - Intergenic
1071693900 10:87852295-87852317 ATTAACAAACTAGAAGATTAAGG + Intergenic
1071703528 10:87970111-87970133 ATGGAAAAACAGCAAGATTATGG - Exonic
1071884839 10:89938480-89938502 ATGTAGAATGTGAAAGATCAAGG - Intergenic
1071948694 10:90678052-90678074 ATGCAGAAAGAGAAAGAGTATGG - Intergenic
1072349993 10:94547317-94547339 ATGAAGAAACTGAGGGAGAAGGG + Intronic
1073010968 10:100359280-100359302 TTCAAGAAACAAAAAGATTAGGG - Intronic
1073053570 10:100684970-100684992 ATGAAGAAAAAGAAAGAGTTGGG + Intergenic
1073712762 10:106063745-106063767 ATAAAGAAACTGAAAAATTAAGG - Intergenic
1073831698 10:107391645-107391667 ATTAGGAAACTGAAAAATTATGG + Intergenic
1073857786 10:107697407-107697429 AAGAAGGAAAGGAAAGATTAGGG - Intergenic
1074232527 10:111551880-111551902 GTGAAGAAACTGAAAGCAAAAGG - Intergenic
1074484279 10:113857854-113857876 GAGAAGAAACTGAAATATTCTGG - Intronic
1075224707 10:120617871-120617893 ATGAAGAAACTGAAGTTTTCTGG - Intergenic
1075292430 10:121241864-121241886 AAGATGATACTGAAAGATGATGG + Intergenic
1076713120 10:132349967-132349989 AAGAAGAAGCTCTAAGATTATGG + Intronic
1078525011 11:12093824-12093846 AGAAAGAAAATGAAACATTAGGG + Intergenic
1078963012 11:16301677-16301699 ATGAATAGAATGATAGATTATGG + Intronic
1079335291 11:19565336-19565358 TTGAATAATTTGAAAGATTAGGG - Intronic
1079448921 11:20582358-20582380 ATGAGGAAACTGAAAAATAATGG + Intergenic
1079576449 11:22009200-22009222 ATGAAGAAACTGACGCATTTGGG - Intergenic
1079595110 11:22234717-22234739 AGGAAGAAACTGCAAGGGTAAGG - Intronic
1079620162 11:22544115-22544137 ATGGAGAAAAGGGAAGATTACGG - Intergenic
1079794497 11:24782930-24782952 ATAAAGAAAATGAAATATTAGGG + Intronic
1080290297 11:30663615-30663637 ATGACGAAAGTGAAAGCTGAAGG + Intergenic
1080541142 11:33266740-33266762 ATGAATAAAGTTAAAAATTAGGG - Intronic
1080979398 11:37382368-37382390 GTGAAGAAGTTGAAAAATTATGG + Intergenic
1081208614 11:40304458-40304480 ATGAAGCTACTGAAAGAGTTTGG + Intronic
1083063785 11:59901847-59901869 TAGTAGAAAATGAAAGATTACGG - Intergenic
1084339835 11:68489584-68489606 ATGAACAAATTGAAGGTTTATGG + Intronic
1084869561 11:72088758-72088780 ATGAAGAAACTGAAACCCAAGGG - Intronic
1084952893 11:72676481-72676503 AGGAACAAACTGCAAGATTCAGG + Intergenic
1085079161 11:73619737-73619759 ATCAAGAACTTGAAAGATTAAGG + Intergenic
1085720603 11:78909385-78909407 ATGAGGAAACTGACACATAAAGG + Intronic
1086785508 11:90965493-90965515 ATGCAGAAAATAACAGATTAGGG + Intergenic
1086879447 11:92136545-92136567 ATAAAGAATCTGAAACATAATGG - Intergenic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087966239 11:104419643-104419665 ATGAGAAAACTGAACGATCAAGG + Intergenic
1088008934 11:104975273-104975295 ATAAAGAAACTGAAAAATCCTGG + Intergenic
1088140153 11:106606224-106606246 ATGAAGAATCTGAAAGCTTGGGG + Intergenic
1088392462 11:109329889-109329911 CTGAAGAAACTGAAAGTTGCTGG - Intergenic
1090432314 11:126656281-126656303 ATGAAGAAACTGAATCATGGAGG - Intronic
1090490184 11:127153823-127153845 ATGAAGAAATTGAAACCTCAAGG - Intergenic
1090543278 11:127732642-127732664 ATGAAGACACTGAAACCTAATGG - Intergenic
1090680669 11:129053624-129053646 ATGAAGAAACTAAAGCATAAAGG - Intronic
1091112825 11:132986371-132986393 GTGAAGAAACAGAATAATTAAGG + Intronic
1091148262 11:133300195-133300217 ATTAACTGACTGAAAGATTAAGG + Intronic
1091284097 11:134398564-134398586 ATGAAGAAACTGAGGCATGAGGG + Intronic
1091418985 12:318217-318239 ATGAAGAAGCTGATAGACTCTGG - Exonic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1092321433 12:7480436-7480458 ATAAAGATATTGAAAGTTTAAGG + Intronic
1092941995 12:13418586-13418608 ATTATTAAACTGAAAGACTAAGG + Intergenic
1093051094 12:14505934-14505956 ATGAGGAAACAGAAACATGACGG + Intronic
1093175237 12:15905962-15905984 ATGAAGGAACTGAGAAATAAAGG - Intergenic
1093363341 12:18260098-18260120 TTGATAAAACTCAAAGATTAAGG - Intronic
1093517377 12:20004479-20004501 ATGAAGAATTGGAAAAATTAAGG - Intergenic
1093986124 12:25536035-25536057 ATGTAGAAACAGAAACATTTAGG - Intronic
1094099784 12:26749696-26749718 ATGAAGAAAATGGAATATTAAGG - Intronic
1094182829 12:27610185-27610207 ATTTAGAAGCTGAACGATTATGG + Intronic
1094381217 12:29845297-29845319 ATGAAGAAACTGAAACAGAAAGG + Intergenic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1096172545 12:49484576-49484598 CTGATGAATCTGAAAGAATAAGG - Exonic
1096636710 12:52965057-52965079 ATGAAGGAGCTGAGAGGTTAAGG + Intergenic
1097362175 12:58670227-58670249 ATGAAGAAACTGAAGAAGTGAGG + Intronic
1097533240 12:60832650-60832672 ATGCAGAAAATGAAAGAAAAGGG - Intergenic
1097845985 12:64367389-64367411 ATAAAGAAACTAAAATACTATGG + Intronic
1098096600 12:66963480-66963502 ATGAAGAAAAAGAAGGAATAAGG + Intergenic
1098274274 12:68798036-68798058 CTAAAAGAACTGAAAGATTATGG - Intergenic
1098622624 12:72622067-72622089 ATAAAGAACCTGAAAGAGTCTGG - Intronic
1098859340 12:75689780-75689802 ATGAAAAAACTGAAACATTTTGG + Intergenic
1099453948 12:82841918-82841940 ATGCAGAAATTAAAAGAATATGG + Intronic
1099457915 12:82886567-82886589 AGGAAAAAATTTAAAGATTAAGG - Intronic
1099483783 12:83201648-83201670 ATGAAGAGAGAGATAGATTAAGG - Intergenic
1099602315 12:84756749-84756771 ATGAGGAAACTGGATGATGATGG - Intergenic
1099739792 12:86619293-86619315 ATCAATAAAATAAAAGATTAAGG - Intronic
1099774409 12:87105567-87105589 ATGTATAAACTGAATGCTTATGG - Intergenic
1101334725 12:103786325-103786347 ATGTGGAAACAGAAAGATTCTGG + Intronic
1101771628 12:107757029-107757051 CTGAAGAAACTGAAACAGTGGGG + Intronic
1103648011 12:122410309-122410331 ATATAGAAACTAAAAGATAAAGG + Intronic
1104578149 12:129987460-129987482 ATGCAGAAACTCAAAGGTTTAGG + Intergenic
1104747694 12:131220347-131220369 AGGAAGAAACAGAGACATTAAGG - Intergenic
1105268326 13:18844018-18844040 ATACAGAAACTGAAACATTAAGG - Intergenic
1105386897 13:19938676-19938698 ATGAAGAAACTGAAATGTTAGGG + Intergenic
1106444204 13:29810114-29810136 ATGGAGAAACTGAGGAATTAAGG + Intronic
