ID: 1155908933

View in Genome Browser
Species Human (GRCh38)
Location 18:31486703-31486725
Sequence GCGGGCATTGCTAAGACTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155908933_1155908939 25 Left 1155908933 18:31486703-31486725 CCGGCAGTCTTAGCAATGCCCGC No data
Right 1155908939 18:31486751-31486773 AATTTTATCCACAGCGAGCCAGG No data
1155908933_1155908936 -4 Left 1155908933 18:31486703-31486725 CCGGCAGTCTTAGCAATGCCCGC No data
Right 1155908936 18:31486722-31486744 CCGCCCTTGACGAAATTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155908933 Original CRISPR GCGGGCATTGCTAAGACTGC CGG (reversed) Intergenic
No off target data available for this crispr