ID: 1155906527

View in Genome Browser
Species Human (GRCh38)
Location 18:31458740-31458762
Sequence TTCCCTCAGGCGAGGCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155906527_1155906532 2 Left 1155906527 18:31458740-31458762 CCACAGAGCCTCGCCTGAGGGAA 0: 1
1: 0
2: 0
3: 9
4: 191
Right 1155906532 18:31458765-31458787 CAGCAGAGGGTGCATGAGTGAGG 0: 1
1: 0
2: 0
3: 65
4: 464
1155906527_1155906533 3 Left 1155906527 18:31458740-31458762 CCACAGAGCCTCGCCTGAGGGAA 0: 1
1: 0
2: 0
3: 9
4: 191
Right 1155906533 18:31458766-31458788 AGCAGAGGGTGCATGAGTGAGGG 0: 1
1: 0
2: 2
3: 29
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155906527 Original CRISPR TTCCCTCAGGCGAGGCTCTG TGG (reversed) Intronic
900119458 1:1042280-1042302 GTCCCTCTGGGAAGGCTCTGGGG + Intronic
900220102 1:1503841-1503863 CTCCCTCTCGGGAGGCTCTGCGG - Intergenic
900687118 1:3955644-3955666 TTCCCACAGGCCATGCCCTGGGG + Intergenic
901876183 1:12168199-12168221 GTCCATCAGGGGCGGCTCTGAGG - Intronic
902559271 1:17266904-17266926 AACCCACAGGCGAGACTCTGAGG + Intronic
903443939 1:23408713-23408735 TTCTTTCAGGAGAGACTCTGTGG - Exonic
904479142 1:30783201-30783223 TTCCTCCAGGGGAGGCCCTGGGG - Intergenic
905791349 1:40791407-40791429 TGCCCCCAGTGGAGGCTCTGAGG + Intronic
905875657 1:41430742-41430764 TTACCTCAGGCTTGGCTGTGGGG + Intergenic
906520558 1:46464575-46464597 TTCACTCAGGGGAGCCTCTGTGG + Intergenic
906712064 1:47938094-47938116 TTCCCTCAGGCCTTGTTCTGTGG - Intronic
907956044 1:59229187-59229209 TTCCCTTTGGAGAGGTTCTGGGG + Intergenic
911167778 1:94739847-94739869 TTCCCTCCTGCCAGGCCCTGAGG - Intergenic
912467783 1:109885979-109886001 GTCCCTCAGGGTAGGCTCAGGGG - Intergenic
912861807 1:113219987-113220009 TTCCCTTAGGTGGGCCTCTGAGG + Intergenic
912952933 1:114133052-114133074 TACCCTCAGTCCAGGCTCTCTGG + Intronic
914243605 1:145869754-145869776 TTCCCTCAGGCGGAGCACAGTGG - Intronic
916640103 1:166718137-166718159 TGCCCTCAGCAGAGGTTCTGTGG + Intergenic
918223678 1:182458758-182458780 TTCCCTCAGGCCAGGCACGGTGG - Intronic
919727839 1:200895371-200895393 TTCCCTCAGGCCGGGCCATGGGG - Intronic
921274562 1:213506098-213506120 TTCTCTCAGAAGGGGCTCTGAGG + Intergenic
922874420 1:228928755-228928777 CTCCCTCAGGCCTGCCTCTGGGG + Intergenic
923335557 1:232966863-232966885 TTCTCTGAGGAGAGGCTGTGAGG + Intronic
1064640258 10:17408375-17408397 TTTCCTCAGGCCAGGCACGGTGG + Intronic
1067073296 10:43154444-43154466 TTCTCCCAGGCCAGGCTCAGTGG + Intronic
1067512924 10:46910697-46910719 TACCCTCTGTCCAGGCTCTGAGG - Intergenic
1067649322 10:48141125-48141147 TACCCTCTGTCCAGGCTCTGAGG + Intergenic
1071164225 10:82786055-82786077 TTTCCTCAGTGGAGGCTCTCCGG - Intronic
1071259970 10:83910788-83910810 TTCCCCCAACCTAGGCTCTGTGG - Intergenic
1071372484 10:84966525-84966547 TTCTCTCAGGTGTGGGTCTGCGG + Intergenic
1071549229 10:86553430-86553452 CTCACTGAGGCAAGGCTCTGAGG - Intergenic
1071876932 10:89852446-89852468 TTCCCTGTGGTGAGGCACTGGGG + Intergenic
