ID: 1155910349

View in Genome Browser
Species Human (GRCh38)
Location 18:31498188-31498210
Sequence TGCGCGCTCGGGGCAGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155910342_1155910349 -7 Left 1155910342 18:31498172-31498194 CCAGGGAGGAGCCGAGTGCGCGC 0: 1
1: 0
2: 2
3: 8
4: 180
Right 1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG 0: 1
1: 1
2: 2
3: 12
4: 242
1155910336_1155910349 15 Left 1155910336 18:31498150-31498172 CCGGGCCGGGGGGAGGCCGGGGC 0: 1
1: 2
2: 4
3: 96
4: 911
Right 1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG 0: 1
1: 1
2: 2
3: 12
4: 242
1155910341_1155910349 -1 Left 1155910341 18:31498166-31498188 CCGGGGCCAGGGAGGAGCCGAGT 0: 1
1: 0
2: 5
3: 74
4: 601
Right 1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG 0: 1
1: 1
2: 2
3: 12
4: 242
1155910338_1155910349 10 Left 1155910338 18:31498155-31498177 CCGGGGGGAGGCCGGGGCCAGGG 0: 1
1: 0
2: 8
3: 151
4: 1086
Right 1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG 0: 1
1: 1
2: 2
3: 12
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155910349 Original CRISPR TGCGCGCTCGGGGCAGGCGG CGG Exonic
900121422 1:1050049-1050071 GGGGCTCTCGGGGCAGGGGGGGG + Intronic
900190114 1:1349607-1349629 GGGGCGCTCGGGTCGGGCGGAGG + Intergenic
900782292 1:4626088-4626110 TGGGAGCTGGGGCCAGGCGGAGG + Intergenic
900916572 1:5643820-5643842 TGAGCTCGCGGGGCAGGCTGGGG - Intergenic
902940984 1:19799973-19799995 GGCGCGCTCGGGGCAGGCGGCGG - Intergenic
903750248 1:25616943-25616965 TGCGCGCTCCGCGGAGCCGGCGG + Intergenic
904003076 1:27349592-27349614 AGGGCGCTCGGGGCAGGGGTGGG + Intronic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
906615837 1:47232253-47232275 GGCGGGCGCGGGGCGGGCGGGGG - Intergenic
910892192 1:92029903-92029925 TGCGCGCTCCGGGCTGGGCGCGG + Intergenic
915818567 1:158996469-158996491 TGTGCCCTCAGGGCAGGCTGGGG - Intergenic
916068232 1:161153486-161153508 TGGGGGCTCGGGGCTGGGGGAGG + Intronic
917433920 1:174999956-174999978 TGCGTGCTCGCGGTGGGCGGTGG + Exonic
920805695 1:209231775-209231797 CGCGCGCTCGGCGCCGGTGGGGG + Intergenic
922717012 1:227883098-227883120 TGCATGCTGGGGGCAGGAGGAGG - Intergenic
1062843814 10:689789-689811 AGCGCGCGCGGGGCGGGCCGGGG - Intergenic
1063115538 10:3068977-3068999 TGAGCGCGCGGGGCGGGCGCGGG + Intronic
1070939034 10:80326945-80326967 TGAGCGCTCAGGTCAGGCAGAGG - Intergenic
1072189077 10:93066103-93066125 TGCGCGCCCGGGGCCGCTGGGGG + Exonic
1075847930 10:125561563-125561585 TGTTTGCTAGGGGCAGGCGGGGG - Intergenic
1076710716 10:132332286-132332308 TGAGCCCTCGAGGCGGGCGGCGG + Intronic
1076737593 10:132465717-132465739 TGCGTGCTCAGAGCAGGAGGAGG + Intergenic
1077464887 11:2729071-2729093 TGCCCGCCTGGGGCAGGCGGGGG - Intronic
1077502642 11:2916320-2916342 TGAGCGCCTGGGGCAGGTGGCGG - Intronic
1077616098 11:3675242-3675264 TGGGCGTTAGGGGCAGGCAGAGG - Exonic
1077637834 11:3855620-3855642 GGCGGGCCCGGGGCGGGCGGGGG - Intronic
1078594427 11:12674501-12674523 TGGGCGCCCGCGGCGGGCGGCGG - Intergenic