1106932244 13:34679114-34679136 ATGGACAAACTGAAAGGTTAAGG + Intergenic
1106939039 13:34755834-34755856 ATGAAGAAAATAAAACATGATGG - Intergenic
1107230324 13:38101847-38101869 ATGAAAAATCTGGGAGATTATGG + Intergenic
1107231089 13:38111395-38111417 GTGAAGAAACTGAAACAGTTTGG + Intergenic
1107813366 13:44220812-44220834 ATGAAAGAAATGAATGATTAAGG - Intergenic
1108113360 13:47101662-47101684 ATGATCAAACTGAAACTTTAAGG - Intergenic
1108995408 13:56727121-56727143 ATGAAGAAAATGAAATAATTAGG - Intergenic
1109408760 13:61936792-61936814 ATAAAGCAAATGAGAGATTACGG - Intergenic
1109555418 13:63968450-63968472 ATGAAGAAATTTAGAAATTAGGG - Intergenic
1109951149 13:69503184-69503206 ATGAAGGAATTGAAAGATGCAGG - Intergenic
1109956502 13:69574451-69574473 ATGAAGAAACTGAGACATTGGGG + Intergenic
1110806010 13:79755269-79755291 AGGAAGAAACTGTAGGATTTAGG + Intergenic
1110815393 13:79855130-79855152 ATGAAGACACCGGAAGAGTAAGG - Intergenic
1111074092 13:83209838-83209860 ATGAACAAAATGAAACATTCAGG + Intergenic
1111245453 13:85532712-85532734 AAGAAGAAAATGAAAGAGCAAGG + Intergenic
1111345227 13:86944387-86944409 ATGAAAAAGCTGAAAGATTGAGG + Intergenic
1111352673 13:87051994-87052016 ATGGAGTAACTAAAAGAGTATGG - Intergenic
1111482756 13:88853003-88853025 AAGCAGAAAGTGAAAGAATAGGG + Intergenic
1111522257 13:89421154-89421176 TTGAATAAACTGAAAAATTATGG + Intergenic
1112032587 13:95471208-95471230 TTCAAGGAACTGAAAGAGTAAGG + Intronic
1112084308 13:96013508-96013530 TTGAAAAAACTGAAAGTTAATGG + Intronic
1113118245 13:106897110-106897132 TTCAAGAAACTGAAAGCTTATGG - Intergenic
1113211092 13:107982187-107982209 ATGAAGATTCAGAAAGATTCAGG + Intergenic
1113228742 13:108189297-108189319 ATTAATAAACTGAGATATTATGG + Intergenic
1114373619 14:22118303-22118325 ATAAAGAAACAGAAAGCTTCAGG - Intergenic
1114441670 14:22753113-22753135 GTGGAGAAAATGAAAGATTTTGG - Intergenic
1114820818 14:26017343-26017365 TTGAAGAAACTTAGAGACTAAGG + Intergenic
1114962439 14:27910658-27910680 ATTAAGACAATGATAGATTAAGG + Intergenic
1114982870 14:28188404-28188426 ATAAAGAAATTGAAAGTTTATGG + Intergenic
1115275499 14:31604234-31604256 AGAAATAAACTGAATGATTAAGG + Intronic
1115428071 14:33284191-33284213 AGGAAGAAACTACAATATTAGGG + Intronic
1115621463 14:35144572-35144594 ATGAAGAAAATGAAAGCTCATGG + Intronic
1115810506 14:37101929-37101951 ATGAGGAAACTGAAACATGAGGG - Intronic
1115872301 14:37818317-37818339 ATGTAGAAACATAAACATTATGG - Intronic
1115913717 14:38285995-38286017 ATGCTGAAACTGTGAGATTAGGG + Intergenic
1116036080 14:39628588-39628610 ATGAAGAAGTTGAAATATTAAGG + Intergenic
1116208501 14:41902563-41902585 ATTAACAAACTGTAAAATTATGG - Intronic
1116502919 14:45642530-45642552 ATGAAAAAACTGGAAGGTGAAGG - Intergenic
1116791529 14:49345059-49345081 ATGAAGAAATACAAAAATTAGGG + Intergenic
1116964194 14:50997765-50997787 TTGAAGAAGCTGAAAAATGAAGG - Intronic
1116985842 14:51218995-51219017 ATGGAAAAATTGAGAGATTATGG - Intergenic
1117456443 14:55901948-55901970 ATGAAGAAACTGGGAGAAGAGGG + Intergenic
1117592573 14:57287934-57287956 CTGATGGAACTGAGAGATTAGGG + Intronic
1117810795 14:59544574-59544596 ATGAAGAAATAGAGAGATTTGGG + Intronic
1118295542 14:64565729-64565751 ATGAAGTTACTGAAAAATAAAGG - Intronic
1118960629 14:70527152-70527174 ATAATGAAAATGAAAGATTTTGG + Intronic
1119016653 14:71064124-71064146 ATGAAGTGACTGGAAGATTTAGG + Intronic
1119188780 14:72664293-72664315 TTGAAGAAACTGAAAGGTGTGGG - Intronic
1119202401 14:72766315-72766337 AAGAAATAACTGAAAGATGAAGG + Intronic
1119286993 14:73463270-73463292 ATGAAGAAAATGAAGCTTTAGGG - Intronic
1119690995 14:76672421-76672443 TTGGAGACACTGAAAAATTAGGG + Intergenic
1120218105 14:81702539-81702561 GTTAAGAAACTGGAAGAGTAAGG + Intergenic
1120884899 14:89444206-89444228 CTGAAGAAACTGAAATATAGAGG + Intronic
1121705154 14:95987397-95987419 ATGATGAAACTGAGATAATATGG - Intergenic
1122845481 14:104494699-104494721 ATGAAGGAACTGGAAGCTGATGG + Intronic
1124627532 15:31317134-31317156 ATGAAGAACATGATAGATTGAGG + Intergenic
1124694472 15:31852398-31852420 ATGGAGAAACTAAAAAACTAAGG + Intronic
1125057160 15:35374897-35374919 ATGGAAAAACAGTAAGATTAGGG - Intronic
1125101855 15:35922909-35922931 ATGCAATAACTGAATGATTAGGG + Intergenic
1125203490 15:37123792-37123814 ATGAAGAAAATGATAAATTTGGG + Intergenic
1125559659 15:40618441-40618463 ATGATGAGACTGAAAGGTTAGGG - Intronic
1125703869 15:41713756-41713778 TGGAAGAAACTCAAAGATCAAGG - Intronic
1125987839 15:44072827-44072849 CTGAATAAAATGAAAGATCAAGG + Intronic
1126393521 15:48186183-48186205 ATGAAACAACTGAAGGCTTATGG + Intergenic
1126503468 15:49375065-49375087 ATTGGCAAACTGAAAGATTAAGG + Intronic
1127127623 15:55827669-55827691 ATGAAGAAAATGAATTATGATGG + Exonic
1127473643 15:59312438-59312460 ATGAAGAAACAGAAGCATAAAGG + Intronic
1127569494 15:60227867-60227889 AATAAGAAACTAAAAGACTACGG - Intergenic
1128383928 15:67133828-67133850 ATGAGGCAACTGAGAGATTCAGG + Intronic
1130710481 15:86275903-86275925 ATGAAGAATCTGAAAGAAGTTGG - Intronic
1130736293 15:86553769-86553791 ATACAGGAATTGAAAGATTATGG + Intronic
1131515772 15:93075615-93075637 ATGAAGAAACTGAAATGTAGAGG - Intronic
1131664106 15:94551653-94551675 ATGAGGAAACTAAAATATTAAGG + Intergenic
1131801390 15:96073102-96073124 ATGGCCAAACTGAATGATTAAGG + Intergenic
1131964954 15:97832190-97832212 ATGAAGAAACTGGGAGAGTGGGG + Intergenic
1132020180 15:98354212-98354234 CCGAAGAAACTGAAAGAGAATGG + Intergenic
1132050461 15:98603771-98603793 ATGAACAAAATGATAAATTAAGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133465986 16:6027491-6027513 TTGAAGAAAGTGAAAGGTTATGG - Intronic
1133855085 16:9542152-9542174 AAGAAGAAACTGAAACAAGAAGG + Intergenic
1134160840 16:11888163-11888185 ACAAAGAAATTGAAAGAATAGGG + Intronic
1134197193 16:12168364-12168386 GTGAGGAAACTGGAAGCTTAAGG + Intronic
1134429619 16:14190913-14190935 ATGAAGTACATGAAAGCTTATGG + Intronic