1073243888 10:102075822-102075844 TTCCCTCATGCCAAGCACTGAGG - Intergenic
1074766911 10:116706380-116706402 TTCCCTAGGGCCAGGTTCTGTGG - Intronic
1077017534 11:403559-403581 CCCCCTCAGGTGAGGGTCTGAGG + Intronic
1077647978 11:3943153-3943175 TTTCCTAAGGCCAAGCTCTGAGG + Intronic
1079092174 11:17488804-17488826 TTTCCTAAGGGGAGGCTCTAAGG - Intergenic
1080003700 11:27381405-27381427 TTCCCTCAGGCAGGGCACAGTGG + Intronic
1080610685 11:33901228-33901250 TTCCATCAGGTTGGGCTCTGTGG - Intergenic
1081460036 11:43264150-43264172 TTCCGTCAGGCTGGGCTCTCAGG + Intergenic
1082000783 11:47392920-47392942 TGCCCTCAGGCGAGGACCGGTGG + Intergenic
1083253106 11:61481193-61481215 TTTCCTCTGCAGAGGCTCTGAGG - Exonic
1084330440 11:68426835-68426857 GGCCCTCAGCGGAGGCTCTGTGG + Intronic
1084668151 11:70587855-70587877 TTGCCTCAGGCCAGGCACAGTGG - Intronic
1084683799 11:70681984-70682006 TTCCCCCAGGCAAGGGGCTGCGG + Intronic
1087816143 11:102661154-102661176 ATGCCTCAGGCCAGGCACTGTGG - Intergenic
1092862878 12:12734825-12734847 TTTACTAAGGCCAGGCTCTGTGG + Intronic
1096435384 12:51586543-51586565 TTCCCTCAAGCCAGGCACAGTGG + Intergenic
1096464091 12:51838637-51838659 TGCCCTCAGGCCAGCCTGTGAGG - Intergenic
1096805612 12:54139324-54139346 TTCCTTCATGCTAGGCACTGTGG + Intergenic
1097288640 12:57896422-57896444 TACCCTCAGGCCAGGGTGTGCGG - Intergenic
1100728279 12:97434103-97434125 TTCCCTCAGTGGAGTCTCCGTGG + Intergenic
1102432046 12:112891208-112891230 TGCCCACAGGCAAAGCTCTGTGG + Intronic
1103302425 12:119938185-119938207 TTCCCTCTGGTTAGGCTATGGGG - Intergenic
1103454476 12:121054029-121054051 TTCCCTGTGGAGACGCTCTGTGG + Intergenic
1105407805 13:20145977-20145999 TTCCCCTAGGCCTGGCTCTGAGG + Intronic
1107966787 13:45604417-45604439 ATCCGTCAGGGGAGGCTGTGGGG + Intronic
1108227565 13:48304313-48304335 TTCCCTCTTGTGAGGCTCGGAGG + Intronic
1112342829 13:98566539-98566561 TTCCCTCAGCAGAGACCCTGAGG + Intronic
1113455175 13:110443685-110443707 TTCCCTAAGGGTGGGCTCTGTGG + Intronic
1113904762 13:113814067-113814089 TTACCTCAGGGAAGGCTCTATGG + Exonic
1116853341 14:49930155-49930177 TTACCTCAGGCCAGGCTCAGTGG - Intergenic
1118602519 14:67480684-67480706 TTCCCTCAGCCCGGGCCCTGGGG - Intronic
1118862282 14:69673745-69673767 TTTCCTCAGTCTGGGCTCTGTGG + Intronic
1119679159 14:76578889-76578911 TTTCTTCATGCCAGGCTCTGGGG + Intergenic
1122072101 14:99211448-99211470 TACCCTGAGACCAGGCTCTGTGG - Intronic
1122132082 14:99610137-99610159 TTCCATCAGGCGATGGTGTGAGG - Intergenic
1122204410 14:100141468-100141490 CTCCCTCAGGCCTGCCTCTGGGG + Intronic
1124594533 15:31081979-31082001 TCCCCTCCTGCCAGGCTCTGGGG + Intronic
1127451144 15:59117754-59117776 TTGCTTCAGGCCAGGCACTGTGG - Intronic
1129103914 15:73292066-73292088 TTCCCTCAGGTGCTGCTCTTGGG - Intronic
1129599758 15:76991903-76991925 GTGCCTCAGGCCAGGCTGTGGGG - Intergenic
1134074667 16:11282253-11282275 TGACCTCAGGTGAGGCTCTAGGG + Intronic
1141565524 16:84899175-84899197 ATCCCTCAGGCGGGGCACAGTGG - Intronic