1079128542 11:17734978-17735000 TCCTCGCTTCGGGCAGGCGGTGG - Exonic
1082789240 11:57335773-57335795 GGCGCGCTGGGGGGACGCGGGGG + Exonic
1083300809 11:61738833-61738855 GGCTCGCCCGGGGCAGGGGGCGG - Intronic
1083560811 11:63671595-63671617 CGCGCACACGCGGCAGGCGGTGG - Exonic
1083669452 11:64291944-64291966 TGCGGACGCGGGGGAGGCGGTGG + Intronic
1083890295 11:65592507-65592529 TGCGCGCTCGCGGCGGGTGCGGG + Exonic
1084070122 11:66728320-66728342 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1094041185 12:26122894-26122916 CGCGCGCTCCAGGCAGGGGGCGG + Exonic
1094565030 12:31591172-31591194 TGGGAGCGCGGGGCGGGCGGGGG + Intergenic
1096127672 12:49131477-49131499 TGGGCGCGCGGGGCCGGAGGAGG - Intergenic
1096155123 12:49337260-49337282 TGCGGGGGCGGGGCAGGCAGCGG + Intergenic
1096503576 12:52079872-52079894 GCCGCGCGCGGTGCAGGCGGTGG + Intergenic
1096783965 12:54006666-54006688 TGGGCTCTCCGGGCAGGCGGCGG + Intronic
1097270758 12:57772522-57772544 TGTGCGCTCGGGGCCGGGGCGGG + Exonic
1100679850 12:96907332-96907354 TGCGCGGACGCGGCGGGCGGGGG - Intronic
1106087694 13:26557941-26557963 CGCGCGCTCCGGCCGGGCGGCGG + Intronic
1109149263 13:58823893-58823915 GGCGCTCGCGGGGCAGGCGCGGG - Intergenic
1110119373 13:71864818-71864840 CGCGCGCACGGAGGAGGCGGCGG - Intronic
1112957062 13:105073235-105073257 TGCGCGCTAGGAGCATGGGGTGG - Intergenic
1113737649 13:112689930-112689952 TGTGGGCGCGGGGCCGGCGGGGG + Intergenic
1113737662 13:112689992-112690014 TGCGCGCCCGGAGCAGGGGCAGG + Intergenic
1117014878 14:51508145-51508167 TGCGAGCACGGGACAGGCTGGGG - Intronic
1118514316 14:66508894-66508916 CGCGCTGTCGGTGCAGGCGGCGG + Intronic
1118725907 14:68628836-68628858 TGTGCGGTCGGGGGAGGCTGGGG - Intronic
1118836822 14:69484086-69484108 TGCGCGCTAGGCGGCGGCGGCGG + Intergenic
1119731932 14:76956627-76956649 TGCCCGCTCGGGGGAGGCCTGGG - Intergenic
1121218525 14:92267090-92267112 TGGGAGGTCGAGGCAGGCGGGGG - Intergenic
1122707190 14:103628937-103628959 GGGGCGCTCGGGGCAGGGCGCGG - Intronic
1122819498 14:104334319-104334341 TGCCCTCTCGGGCCAGCCGGCGG + Intergenic
1122997498 14:105273294-105273316 TGTGCGGTTGGGGAAGGCGGTGG - Intronic
1123004452 14:105314678-105314700 GGCGCGCGCGGGGCGGCCGGGGG + Exonic
1124427056 15:29570980-29571002 GGAGCGCGCGGGGCGGGCGGGGG - Intergenic
1125462667 15:39920932-39920954 TGCGCGCCTGGGGCAGCCGGGGG + Intergenic
1125626897 15:41116181-41116203 TGCGGGCGCTGGGCCGGCGGCGG + Exonic
1126766910 15:52019074-52019096 TGCGCGCGCCGCGGAGGCGGTGG - Intronic
1127997690 15:64163097-64163119 CGCGGGCTCCGGGCGGGCGGCGG + Exonic
1129933649 15:79432018-79432040 TGAGCGCCCCGGGCGGGCGGCGG + Intergenic
1131827201 15:96331267-96331289 CGGACGCCCGGGGCAGGCGGCGG + Exonic
1132552773 16:560241-560263 TGCGCGCCAGGGGGCGGCGGGGG + Intergenic
1132585956 16:705833-705855 GGCGCGCGCGGCGCCGGCGGCGG - Intronic
1132793556 16:1706882-1706904 TGGGGTCCCGGGGCAGGCGGGGG - Intronic
1132824516 16:1896822-1896844 TGCACGCTCGGGAAAGGCGCAGG + Intergenic
1132854310 16:2038038-2038060 GGGGAGCTCGGGGCAGGCTGAGG - Exonic