1134628351 16:15739018-15739040 AAGCAGAAACTTAAAGATGAAGG - Intronic
1134810655 16:17164199-17164221 ATGAAATAACTTAAAGATTATGG - Intronic
1135651633 16:24211466-24211488 AAGAGGAAACTGAAACTTTAAGG + Intronic
1135665188 16:24329635-24329657 ATGAAGAAAGTGTCACATTAGGG + Intronic
1136292474 16:29284149-29284171 ATTGAGAAACAGAAAAATTATGG + Intergenic
1136470684 16:30477998-30478020 AAGAAGAAAAAGAAAGATGAAGG + Intronic
1136527089 16:30838422-30838444 CTGAAGTAACTGGAATATTAAGG - Intronic
1137286559 16:47020965-47020987 GTGAAGCAACTGCAAGTTTAAGG - Intergenic
1137306095 16:47201577-47201599 ATCAAGAAACTGTGAGAATAAGG - Intronic
1137830220 16:51537104-51537126 ATGAAGACTCAGAAAGACTAAGG - Intergenic
1138403026 16:56764165-56764187 AAGAAGAAACTAAATGATTTTGG + Intronic
1138637030 16:58348159-58348181 ATAATTAAACTGAAACATTAAGG - Intronic
1139036111 16:62948521-62948543 ATTAAGAAAAGGAAAGATCATGG + Intergenic
1139411745 16:66767633-66767655 GTGAATAAACAGAAAGATTCTGG + Intronic
1140624066 16:76770752-76770774 AAGAAGAAACAGCAAGAATAGGG + Intergenic
1140721846 16:77779253-77779275 ATGAAGCAACGGAAAGATTAAGG + Intergenic
1140791753 16:78398731-78398753 ATTAAGAATTAGAAAGATTAAGG - Intronic
1140941754 16:79728047-79728069 ATGTAGAAACTGAAACTTTTGGG - Intergenic
1141120135 16:81347503-81347525 ATCAAGAAAGTGGAAGATTCTGG - Intronic
1142098367 16:88258168-88258190 ATTGAGAAACAGAAAAATTATGG + Intergenic
1143261735 17:5604420-5604442 ATGAAGAAAGTGATTCATTATGG - Intronic
1144643131 17:16950469-16950491 AGGAAGGAACTAAAAGATCACGG + Intronic
1144994138 17:19255410-19255432 ATGAAGAAACTCAAGCAATAAGG - Intronic
1145081439 17:19897714-19897736 ATGAAGAAATAGAGAGATGAAGG + Intergenic
1145192661 17:20858538-20858560 AAGAATAAGCTGAAAAATTAAGG - Intronic
1145403180 17:22561608-22561630 AAGAATAAGCTGAAAAATTAAGG - Intergenic
1147112692 17:38275243-38275265 ATGAAGAAACTGAAACAGCAAGG - Intergenic
1148416932 17:47513996-47514018 ATGAATAAACTGAAACAGCAAGG + Intergenic
1148661016 17:49332852-49332874 CTGGAGAAACTGAAAGAAAAGGG - Intronic
1149341331 17:55689261-55689283 ATGAAGGAACTGAAAGTGGATGG - Intergenic
1149553113 17:57554734-57554756 ATGAAGAAACAGAAGGGTTAAGG + Intronic
1150448837 17:65248730-65248752 ATAAATATACTGAAAAATTAGGG + Intergenic
1152047992 17:77951132-77951154 AAGAAGCAAATGATAGATTATGG + Intergenic
1203167935 17_GL000205v2_random:115380-115402 ATGATGAAAAAGAAAGATTGAGG + Intergenic
1153510387 18:5845634-5845656 AGGAAGTATCTGAAAGATGATGG - Intergenic
1153583405 18:6598005-6598027 AGGAGGAAACTGAGAGATGAAGG + Intergenic
1154156095 18:11945376-11945398 ATGTGGACACTGAAAGAGTAAGG - Intergenic
1154419695 18:14216016-14216038 ATACAGAAACTGAAACATTAAGG + Intergenic
1155260097 18:24033360-24033382 GTCAAGAATCTGAAAGATCATGG - Intronic
1155906060 18:31452725-31452747 ATGAAGAAACTGAAAGATTAAGG + Intronic
1156129379 18:33951950-33951972 ATGTAGAACCAGACAGATTAGGG - Intronic
1157327142 18:46677592-46677614 ATGAGGAAACTGAGACATTGAGG + Intronic
1158996504 18:62925921-62925943 CTGAACACACTGAAAGCTTAAGG + Intronic
1159538578 18:69746734-69746756 TTGAATAAAATGGAAGATTAAGG + Intronic
1160253588 18:77226666-77226688 ATGAAGAAACTGATGGATATGGG + Intergenic
1161841020 19:6680341-6680363 GTGGAGAAACTGAAGGATCAAGG + Intronic
1161898747 19:7101886-7101908 ATGAGGAAACTGAAACACGAAGG + Intergenic
1164088476 19:21926349-21926371 ATGTAAAAAATGAAAGATTTTGG - Intergenic
1164112138 19:22176305-22176327 AATAAGAAACAAAAAGATTATGG + Intergenic
1164691022 19:30210829-30210851 ATGCAGAAACTGAGAGCTCAGGG - Intergenic
1167549990 19:50153896-50153918 ATGAAGAAACTGAGGCGTTAGGG + Intronic
1167616572 19:50537723-50537745 AAGAAGAAACTGACAAAGTATGG + Intronic
1202641708 1_KI270706v1_random:97797-97819 ATATAGAAACTGAAAAAGTAAGG - Intergenic
925176071 2:1784726-1784748 ACAAAGAAACTGAAAAATTGAGG - Intergenic
925437429 2:3852197-3852219 ATGAAGAGAAAGAAAGTTTAAGG + Intergenic
925459286 2:4045819-4045841 ATGAAGCAACTGCAGGATCAAGG - Intergenic
926293223 2:11547359-11547381 ATGAAGAAACTAAGAAAATAAGG - Intronic
926435574 2:12834310-12834332 AAGAAGTCACTGAAATATTAGGG - Intergenic
926553117 2:14324316-14324338 AGGAAGAAACTGAGATATTCAGG + Intergenic
926591396 2:14743817-14743839 CTGAAGAAACTGGAACATGATGG - Intergenic
926804824 2:16698219-16698241 ATGAAAAACCTTTAAGATTATGG + Intergenic
927037580 2:19195187-19195209 ATGAAGAAACTCTAATATCATGG + Intergenic
927857424 2:26536223-26536245 ATGAACAAAATGAAGGGTTATGG - Intronic
928071196 2:28219177-28219199 CTGAACAACCTGAAAGAGTAAGG - Intronic
928919991 2:36516856-36516878 ATGAGGAAACTGAGAGCTCAGGG - Intronic
929671123 2:43877012-43877034 ATGAAGAAACTGTGTGAATATGG + Intronic
929707656 2:44231798-44231820 ATTAAGAAATTGAACAATTATGG + Intronic
929759774 2:44797504-44797526 ATGAGGAAACAGAAAGACAAAGG + Intergenic
929963947 2:46519621-46519643 ATGAAGAAACTGAGGGCTTGAGG - Exonic
929988470 2:46762845-46762867 ATGAAGAAAATGAATGAGAATGG - Exonic
930749161 2:54915852-54915874 CTAAAGAAACTGGAATATTAAGG + Intronic
930757353 2:54990111-54990133 ATGAAGAAACTGAAATATAGAGG - Intronic
931022293 2:58061541-58061563 ATAAAGACACTAAAAGGTTAAGG + Intronic
931142836 2:59482549-59482571 ATGGAGAAGAGGAAAGATTATGG + Intergenic
931296390 2:60930098-60930120 ATGGAGAAATGGAAAGAATAGGG + Exonic
931326353 2:61229319-61229341 GTTAAGAAACTTAAAAATTAGGG + Intronic
931733039 2:65170000-65170022 AAGAAGAAAAAGAAAGATAAAGG + Intergenic
931774041 2:65524556-65524578 ATGAGAAAAATGAAAGAGTAGGG + Intergenic
933022656 2:77213997-77214019 TAGAAGAAACTGAAATATTAGGG + Intronic
933058930 2:77710710-77710732 ATGTAGTAATTGAAAGGTTATGG - Intergenic
933169776 2:79112248-79112270 AAGAAGCAACTTAAAGCTTATGG - Intergenic
933238578 2:79893746-79893768 AAGAACAAACTGCAGGATTAGGG - Intronic
933251179 2:80030320-80030342 ATGATGAAACTGAAAGTTTGTGG + Intronic
933447117 2:82395614-82395636 ATGCAGACACACAAAGATTAAGG + Intergenic
933485118 2:82911611-82911633 ATGATGAAAAAGAATGATTATGG - Intergenic