1142864980 17:2785230-2785252 TTCCTTCAGGGAAGGCTCAGAGG - Intronic
1143031944 17:3972873-3972895 TTCCCTCAGGGGAGGGGCAGGGG + Intergenic
1143953108 17:10648960-10648982 TTTCCTCAGGCTGGGCTCGGTGG - Intronic
1145375520 17:22344041-22344063 TTCACTCAGGAGAGTATCTGAGG + Intergenic
1145415528 17:22710989-22711011 TTTCCACAGGCCAGGCACTGAGG - Intergenic
1149771077 17:59321469-59321491 TTCCTTTAGGCCAGGCTCAGTGG - Intergenic
1150465930 17:65392603-65392625 ATCCATTAGGCCAGGCTCTGTGG + Intergenic
1151361937 17:73594154-73594176 TTCACTCTGGCCAGCCTCTGAGG + Intronic
1151453939 17:74215047-74215069 CTCCCACAGGCTGGGCTCTGGGG - Intronic
1151850972 17:76689378-76689400 GTCCCTCAGGCCAGGCACAGTGG - Intronic
1152091859 17:78251661-78251683 CTCCAGCAGGCGATGCTCTGTGG - Intergenic
1152109077 17:78347471-78347493 GACCATCAGGCCAGGCTCTGTGG - Intergenic
1155416477 18:25604981-25605003 TCCCTGCAGGTGAGGCTCTGTGG - Intergenic
1155906527 18:31458740-31458762 TTCCCTCAGGCGAGGCTCTGTGG - Intronic
1157434330 18:47655479-47655501 CTCCCTAGGGAGAGGCTCTGTGG - Intergenic
1158717664 18:59894894-59894916 TTCTCTCAGGCCAGGCACGGTGG - Intergenic
1159897491 18:74011315-74011337 TTCCCCCAGGGGAGGTTCTGTGG + Intergenic
1160003648 18:75052010-75052032 CGCACTCAGGAGAGGCTCTGGGG + Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1161577278 19:5061258-5061280 TTCCCTGAGCCGAGGCTCCCAGG + Intronic
1161591485 19:5131178-5131200 TCCCCTCAGAGGAGGCGCTGTGG + Exonic
1162733481 19:12732875-12732897 TCCCAGCAGGCCAGGCTCTGTGG - Intronic
1167245857 19:48372925-48372947 TTCCCTCTGGGGTGGTTCTGAGG - Intronic
1167580504 19:50338572-50338594 TTTCCTCAGGCCAGGCACGGTGG - Intronic
1168239818 19:55083454-55083476 TCCTCCCAGGCGCGGCTCTGCGG - Exonic
1168444650 19:56401491-56401513 TTCTCTCAGGTGAGCCTCAGAGG - Intronic
1168511832 19:56979710-56979732 CACCCTCAGGGGAGGTTCTGTGG + Intergenic
1168511869 19:56979826-56979848 CACCCTCAGGGGAGGTTCTGTGG + Intergenic
1168511909 19:56979942-56979964 CACCCTCAGGGGAGGTTCTGTGG + Intergenic
1168711214 19:58500912-58500934 GTCCCCCAGGCAAAGCTCTGAGG - Intronic
925744310 2:7031607-7031629 CTCCTTCAGGAGAGCCTCTGAGG + Intronic
927219602 2:20694949-20694971 TTTCCTCTGGCGAGGCCCTCTGG + Intronic
927719403 2:25373181-25373203 TTCCTTCAGACGAGGCCCCGTGG - Intergenic
927844685 2:26465291-26465313 TTTCCTCATGGGAGTCTCTGAGG - Intronic
933992838 2:87646011-87646033 CTCCCTCAAGAGGGGCTCTGTGG + Intergenic
936080656 2:109430416-109430438 TTGCCTCAGCCCAGGCTGTGTGG + Intronic
936264952 2:110996959-110996981 TTCCCCCAGGCGTAGATCTGAGG + Intronic
936301018 2:111304868-111304890 CTCCCTCAAGAGGGGCTCTGTGG - Intergenic
937131642 2:119518407-119518429 TTCCCTCACCTGAGGCTCTTAGG - Intronic
946655094 2:221937755-221937777 TTCTCTAAGGCGAGGCACAGTGG - Intergenic
947498168 2:230653986-230654008 TTGCCTTTGGGGAGGCTCTGGGG - Intergenic
948938002 2:241180909-241180931 GTCCCTCAGGCCAGGCGCAGTGG + Intronic