1132932959 16:2468101-2468123 GGCGCGCTCGGCGGAGGCGAAGG + Intergenic
1132934878 16:2475174-2475196 GGTGCGCTCGGGGCGTGCGGGGG + Intronic
1133009653 16:2904196-2904218 TGCACGCTAGGGCCAAGCGGAGG - Intergenic
1133743999 16:8674062-8674084 GGAGCGCTGGGGCCAGGCGGAGG + Intergenic
1133788227 16:8989374-8989396 TGGGGGCTGGGGGCAGGGGGTGG + Intergenic
1134134139 16:11668561-11668583 CGCGCGCTCGGGCCGGGCGGGGG + Intronic
1134149830 16:11797051-11797073 GGCGCGCGCGGGGGGGGCGGGGG + Intronic
1136546521 16:30957982-30958004 TGCGCGCGCCGGGGAGGTGGTGG + Intronic
1138591363 16:58001085-58001107 GCCGGGCTCGGGGCAGGCAGGGG + Intronic
1139602292 16:67993935-67993957 TGTGCGGTCGGGGCGGGGGGCGG - Intronic
1139676949 16:68530293-68530315 TCCGCGCTCGGGGCTGGCGGCGG - Intronic
1141443363 16:84043188-84043210 TGAACGCTTGGGGGAGGCGGCGG + Intergenic
1141464171 16:84195704-84195726 AGGGCCCCCGGGGCAGGCGGGGG + Intronic
1141617829 16:85220268-85220290 TAGGAGCTGGGGGCAGGCGGGGG + Intergenic
1141686805 16:85574882-85574904 TCTGCGCTCCAGGCAGGCGGGGG + Intergenic
1141714767 16:85720414-85720436 TGGGCGCTCTGGGAAGGCTGTGG + Intronic
1142240374 16:88941917-88941939 GGCGAGCGCGGGGCAGGGGGCGG - Intronic
1142335976 16:89490014-89490036 TCCGGGTTCGGGGCAGCCGGGGG - Intronic
1142697721 17:1643161-1643183 TGAGCGGTCGGGGGAGGGGGCGG - Intronic
1147954301 17:44123714-44123736 TGCGGGCAAGGGGAAGGCGGGGG - Intergenic
1148158987 17:45439404-45439426 TGCGTGCTTGGGCCAGGCTGTGG + Intronic
1150390343 17:64786494-64786516 TGCGTGCTTGGGCCAGGCTGTGG + Intergenic
1151985630 17:77541489-77541511 GGCTCACTCGGGGCAGCCGGGGG - Intergenic
1152448780 17:80363325-80363347 GGCTTGCTCAGGGCAGGCGGAGG - Intronic
1152697447 17:81804181-81804203 GGCGCGCTCGGGTCGGGCGCCGG - Exonic
1152723287 17:81933222-81933244 TGCCCGCTGGGGCCAGGCTGCGG + Exonic
1153051987 18:908416-908438 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1153559862 18:6361368-6361390 TGCACGGTTGGGGCAGACGGCGG - Intronic
1153900656 18:9614611-9614633 CGCGCGCGCGGGGCGGGCCGAGG + Intronic
1153935023 18:9913882-9913904 TGCGCGCTCGCGGCTTGCCGCGG - Intergenic
1154097554 18:11432315-11432337 GGCGCCCTCGGAGCAGGGGGCGG + Intergenic
1155146958 18:23092292-23092314 TGCGAACTCGGGGCTGGTGGAGG + Intergenic
1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG + Exonic
1158775544 18:60574123-60574145 TGCGGGCATGGGGCAGGAGGTGG + Intergenic
1158930906 18:62324920-62324942 TGGGCGCGCGGGGCAGGAGCAGG + Intergenic
1160509318 18:79444469-79444491 CGAGGGCTCGGGGTAGGCGGGGG - Intronic
1160909210 19:1467194-1467216 GCCGCGCTCGGGGCAGGCCGAGG - Exonic
1160947954 19:1652218-1652240 AGCGCGCGCGGGGCGGGCCGGGG + Intronic
1160988634 19:1851723-1851745 TGCCCGCCCGGGGAAGGGGGTGG - Intergenic
1161015000 19:1979100-1979122 TGCGCGCGCGCGGCGGGGGGCGG + Intronic
1161396911 19:4049534-4049556 TGCCCTCTCGAGGCTGGCGGCGG + Intronic
1161752569 19:6109057-6109079 TGGGCGGTGGGGGCAGGGGGTGG + Intronic
1161779221 19:6279954-6279976 TGCGCGACCCGGGCTGGCGGTGG - Intergenic