935280918 2:101517092-101517114 ATCAAGAAACTGAAGAGTTAAGG + Intergenic
935601879 2:104930464-104930486 ATAATGAAAGTGATAGATTAGGG - Intergenic
935643972 2:105317686-105317708 ATGAAGAAAGTGAAAAGATAAGG + Intronic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
936655802 2:114485500-114485522 ATAATCAAACTGAAACATTAAGG - Intronic
937576781 2:123433123-123433145 ATGAAGAAAATGTAAGAAAATGG + Intergenic
937667441 2:124502953-124502975 ATGAAGAAAATAATACATTACGG + Intronic
938147489 2:128848954-128848976 ATTAAAAAACTGAAAGATTAGGG + Intergenic
938189201 2:129259592-129259614 ATAAAGAAACTGGAATATCATGG - Intergenic
938856740 2:135320648-135320670 ATGATGAAACAGGAAGTTTATGG + Intronic
938926634 2:136049078-136049100 TTGAAGAAACTGACAGCTGAAGG + Intergenic
938945620 2:136209395-136209417 ATGAGGAAGCTGAAGGATTAGGG + Intergenic
939122646 2:138136709-138136731 ATGAAGAGACAAATAGATTAGGG - Intergenic
939676948 2:145084385-145084407 ATGCTGAAGCTTAAAGATTAAGG + Intergenic
939741966 2:145919033-145919055 AGGAAGAGACTGAGAGATGAGGG - Intergenic
939792019 2:146589397-146589419 ATCAAAAAACTAAAATATTATGG + Intergenic
940092162 2:149933005-149933027 TTGAAAAAACTGAAAGGTGATGG + Intergenic
940331889 2:152484188-152484210 ATGAAAAAACTGAGACATTCTGG - Intronic
941216902 2:162723169-162723191 ATGAAGAAACAGGTAAATTATGG - Intronic
941449581 2:165643671-165643693 ATGATAGAACTGAAACATTATGG - Intronic
941507493 2:166365676-166365698 ATGAAGTAAATGAAAAACTAAGG - Intronic
941898403 2:170653699-170653721 AGAAAGAATCTGAAAGATTTAGG - Exonic
942027758 2:171927458-171927480 ATGAAGTAATTGAAAAATGAGGG - Intronic
942090600 2:172486504-172486526 ATGACGAAACAGAGAGCTTAAGG - Intronic
943372791 2:187036554-187036576 AAGAAAAAACTGTGAGATTAGGG + Intergenic
943563426 2:189490229-189490251 ATGAAAAATTTGAAATATTATGG + Intergenic
944273889 2:197813307-197813329 ATTAAGAAACTGCAAGTTCAAGG - Intronic
944503682 2:200388029-200388051 TTGAAGAAACAGAAGGATTATGG + Intronic
944818238 2:203401501-203401523 ATTAGGAAACTGATGGATTATGG + Intronic
944975700 2:205048122-205048144 ATTACGAAACTGGAAGATGAAGG - Intronic
945081846 2:206093942-206093964 ATGAGGAAACTGAGAGGGTAAGG - Intergenic
945999005 2:216465158-216465180 ATGAAAAAAGTAAAAGTTTAGGG + Intronic
946614266 2:221492512-221492534 TTGAAGAAAATTAAAGATAAAGG - Intronic
947356079 2:229297004-229297026 TTGAAGTAAGTGAAATATTATGG - Intergenic
947430842 2:230026252-230026274 AAGATGAAACTGACATATTAAGG + Intergenic
947743477 2:232495882-232495904 ATGACCACACTGAGAGATTAGGG + Intergenic
1169015366 20:2288270-2288292 ATGAAGAAATCGAAAGGTTTGGG - Intergenic
1169511641 20:6270155-6270177 ATGAAGAAACTGAAGCATAAGGG - Intergenic
1169617212 20:7461860-7461882 ATGAAACAACTGGAAAATTAGGG + Intergenic
1170033340 20:11965458-11965480 ATGAGGAAACTAAAAAGTTAAGG + Intergenic
1170696121 20:18660545-18660567 AAGCAGAAACTGAAAGAAAAAGG + Intronic
1170995706 20:21355561-21355583 ATGAATATACTGCAAGATAAAGG - Intronic
1171029140 20:21661546-21661568 ATGGAGCAACTGAAAGATTGTGG - Intergenic
1172961502 20:38803631-38803653 ATCAAGAAAGTGAAAAGTTATGG - Intergenic
1173553139 20:43947235-43947257 ATGAAGAGACAGAAAGCTCAAGG - Intronic
1174125260 20:48299752-48299774 ATGCAGATACTGAAAGATGGTGG + Intergenic
1174269942 20:49360604-49360626 GAGAAGAACCTGAAAGATCAAGG + Intergenic
1174645395 20:52081021-52081043 ATGCAGAAACTAAAGGATAAGGG - Intronic
1175363290 20:58432031-58432053 ATGAAGAAGCTGAGGGATGATGG + Intronic
1175622127 20:60456859-60456881 CTGCAGAAACCAAAAGATTATGG + Intergenic
1175674574 20:60935665-60935687 GTGAGGATACTGAAAAATTATGG - Intergenic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1176403822 21:6343756-6343778 ATGATGAAAAAGAAAGATTGAGG - Intergenic
1176433335 21:6645348-6645370 ATGATGAAAAAGAAAGATTGAGG + Intergenic
1176853598 21:13943281-13943303 ATACAGAAACTGAAACATTAAGG - Intergenic
1177343624 21:19838353-19838375 TTGAAAAAAGAGAAAGATTAAGG - Intergenic
1177636894 21:23798957-23798979 ATGTAAATACTGAAAGCTTAGGG - Intergenic
1177668943 21:24200251-24200273 AGGCTGAAACTGAAAGATCAAGG - Intergenic
1177881173 21:26696731-26696753 TTGAAACAACTGAAAGATGAGGG - Intergenic
1177993193 21:28063030-28063052 ATGAAAAGACTGAAAAAATAAGG - Intergenic
1178074968 21:29006561-29006583 ATGATGAAACGGAAAGACAAAGG - Exonic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1180016448 21:45088490-45088512 AAGAAGAAATTGAAAAAATAAGG + Intronic
1180360237 22:11884068-11884090 ATATAGAAACTGAAAAAGTAAGG + Intergenic
1181150941 22:20882938-20882960 AAGAAGAAACTAAAAGTTCAAGG + Intronic
1181372870 22:22431920-22431942 ATGAAGAAAGGGAGAGATTTGGG + Intergenic
1182032618 22:27171407-27171429 ATGAAGAAACTGAGTCCTTAGGG - Intergenic
1183730179 22:39614158-39614180 ATGAAGAAACTGAGACAGAAGGG - Intronic
1183746456 22:39694634-39694656 AGGAAGAGACAGAAAGATTGAGG - Intergenic
1184103972 22:42356830-42356852 ATGAAGAAACAGAGAGGTGAAGG + Intergenic
949240081 3:1860379-1860401 ATTAAGGAACTGAATAATTAAGG - Intergenic
949288271 3:2432087-2432109 ATGAAGAAACAAAAATATTCTGG - Intronic
949569106 3:5274535-5274557 ATTAAGAAACTAAAACATCAGGG + Intergenic
950089356 3:10284516-10284538 ATGCAGATCCTGATAGATTAGGG + Intronic
950320646 3:12049541-12049563 ATAAAAAAACTGAAAGATGAGGG + Intronic
950519201 3:13486460-13486482 ATGAAGAAAGTGAAAAATAGAGG + Intronic
950667840 3:14508022-14508044 ATGAAGAAACTGAAACTCAAGGG - Intronic
951600096 3:24364621-24364643 ATGATGAAGCAGAAAGATTTTGG - Intronic
952054147 3:29424121-29424143 AAGTAGAAACTGAAAAAGTATGG + Intronic
952165633 3:30745900-30745922 AAGAAGAAATGGAAAGAATAAGG - Intronic
952570969 3:34715804-34715826 GGGAAGAAATTGAAAGATGAAGG + Intergenic
952794579 3:37227540-37227562 ATGCAGAAACAGGAAGTTTAAGG - Intergenic
953401489 3:42624372-42624394 TTGAAGAAATTCAAAGATTTGGG + Intronic
953858442 3:46520778-46520800 ATCAAAGAACTGAAAAATTAAGG + Intronic