949017357 2:241720877-241720899 CTCCCTCAGGCGAGACTGAGAGG + Intronic
1173300022 20:41794238-41794260 TTCCCTCAGGCCAGGCGCGGTGG - Intergenic
1174170735 20:48616686-48616708 TTCCCTCATGCCAGGCTCCCCGG - Intergenic
1175286920 20:57843096-57843118 TTCCCCCTGGAGAGGTTCTGAGG + Intergenic
1176197702 20:63844943-63844965 CTCCCCCAGCCGAGGCTCAGAGG + Intergenic
1176896442 21:14383716-14383738 TTCCCTCAGGCCCCGCACTGCGG - Intergenic
1179574762 21:42301165-42301187 CTCCCTCAACCGGGGCTCTGGGG + Intergenic
1180968723 22:19803815-19803837 TCCCCTCAGGCAGCGCTCTGTGG + Intronic
1183479742 22:38057054-38057076 TTACCTCCGGCGAGGCTCAGTGG - Intronic
950017951 3:9767557-9767579 TTCCCACAGCCCAGGCCCTGTGG - Intronic
953458347 3:43061747-43061769 TTGCCTCAGCAGAGCCTCTGAGG - Intergenic
953605495 3:44410723-44410745 TTCCCTCAGGCCAGGTGCAGTGG + Intergenic
953785422 3:45907389-45907411 CTCGCTCAGGCCAGGCTCTGTGG + Intronic
954125149 3:48523853-48523875 GTCCCTCAGGCCTGGCTCCGGGG + Intronic
954711516 3:52507330-52507352 TTATCTCAGGCCAGGCTCAGTGG - Intronic
959387860 3:105734630-105734652 TTCCCGCATGCCAGGCACTGTGG + Intronic
959505541 3:107152592-107152614 TTCCCTCAGCCAGGGCTGTGGGG - Intergenic
960161232 3:114352128-114352150 CTACCTCAGCCGAAGCTCTGGGG - Intronic
960497416 3:118391786-118391808 TTCCTTCAGGCCAGGCGCGGTGG - Intergenic
961000637 3:123371835-123371857 ATCCCTGAGGGGAGGCCCTGGGG - Intronic
961524275 3:127486656-127486678 GTGCCTCAGTGGAGGCTCTGAGG - Intergenic
963299772 3:143585273-143585295 TTGTCTCAGGTGAGGCTCAGAGG - Intronic
967266439 3:187696225-187696247 TTCCCTCAGGCATAGCTGTGAGG - Intergenic
968978064 4:3832060-3832082 ATGCCTCACACGAGGCTCTGTGG - Intergenic
973760010 4:54107041-54107063 TTCACTCAGGGGAGCCCCTGGGG - Intronic
974346438 4:60688136-60688158 TTACCTCAGGCCAGGCTGTCTGG + Intergenic
979990234 4:127366743-127366765 TTTCCTCAGGCCTGGCCCTGAGG + Intergenic
980615126 4:135210359-135210381 ATCTCTCAGGAAAGGCTCTGCGG - Intergenic
982173076 4:152680296-152680318 ATCCCCCAGGTGAGGCTCCGGGG + Intergenic
983657843 4:170100978-170101000 TTCCCTCAGCAGTGGCTGTGTGG + Intergenic
983982646 4:174017694-174017716 TTTCTTCAGGCTAGGCTCTAGGG + Intergenic
985801094 5:2005683-2005705 TTCCTTGAGGTGAGGCTCAGAGG + Intergenic
986106057 5:4660758-4660780 TTCCCTCAGGGGAGTTTCTTAGG - Intergenic
991066820 5:62432676-62432698 ATCCCTGAGGAGAGGGTCTGTGG + Intronic
991777352 5:70098059-70098081 GTTCCTCAGGCCAGGCACTGTGG + Intergenic
991856640 5:70973503-70973525 GTTCCTCAGGCCAGGCACTGTGG + Intronic
995740459 5:115350482-115350504 TTCCCTGAGGAGAGCATCTGTGG - Intergenic
997283240 5:132661562-132661584 TTACCTCAGATGAGGCTCTGAGG - Intergenic
997457158 5:134025985-134026007 CTCCCCCAGGCCAGGCTCGGTGG - Intergenic
998862042 5:146453908-146453930 TTCCTTCCGGCCAGGCGCTGTGG + Intronic
1000380067 5:160620918-160620940 AACCCTCAAGCAAGGCTCTGGGG - Exonic
1002318105 5:178357388-178357410 TTCTCTGAGTCGAGGCTGTGCGG - Intronic
1002779011 6:352425-352447 TTCACTCATTCGAGGCTCAGAGG + Intergenic