954507966 3:51095538-51095560 ATTAAGAAACTGGGAGATTCTGG - Intronic
956018253 3:64907311-64907333 AGGAAGAAACTGGAAGATGGAGG - Intergenic
956475595 3:69616936-69616958 ATGAAGAAACTGAGATATTATGG + Intergenic
957200863 3:77134485-77134507 AAGGAGAAACTGAAGGATAAAGG + Intronic
957347186 3:78976975-78976997 ATGAAGAAATTTAAAGAAAATGG - Intronic
957444913 3:80303522-80303544 AGGAAGAAACAGAGAGATAATGG - Intergenic
957538298 3:81534199-81534221 ATGAAAAAAATGACAGATTCAGG - Intronic
957894690 3:86406629-86406651 ATGAAGAAACTGAAACAAGGAGG - Intergenic
958434029 3:94075931-94075953 ATGAAGACCCTGAAGGAATATGG - Intronic
958469990 3:94505167-94505189 CTTAAGAAACTGAAAAAATAAGG - Intergenic
959520910 3:107322082-107322104 ATGAACAAACTAAAATATTGGGG + Intergenic
959637393 3:108590302-108590324 ATGTAGAAATTGTAAGAATAGGG + Intronic
960846234 3:122006725-122006747 TTAAAGAAACTTAAACATTAGGG - Intronic
962076319 3:132085912-132085934 ATCAAGATACTGAAAGCATATGG + Intronic
962082934 3:132159760-132159782 GGGAAGAAACAGAAAGATTAGGG + Intronic
962424996 3:135261894-135261916 ATGAGGAAACTGAGAGACAAAGG + Intergenic
962669619 3:137691944-137691966 ATGAAGAGATTGAAAAGTTAAGG - Intergenic
962693050 3:137920238-137920260 ATGGAGAAACTTCAAGATTTGGG + Intergenic
963027034 3:140930265-140930287 ATGAGGAAACTGAGAGGTCAGGG - Intergenic
963318106 3:143782962-143782984 ATGATGGAACTGACAGAATATGG - Intronic
964224879 3:154386705-154386727 CTGAAGAAAACAAAAGATTAAGG + Intronic
964642010 3:158918459-158918481 ATGAACATATTGAAAAATTATGG + Intergenic
964711250 3:159674146-159674168 ATGAAGAGAGTGAAAGTTTGTGG - Intronic
964926693 3:161967378-161967400 ATGGAGAAAGTGAAAGTTTATGG + Intergenic
965141391 3:164840408-164840430 ATTAAGAAACAGAGAGATTAAGG + Intergenic
965165042 3:165187266-165187288 AGGAAGAAACTGCAGGTTTAGGG + Exonic
965329762 3:167357300-167357322 ATGAAGAAAGTCATAGATAAGGG + Intronic
965518384 3:169646926-169646948 AGGAAGAAAATGAAAGATGAAGG + Intronic
965686926 3:171314017-171314039 ATGGAGCAACTGAAATATTCAGG - Intronic
965873060 3:173283705-173283727 ATGATGAAAATGAAAGGTCAAGG - Intergenic
966181487 3:177192848-177192870 ATGAAGAAACAAACACATTAGGG + Intronic
966520098 3:180864454-180864476 ATAAAGAAACTGAAAGTTTCTGG - Intronic
966985629 3:185177869-185177891 ATGAAGAAAATGCAAGATCAAGG + Intergenic
967173967 3:186846016-186846038 ATGAGGAAACTGACAGATTAAGG - Intronic
967174246 3:186848417-186848439 ATGAGGAAACTGAGAGATTAAGG + Intronic
967540455 3:190661274-190661296 ATGAAGCTACTGAAATATTGGGG - Intergenic
967597105 3:191339102-191339124 GTGAAGAATCTGAAAGTTTTGGG + Intronic
967879404 3:194288702-194288724 ATCAAGAAAATGAAATATTCAGG + Intergenic
967879405 3:194288742-194288764 ATCAAGAAAATGAAATATTTAGG + Intergenic
968161027 3:196426940-196426962 ATCAACCATCTGAAAGATTAAGG + Intronic
969708490 4:8829301-8829323 ATGAAGAGACAGAAAGACAAAGG + Intergenic
970174046 4:13320191-13320213 AAGAAGACACTGAAAGAGAAGGG - Intergenic
970216867 4:13767832-13767854 ATGAAGATGCTGAGAGAGTAAGG - Intergenic
970356415 4:15258059-15258081 AAGAAGAAAAAGAAAGATTTAGG - Intergenic
970942064 4:21646111-21646133 ATCAAGACAATGAAGGATTAGGG - Intronic
971035504 4:22688796-22688818 ATGAAGAAACTGTAAATTCAGGG - Intergenic
971245985 4:24928483-24928505 ATGAAGAAAATGAAAAATACTGG - Intronic
971256336 4:25017059-25017081 ATGTATAAACTGAAAGTTTGTGG + Intronic
971399230 4:26260329-26260351 GTGTAGAAACTGAAAAATAAAGG + Intronic
971566428 4:28148489-28148511 ATTCAGCAACTGACAGATTAAGG + Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971733311 4:30414338-30414360 ATGAAGAAATTGTAAGATTAGGG + Intergenic
971845975 4:31917891-31917913 ATGAAGCAAATGTTAGATTAGGG + Intergenic
972032782 4:34482994-34483016 ATGAAGAAACTGAGTGAATTTGG + Intergenic
972554695 4:40170190-40170212 CTAAAAAAACTGAATGATTAAGG - Intergenic
973891575 4:55372702-55372724 TAGTAGAAAATGAAAGATTAAGG - Exonic
974629661 4:64469240-64469262 ATGAAAATAGTGAAAGATTAGGG - Intergenic
975601571 4:76105606-76105628 CTGAACTAACTGAATGATTATGG - Intronic
976185636 4:82440255-82440277 ACAAAGAAAATGAGAGATTATGG - Intronic
976422044 4:84856520-84856542 TTGCTCAAACTGAAAGATTATGG - Intronic
976747385 4:88417488-88417510 ATGAAGCAGCTGAGAGATGATGG - Exonic
976855450 4:89599613-89599635 ATGAAGAAACAAAAAAGTTAAGG - Intergenic
976860285 4:89657311-89657333 ATTGACAAACTGAAATATTAAGG + Intergenic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
977135184 4:93295141-93295163 GTGAATAAAATGAAAGTTTAGGG + Intronic
977147272 4:93459415-93459437 ATCAAGGAACTGAGAGATAAAGG + Intronic
977284326 4:95083331-95083353 ATAAAGACACAGAAAGATCATGG + Intronic
977503352 4:97869310-97869332 ATGAAAAAACTAAAAGTTAAAGG + Intronic
977717071 4:100194874-100194896 ATGAAAAAACTGAATCATTCTGG - Intergenic
977797620 4:101186078-101186100 ATGAAGAAATTGTAAGTTAAAGG - Intronic
977827207 4:101547379-101547401 TTGAAGTAACTGAAAGGTTCAGG + Intronic
977862146 4:101974965-101974987 ATAAATAAACTGAAACATTTAGG + Intronic
978697231 4:111596866-111596888 ATGAGGAAAGTGAGAGATGACGG + Intergenic
978818955 4:112943080-112943102 AGAAAGAAAAAGAAAGATTAAGG - Intronic
979040442 4:115785153-115785175 ATGAAGAAATTGACATATAAAGG - Intergenic
979098014 4:116575152-116575174 ATCAAGAACTTGAAAGATTTTGG - Intergenic
979479108 4:121194690-121194712 ATGAAGACACTCAAGGTTTAGGG - Intronic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
979718688 4:123872318-123872340 ATGAAGAAAGTGGCAGGTTAAGG - Intergenic
979917656 4:126457087-126457109 CTGATGGAACTGAAAAATTACGG - Intergenic
980417095 4:132504437-132504459 ATAAATAAACTGATAGATGAGGG - Intergenic
980666602 4:135947358-135947380 CTGATGAAAATGAAATATTAGGG + Intergenic
980772016 4:137386159-137386181 AAAAAGAAAATGAAAGATAAAGG + Intergenic
981030513 4:140120680-140120702 ATGAGGAAAAAAAAAGATTAAGG - Intronic
981168148 4:141587671-141587693 AAGAAGAAACTGAAAGACAAAGG - Intergenic
981250077 4:142590516-142590538 ATGCCGAAATTGAAAAATTAAGG + Intronic
981448502 4:144868482-144868504 ATCAAGAAACAGAAAGATATGGG + Intergenic
981559948 4:146036915-146036937 ATGAATAAATTGTGAGATTATGG + Intergenic
981886652 4:149682813-149682835 ATGAAGAAACTAAGACATTTAGG + Intergenic
982264460 4:153525639-153525661 ATTAAGAAACTGAAAGAAAAAGG - Intronic
983100036 4:163614349-163614371 CTGAGGAAACTGAAAAATTGGGG + Intronic
983206181 4:164912381-164912403 ATGAAGAAAATGAAATATGAAGG + Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984053769 4:174900144-174900166 TTGAAAAAAATGAATGATTAAGG - Intronic
984296097 4:177856481-177856503 AGGAAGAAACTGAAAAGTCAGGG - Intronic
984437550 4:179724590-179724612 ATGAGGAACATGAAAGAATATGG - Intergenic
984445012 4:179825507-179825529 ATGACAAAACTGAAATATCAGGG + Intergenic
984535323 4:180968066-180968088 ATTAAGGCACTGAAAGATTCAGG - Intergenic
984841795 4:184075421-184075443 AGAAAGAAATGGAAAGATTAAGG + Intergenic
984982325 4:185294446-185294468 ATGAAGATACTGAAGGAGTCAGG + Intronic
1202769080 4_GL000008v2_random:183664-183686 ATATAGAAACTGAAAAAGTAAGG - Intergenic
986257943 5:6116626-6116648 GTGAAGATACTGAAGGATGATGG + Intergenic
986976800 5:13403941-13403963 GTCAAGAAACTGAAAGGCTAGGG + Intergenic
987824601 5:23012860-23012882 ATAAAGAAAAAAAAAGATTATGG - Intergenic
988003354 5:25378046-25378068 ATAAAGCAGCTGAAAGATTCAGG - Intergenic
988246748 5:28694202-28694224 AAGAAGTAGCTGAAAGAATATGG + Intergenic
988615645 5:32772214-32772236 TGGAAGAAACTGATAGATTCTGG - Intronic
988855171 5:35221314-35221336 ATTATGAGACTGAAAGATAAAGG - Intronic
989465718 5:41752871-41752893 AAGGAGAAAGAGAAAGATTAGGG - Intronic
989575401 5:42983071-42983093 AGCAAGAAACTGAAAAATTGGGG + Intergenic
990153057 5:52842305-52842327 ATGAAGAAAATCTAAGATGAGGG - Intronic
990406189 5:55493333-55493355 AAGAAAAAACTGAAAGTTAATGG + Intronic
990649245 5:57879422-57879444 ATGAATAGACTGAAAAATTAAGG - Intergenic
990679371 5:58223623-58223645 AAGAACAAACTAAAACATTAAGG + Intergenic
991254386 5:64598271-64598293 ATGAGACAACTGAAAGATGAGGG - Intronic
992489530 5:77228688-77228710 ATGGAGAAAATGAAAGATGAGGG + Intronic
992525626 5:77607406-77607428 ATGAGGACACTGAAAGATACAGG + Intronic
992606573 5:78463402-78463424 GAGAAGAAACTGAAATAATAAGG - Intronic
993408585 5:87545386-87545408 ATGAATAAATGGAAAGATCATGG + Intergenic
993644512 5:90445811-90445833 AGGAAGAAACTGGAAGAGGAGGG + Intergenic
994057492 5:95434638-95434660 ATGAAGAAATTGACAAATTGTGG - Intronic
994086358 5:95763543-95763565 AGGAAGAAGTTGAAAGATTCTGG + Exonic
994190394 5:96862779-96862801 ATGAGGCAATTGAGAGATTAAGG + Intronic
994423609 5:99556251-99556273 TTGAAGATACTGTAAAATTAAGG + Intergenic
994598516 5:101870932-101870954 ATAAAAAAATTGAAATATTATGG + Intergenic
995673691 5:114637250-114637272 ATAAAGAACATGCAAGATTATGG + Intergenic
995823212 5:116262444-116262466 ATTAAGAAACTGAAGAATGATGG - Intronic
996107787 5:119525577-119525599 AGCAAGGAACTGAAAGGTTAGGG + Intronic
996209341 5:120786187-120786209 ATTAAGAAACAGAAATATTTGGG - Intergenic
996498795 5:124192722-124192744 ATCAAGAAACTGTAAAATAATGG - Intergenic
996615052 5:125431221-125431243 ATGAAGGAACTGAGAAGTTAAGG - Intergenic
997742606 5:136270293-136270315 AAGAAGAAACTGAAACACTAAGG - Intronic
998561429 5:143175791-143175813 ATGAGGAAATTTAAAAATTAAGG - Intronic
998602252 5:143596744-143596766 ACAATGAAACTGAAAGAATATGG + Intergenic
998866799 5:146513460-146513482 ATGGAGAATCTGAAATATAAAGG - Exonic
998922377 5:147083867-147083889 ATGAAGGAACTGGAGGATTCAGG + Intronic
999056524 5:148583888-148583910 ATTAAGAAACTGGGAGATTCTGG - Intronic
999657274 5:153822858-153822880 ATGAAGAAAATAAAATTTTATGG - Intergenic
1000178968 5:158788656-158788678 ATGAAGAAAATGAATATTTATGG - Intronic
1000808904 5:165836075-165836097 ATAAACAAGGTGAAAGATTATGG + Intergenic
1002826397 6:777944-777966 ATGAAGACACAGGAAGATGAAGG + Intergenic
1002937710 6:1687721-1687743 ATGCAGAGACTGAAAGAGTGTGG + Intronic
1003347134 6:5280587-5280609 ATAAAGAAACTGAAGTATCAAGG - Intronic
1003458745 6:6309512-6309534 CTTAAGAAATTGAAAGATGATGG + Intronic
1003734334 6:8860939-8860961 TTGAATAAACTGAGAGATGATGG + Intergenic
1004190837 6:13462056-13462078 ATGGAGAAACCGAGAGGTTAAGG - Intronic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005947751 6:30606611-30606633 AAGAAGAAACGTAAAGATGAAGG - Exonic
1006077589 6:31543883-31543905 ATGAAGAAAATGCAAGGTAAAGG + Intronic
1006306644 6:33225241-33225263 ATGAATAAATAGAGAGATTATGG + Intergenic
1006822857 6:36912246-36912268 ATGAACAAACTGAAAGTTAGAGG - Intronic
1007625216 6:43242750-43242772 AGGAAGAAACTGAAAGAGACAGG + Intergenic
1007656460 6:43454111-43454133 ATGAGGAAATGGAAAGATAAAGG - Intronic
1008023458 6:46606589-46606611 ATAAAGAAACTGAGTGATTTGGG + Intronic
1008280849 6:49594190-49594212 ATGAATGCATTGAAAGATTAAGG + Intergenic
1008668280 6:53739326-53739348 ATTAAGAAACTGAAATAATATGG + Intergenic
1009217374 6:60939321-60939343 GTGAAGAAACTCAAACACTATGG + Intergenic
1009250042 6:61287648-61287670 ATGCTGACACTGAAAGATTGGGG - Intergenic
1009682580 6:66917259-66917281 GTGAAGATACTTAAAGATTGAGG + Intergenic
1009755503 6:67934327-67934349 GTGACGAAGCTGAAAGATGAGGG + Intergenic
1009855945 6:69263823-69263845 ATGAAGAAACTGAGACATAGAGG + Intronic
1009979042 6:70704602-70704624 AAGAATAAACTCAAAGACTAAGG - Intronic
1010348923 6:74848291-74848313 ATGCAGAAACAGAAATATTGTGG + Intergenic
1010694586 6:78954600-78954622 ATGAAGACACTGTAAGAATTGGG - Intronic
1010809259 6:80280124-80280146 CTGAAGAATCTTAAATATTAAGG + Intronic
1011180569 6:84615202-84615224 ATGAAGAAAGAGAAAGATTAGGG - Intergenic
1011519215 6:88185715-88185737 ATGAAAATGCTGAAAAATTATGG + Intergenic
1012031635 6:94075132-94075154 AGGAAGATACTGAAAAAATATGG - Intergenic
1012631712 6:101478037-101478059 ATGAAAAGGCTGATAGATTATGG + Intronic
1013097548 6:106959340-106959362 ATGAAGAAACTGAAAGACATTGG - Intergenic