1003592471 6:7447487-7447509 TACACTCAGGCCAGGCGCTGTGG + Intergenic
1004645413 6:17555479-17555501 TTCTCTCTGGCTGGGCTCTGTGG - Intronic
1005805271 6:29468518-29468540 CACCCTCAGGCCAGGCCCTGGGG - Intergenic
1008282263 6:49610881-49610903 TTCTCTCAGGCGCGTCTCTTTGG + Intronic
1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG + Exonic
1016958325 6:149648439-149648461 TTCACTCTGGCGGTGCTCTGGGG - Intronic
1019595451 7:1856375-1856397 TCCCCACAGGCCAGCCTCTGTGG + Intronic
1019705905 7:2497306-2497328 CTCCTCCAGGAGAGGCTCTGAGG + Intergenic
1021615573 7:22499929-22499951 TTCGCTTATGCGCGGCTCTGGGG - Intronic
1022248507 7:28584215-28584237 ATCTCCCAGGCGAGGCCCTGTGG + Intronic
1022681200 7:32547917-32547939 TAACCTCAGGCAAGGCTGTGAGG - Intronic
1024019157 7:45349342-45349364 TGAGCTCAGGAGAGGCTCTGAGG + Intergenic
1024261616 7:47577860-47577882 TCCCCTGAGGGGTGGCTCTGAGG + Intronic
1024952058 7:54873893-54873915 ATCCATCAGGCCAGGCTCAGTGG + Intergenic
1032784403 7:135188886-135188908 TTGCCCCAGCCCAGGCTCTGGGG + Intronic
1032836655 7:135681440-135681462 TGCCCTCCGGCGTGGGTCTGGGG + Exonic
1033245186 7:139711978-139712000 TTCTCTGAGGCAAGTCTCTGTGG + Intronic
1038547307 8:28435459-28435481 TGCCCTCAGGCCAGGCACGGTGG - Intronic
1041573135 8:59360186-59360208 ATCCCTCAGGCCAGGCACAGTGG - Intergenic
1041869273 8:62615129-62615151 GTGCCTCAGGTGAGCCTCTGAGG - Intronic
1042242424 8:66677768-66677790 TTCCCTCATGGGAGGCTGTCGGG + Exonic
1044645670 8:94440820-94440842 TTCCCTCAGGTGGGGCCATGGGG - Intronic
1045628520 8:104086520-104086542 TTCCCTAAGGCTTGGCTTTGTGG - Intronic
1046423412 8:114013848-114013870 TTACATCAGGCCAGGCGCTGTGG - Intergenic
1046666431 8:117008781-117008803 TATCATCAGGCTAGGCTCTGGGG - Intronic
1047834874 8:128678244-128678266 TGCCCTGAGGAGAGGCTATGAGG + Intergenic
1048446241 8:134495492-134495514 TTCCCTTAGAGGAGGCCCTGGGG - Intronic
1049843940 8:144790825-144790847 CTCGCACAGGGGAGGCTCTGAGG - Intronic
1050224625 9:3438121-3438143 TTCCCTGATGCAAGACTCTGAGG - Intronic
1056682535 9:88731719-88731741 TTCCTTCAGGCTGGGCTCAGTGG - Intergenic
1057240006 9:93399839-93399861 TTCCCCCAGGGAAGTCTCTGTGG - Intergenic
1060504676 9:124188846-124188868 TTCCAGCAGACCAGGCTCTGGGG - Intergenic
1061920840 9:133781535-133781557 TTCCCACAGGAAAGGCTCTCAGG + Intronic
1187873828 X:23787079-23787101 TTCCGTCAGGCCAGGCGCAGTGG - Intergenic
1188905650 X:35788008-35788030 TTCTCTCAGGTGAGCCTCAGAGG - Intergenic
1189083377 X:37996612-37996634 TGCCCTCAGGCTTGACTCTGGGG - Intronic
1190325997 X:49207099-49207121 TTTCCCCAGGAGAGGCTCTGGGG - Exonic
1192244246 X:69359867-69359889 CTCGGTCAGGAGAGGCTCTGAGG - Intergenic
1192261576 X:69508823-69508845 TCCACTCAGGAGAAGCTCTGAGG - Intronic
1192884336 X:75320763-75320785 TTCCCTCAAGGGAAGCTGTGAGG - Intergenic
1195925968 X:110025076-110025098 TTGCATCAGGGAAGGCTCTGAGG + Intronic
1200838120 Y:7752795-7752817 TTTCCTCAGTTGAGCCTCTGAGG + Intergenic