1014024481 6:116629504-116629526 ATGAATAATCTGAAATTTTAAGG + Intronic
1014786785 6:125628499-125628521 TTGAATAAACTGAAAGACTAGGG + Intergenic
1015035458 6:128648405-128648427 ATGAAGTAACTGATAGACTTAGG + Intergenic
1015399392 6:132771725-132771747 ATGAAGAAATTGAAACACTGAGG - Intronic
1015797915 6:137031737-137031759 ATCAAGAAAATGAAAGAGGATGG + Intronic
1016671518 6:146714598-146714620 ATGCTGAACCAGAAAGATTAGGG + Intronic
1018305654 6:162452526-162452548 ATGAAGAAACTAAGAAGTTAAGG + Intronic
1018417510 6:163613809-163613831 ATGAAAACACTCAAGGATTATGG - Intergenic
1018497861 6:164368641-164368663 ATAAAGAAGCTGAAAGAACAGGG - Intergenic
1018662361 6:166099955-166099977 ATGAAGGAACTGAAATCTGATGG - Intergenic
1018677595 6:166236353-166236375 ATGAAGTAATGAAAAGATTAGGG - Intergenic
1019939120 7:4275288-4275310 AAGAAGAAAAAGAAAGATGAGGG + Intergenic
1020531819 7:9347747-9347769 CTGCAGAGACTGAAAGATAAGGG + Intergenic
1020572603 7:9884541-9884563 ATGAAGAAATTGCAAAACTAAGG + Intergenic
1020894233 7:13919207-13919229 ATGAAGAAACTGGAGGCATAAGG + Intronic
1023383104 7:39627959-39627981 ATGAAAAATATGAAAGATAAAGG - Intronic
1024401867 7:48933290-48933312 ACAAAGAACCTGAAAAATTAAGG + Intergenic
1026513046 7:71043412-71043434 ATGGAGACACTGAGTGATTAAGG + Intergenic
1027023855 7:74836491-74836513 ATGAAGAAACTGAAATTTAAAGG + Intronic
1027064074 7:75108830-75108852 ATGAAGAAACTGAAATTTAAAGG - Intronic
1027418300 7:77995574-77995596 GTGAAGATAATGAAAAATTATGG - Intergenic
1027469769 7:78558631-78558653 GTGAAGAAACTGAAGGATGGAGG - Intronic
1027818786 7:83015718-83015740 CTAAAGAAACTGAAAAATAATGG - Intronic
1027948948 7:84787664-84787686 AGGAAGAAACTGGAATATAAAGG + Intergenic
1028457371 7:91053261-91053283 ATGAAGAAACTGGGAAATTGAGG + Intronic
1029005012 7:97200383-97200405 ATGACTAAACAAAAAGATTATGG + Intergenic
1029528541 7:101110141-101110163 ATGAGGAAACTGACAGATAGAGG - Intergenic
1029992524 7:104975123-104975145 ATGGAGAAATGGAAACATTAAGG + Intergenic
1030152974 7:106424834-106424856 AAGAAGAAAATAAAAGATTCTGG + Intergenic
1031097659 7:117440754-117440776 ATAAAGAAAGTGAATGATGATGG - Intergenic
1031277859 7:119753887-119753909 ATGAATAAACTGAAAAACTGAGG + Intergenic
1031323379 7:120362020-120362042 CTATAGAAAATGAAAGATTATGG - Intronic
1031332838 7:120487373-120487395 ATGAAGAAAGTGAAAGAAATGGG + Intronic
1031552645 7:123133828-123133850 ATGAATAAAAATAAAGATTAGGG - Intronic
1031743271 7:125461556-125461578 CTAAAGAAACTGAGAGATTTTGG + Intergenic
1031766402 7:125783168-125783190 AATAAGAAACTAAAGGATTAAGG + Intergenic
1031814319 7:126414434-126414456 CTGAAGCAATTGAAACATTATGG - Intergenic
1031909404 7:127499189-127499211 ATGAAGAAACAGAAACCATATGG - Intergenic
1032158195 7:129487948-129487970 ATGGAGAAACTGAAGCACTAAGG + Exonic
1032419556 7:131766916-131766938 ATGAAGAAACTGAGACAACAGGG + Intergenic
1033182939 7:139198633-139198655 AAGAAGAATCTGTAAGATTCTGG - Intergenic
1033441001 7:141378777-141378799 AAGAAGAAACTGCAAGAAAAAGG + Intronic
1035568389 8:656868-656890 AAGCAGAAACTTAAACATTATGG + Intronic
1036195709 8:6712200-6712222 AATAAGAAACTAAAAGATTATGG - Intronic
1036495372 8:9265526-9265548 ATGAGAAAACTGAGAGGTTAGGG - Intergenic
1036732656 8:11279972-11279994 ATAAAGAAACTAAAAGAAAAAGG + Intergenic
1038467213 8:27774952-27774974 ATGAACAAACTGAAAGGCCAGGG - Intronic
1039033788 8:33337021-33337043 GTGAAGAGAGTGAAAGAATAAGG + Intergenic
1039047387 8:33462396-33462418 AGGAAGAAAATAAAAGATTCAGG + Intronic
1040077560 8:43253545-43253567 ATACAGAAAATGAAAAATTAAGG + Intergenic
1040751629 8:50716229-50716251 GTGAAATAATTGAAAGATTATGG - Intronic
1041220849 8:55649350-55649372 ATGTGGAAACTTAAAGATAATGG - Intergenic
1041795352 8:61742088-61742110 ATGAAGGAACTGGAGTATTATGG + Intergenic
1041917991 8:63155081-63155103 ATTAAGAAAGTAAAAGAATAAGG + Intergenic
1042237800 8:66631542-66631564 ATGAAGATACTTAAAAATAATGG + Exonic
1042287233 8:67127084-67127106 AAGGAGAAACTGAAAGGTCAAGG + Intronic
1042468402 8:69155256-69155278 AAAAAGAAACTGAAAAAATAAGG - Intergenic
1042573314 8:70191083-70191105 ATGATGAAGCTGAAAGTTTATGG - Intronic
1043223232 8:77692784-77692806 ATGAAGAAAATGGAAGAAAAAGG + Intergenic
1043834268 8:85028993-85029015 ATGAAGAAACTAAAAGATGTGGG - Intergenic
1043883641 8:85573668-85573690 ATTAAGGAAATGAAAGATTTTGG - Intergenic
1043934591 8:86129174-86129196 CTGAAGAAACTGAACTCTTAGGG + Intronic
1044066100 8:87702427-87702449 ATGAAGATACAGTAAAATTATGG + Intergenic
1044077063 8:87834909-87834931 TTGAAGAAAATGAAAGAGTTGGG - Intergenic
1044216066 8:89612140-89612162 AAGAAGAAACCGAGAGAATAAGG + Intergenic
1044483069 8:92715740-92715762 ATGAAGAAAATTCAAGATTTAGG - Intergenic
1044586972 8:93877211-93877233 ATGCAGATACTGAAAGTTTAGGG + Intronic
1045121182 8:99036975-99036997 ATGAAGAATCTGAGACATGAAGG - Intronic
1045403464 8:101841895-101841917 ATAAAGAAAAAGAAAGAATACGG + Intronic
1045937056 8:107692152-107692174 ATAAATAAACTGAAAGAGGAAGG + Intergenic
1046086291 8:109439786-109439808 AGGAAGATACTGAAATTTTATGG + Intronic
1046612237 8:116438732-116438754 CTGGAGACACTGAAAGTTTATGG - Intergenic
1046726510 8:117680620-117680642 CTGAAGAAACTGAATTTTTAAGG + Intergenic
1046823420 8:118660544-118660566 ATTAATGAACTAAAAGATTAGGG - Intergenic
1046973048 8:120244103-120244125 GTGAAGAAACTAAAAGATTTGGG + Intronic
1047020598 8:120771409-120771431 ATGAAGAAAAAGACAGATTTAGG + Intronic
1047186081 8:122634650-122634672 GTGTAGAAACTGAAAGCTAAAGG + Intergenic
1047350556 8:124069428-124069450 AAGAAGAAACCCAAAGATGATGG + Exonic
1047486818 8:125338801-125338823 ATGATGAAACTGAATGATTATGG + Intronic
1047608227 8:126495818-126495840 AGGAAGAAACTGAATGAGTTTGG + Intergenic
1047686435 8:127309339-127309361 ATGAAGAAACTGACATAACAGGG - Intergenic
1048289649 8:133171016-133171038 ATAAAGAAACTTGAAGGTTAAGG + Intergenic
1048518330 8:135131032-135131054 GTGGAGAATCTGAAAGATTTCGG + Intergenic
1049993145 9:1009156-1009178 ATGATGGAAGTGAAAGATCAGGG - Intergenic
1050412056 9:5376402-5376424 ATAAGGAAACAGAGAGATTAAGG - Intronic
1050802709 9:9636072-9636094 ATGAAGAACCTGAAAAAGTGTGG - Intronic
1050943924 9:11494332-11494354 CTGAAGAAACTCATTGATTATGG - Intergenic
1051063465 9:13073087-13073109 GTGAAGATACTGGAAGAATATGG - Intergenic
1051273564 9:15377915-15377937 ATGAAGAAAGTGAAAAAAAAAGG - Intergenic
1051834969 9:21325238-21325260 ATCAATTAACTCAAAGATTAAGG - Intergenic
1052150886 9:25114080-25114102 ATGAGGAAACTCATAGATAAAGG - Intergenic
1052239733 9:26256712-26256734 ATGAAGAAACTGAAAGTTAGAGG - Intergenic
1052874543 9:33545243-33545265 ATACAGAAATTGAAAAATTAAGG + Intronic
1053008025 9:34616942-34616964 ATGCAGGAAGGGAAAGATTAGGG + Intronic
1053501478 9:38599050-38599072 ATACAGAAATTGAAAAATTAAGG - Intergenic
1054360622 9:64111974-64111996 ATATAGAAACTGAAAAAGTAAGG + Intergenic
1054989030 9:71299787-71299809 ATAAAGAAACTGAAAATTTGTGG + Intronic
1055057226 9:72035084-72035106 ATAAATAAAATGAAAGATAATGG + Intergenic
1055351931 9:75398653-75398675 ATGAAGAGAGTGAAAGCCTATGG + Intergenic
1055553339 9:77451217-77451239 ATGAGGAAACTGAGGGCTTAGGG - Intronic
1055849884 9:80613501-80613523 ATAAGAAAACTGAAAGATGATGG - Intergenic
1056338139 9:85598192-85598214 ATAAAGAAACTGAAAACTTAGGG - Intronic
1056936382 9:90918174-90918196 ATGACAAAACTGAAAGTTAAAGG - Intergenic
1056993367 9:91431315-91431337 ATGAAGAAACTGAGGCATCAAGG - Intergenic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1057251411 9:93506326-93506348 ATGAAGAAAATTCAAGTTTACGG - Intronic
1057680874 9:97183432-97183454 ATATAGAAATTGAAAAATTAAGG - Intergenic
1058382553 9:104393718-104393740 ATGCAGAAACTGAGAGGTTAAGG + Intergenic
1058438596 9:104987204-104987226 AGGAAGAGAGAGAAAGATTAAGG - Intergenic
1059326356 9:113506263-113506285 ATGAAGAAACTTAGAGAAAAAGG + Intronic
1059545267 9:115169408-115169430 ATGAAAAAACTGTAAGATTTTGG + Intronic
1059556333 9:115284320-115284342 AGGAAGAAAATGAAAGAACATGG + Intronic
1059721591 9:116965251-116965273 ATGAATAAACTTAAACATTCAGG + Intronic
1059754760 9:117282160-117282182 AAGAAGAAACTGAGAGAATGGGG - Intronic
1059962448 9:119578523-119578545 ATGAAGAAACTGAGATTATAAGG + Intergenic
1059998436 9:119936387-119936409 ATGAAGAAGATGAAATATAATGG + Intergenic
1061321487 9:129833456-129833478 ATGAAGAAACTGAAGGAAAGGGG - Exonic
1061829976 9:133285535-133285557 ATGAGGAAATTGAAAGACTGAGG - Intergenic
1203428077 Un_GL000195v1:59980-60002 ATGATGAAAAAGAAAGATTGAGG + Intergenic
1203438201 Un_GL000195v1:163322-163344 ATGATGAAAAAGAAAGATTGAGG - Intergenic
1203693962 Un_GL000214v1:77379-77401 ATATAGAAACTGAAAAAGTAAGG - Intergenic
1203705582 Un_KI270742v1:40046-40068 ATATAGAAACTGAAAAAGTAAGG + Intergenic
1203558414 Un_KI270744v1:25759-25781 ATATAGAAACTGAAAAAGTAAGG - Intergenic
1203642311 Un_KI270751v1:26684-26706 ATATAGAAACTGAAAAAGTAAGG + Intergenic
1185505698 X:631132-631154 AAGGAGAAACTGAAAGAATTCGG + Exonic
1185531308 X:821083-821105 TTTAAAAAATTGAAAGATTATGG - Intergenic
1185745912 X:2573304-2573326 ATGAAGAAACAGAGAAAGTAAGG - Intergenic
1186036264 X:5426680-5426702 ATAAAGAAATTGAAAGATGTAGG + Intergenic
1186136019 X:6521850-6521872 ATGATGTAACTGAAATATAATGG - Intergenic
1186615875 X:11187542-11187564 ATGAAGAAATTACAAAATTATGG - Intronic
1186777872 X:12883631-12883653 AGCAAGAAACTGACTGATTAAGG + Intronic
1186908082 X:14132722-14132744 TTGAAGAAACAGAACGATTCTGG - Intergenic
1187993670 X:24902760-24902782 ATGGAAAAACAGAAAGGTTAGGG + Intronic
1188464184 X:30460275-30460297 AGGAAGAACCTGAATGTTTATGG - Intergenic
1188773120 X:34178880-34178902 ATGAAGAAAGAGAAAAATTACGG - Intergenic
1189144932 X:38645968-38645990 ATGAAGAACCTGAAAGTATAGGG + Intronic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1189836324 X:45026999-45027021 CTGAAGATAATGAAAGTTTAGGG + Intronic
1189836345 X:45027173-45027195 CTGAAGATAATGAAAGTTTAGGG + Intronic
1189891075 X:45603306-45603328 AGGAATAAACTCAAAGATTTAGG + Intergenic
1189988839 X:46575945-46575967 AACATGAAACAGAAAGATTAGGG - Intronic
1190365146 X:49685947-49685969 AGAAAGAAACTGAAAGAAAAAGG + Intergenic
1190483350 X:50899572-50899594 ATGTTGAAACTGAAAGTTGAGGG - Intergenic
1190500272 X:51069080-51069102 ATCAAAAAATTGAAAGATAAGGG + Intergenic
1190711682 X:53076200-53076222 AGGAAGAAACAGAAAGGGTAGGG - Intronic
1190989484 X:55531318-55531340 ATGAAGAAACTTGATGATGAAGG - Intergenic
1191606728 X:63070881-63070903 ATGAAGAAAATGAATATTTATGG + Intergenic
1192112193 X:68376477-68376499 ATAAAGAAAGAGAAAGATCATGG + Intronic
1192658014 X:73012714-73012736 ATGAAGAACTTGAAAGATGCAGG - Intergenic
1193239656 X:79152754-79152776 ATAGAGAAACTGAAAAATGAGGG - Intergenic
1193258268 X:79376143-79376165 ATGAAGAAACTGAGATTCTAAGG + Intergenic
1193874392 X:86842598-86842620 ATGATGACAGTGAAAAATTATGG + Intergenic
1194298766 X:92159953-92159975 ATAATCAAACTGAAACATTAAGG - Intronic
1194947336 X:100084658-100084680 TTGTATAAACTAAAAGATTAAGG + Intergenic
1195794101 X:108624539-108624561 AAGAAGAAACTGAATAATCAAGG - Intronic
1196713038 X:118783256-118783278 ATGAAGAAAATCAGTGATTAGGG - Intronic
1197388106 X:125826283-125826305 AAAAAGAAACTGAAAGGCTAAGG - Intergenic
1197424649 X:126280860-126280882 ATGAAGAAACTGAGACAAAAAGG - Intergenic
1198175866 X:134153834-134153856 ATGAAGGAAATGAAAGAAAAGGG + Intergenic
1198519983 X:137442618-137442640 ATGAAGATGCTGGCAGATTAGGG - Intergenic
1198666358 X:139027767-139027789 ATAAAGAAACAGAAAAATTCAGG + Intronic
1198751612 X:139941564-139941586 GTAAAGAAACTGAGAGGTTATGG + Intronic
1198881203 X:141283143-141283165 CTGAATAACCTGAAATATTAAGG - Intergenic
1199139785 X:144296508-144296530 ATGAACTGACTGACAGATTATGG - Intergenic
1199885760 X:152020528-152020550 ATTAAGGAACTGAAAAATTAGGG + Intergenic
1200616379 Y:5384930-5384952 ATAATCAAACTGAAACATTAAGG - Intronic
1200976826 Y:9220255-9220277 ATAAAGAAAATGAAAAATAAAGG - Intergenic