1161808942 19:6460420-6460442 TGCGGGCTGGAGGCAGTCGGGGG - Intronic
1161852774 19:6746202-6746224 TGAGGCCTCGGGGCAGGAGGAGG + Intronic
1163509490 19:17726586-17726608 CGTGCGCTCGGCGCCGGCGGAGG - Exonic
1164605669 19:29596190-29596212 GTCGCGCTGGGGGCAGGGGGTGG - Intergenic
1165243104 19:34482459-34482481 AGCGGGCGCGGGGCAGGCGCCGG - Exonic
1165353668 19:35291117-35291139 TGGGGGCTCGGGGCAGCTGGAGG - Intergenic
1165718613 19:38063264-38063286 TGGGAGCTGGGGGCCGGCGGGGG - Intronic
1165838013 19:38771082-38771104 CGCGCGCCAGCGGCAGGCGGTGG + Exonic
1165841552 19:38791615-38791637 CGCGCGCCAGCGGCAGGCGGTGG - Exonic
1166700597 19:44879459-44879481 TGAGGGCATGGGGCAGGCGGGGG + Intronic
1167075194 19:47244222-47244244 TTATCGCTCGGGCCAGGCGGAGG + Intergenic
1167494515 19:49809666-49809688 CGCGAGCTCGGGGCTGGCTGTGG - Intronic
1168722578 19:58562300-58562322 GCCGCACTCGGGGCAGGCGAAGG + Exonic
926927485 2:18002093-18002115 TGCGCCCTGGGGGGAGGGGGTGG + Intronic
929983139 2:46699313-46699335 TGCGCTCGCTGGGCAGTCGGAGG + Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
934636175 2:95991944-95991966 CGCGCGCCCAGTGCAGGCGGCGG + Intergenic
934797474 2:97113482-97113504 CGCGCGCCCAGTGCAGGCGGCGG - Exonic
934835937 2:97589957-97589979 CGCGCGCCCGGTGCAGGCGGCGG + Exonic
935083594 2:99823260-99823282 TGCATGCTTGGGGCGGGCGGGGG - Intronic
935775268 2:106466899-106466921 GGCGCGCTCTGTGGAGGCGGCGG - Intronic
935775549 2:106468078-106468100 GGCGCGCTCTGTGGAGGCGGCGG - Intronic
937273682 2:120671019-120671041 TGCTCTCTGGGGGCAGGGGGAGG + Intergenic
942034726 2:171999832-171999854 TGCGCGCGCGGGGCTGACTGCGG - Exonic
943669848 2:190649022-190649044 AGCGCGCGCGGGGAAGGCAGGGG + Intronic
946219961 2:218217550-218217572 CGCGCGCCCGGGGCCGGGGGTGG + Intronic
946354762 2:219177915-219177937 TGCTCGCTCGGGAAGGGCGGTGG - Exonic
947623442 2:231604959-231604981 TCCTGGCCCGGGGCAGGCGGGGG + Intergenic
947741754 2:232487907-232487929 GGGGCGCGCGGGGCGGGCGGAGG - Intergenic
948805926 2:240453438-240453460 TGCGGGAGCGGGGCGGGCGGAGG - Intronic
1170262258 20:14423374-14423396 TGGGGGATGGGGGCAGGCGGTGG + Intronic
1171346429 20:24469544-24469566 CCGGCGCTCGGGGCAGCCGGGGG + Exonic
1171499795 20:25585053-25585075 GGCCCGCGCTGGGCAGGCGGCGG + Intronic
1172793579 20:37522564-37522586 TGGGCGGGCGGGGCAGGGGGTGG + Intronic
1172841034 20:37903009-37903031 CTCCCGCTCGGAGCAGGCGGCGG - Intergenic
1175429599 20:58891941-58891963 CGCGCGCCCGGGGCGGGGGGCGG - Intronic
1176380783 21:6111287-6111309 GGCGGGCTCCGGGCGGGCGGAGG + Intronic
1178488463 21:33033241-33033263 TGGGCGCGCGGCGCGGGCGGAGG + Intergenic
1179742689 21:43426953-43426975 GGCGGGCTCCGGGCGGGCGGAGG - Intronic
1180187428 21:46146417-46146439 TGTGTGCTCGGGGCAGGGGGCGG - Intronic
1180748856 22:18110895-18110917 TGCGGGCGCGCGGCAGGCGTAGG + Intronic
1180831093 22:18906486-18906508 TACGCGGGCGGGGCGGGCGGCGG + Intronic
1180908368 22:19431583-19431605 TGAGGGCGCGGGGCGGGCGGCGG - Exonic
1182149513 22:28018298-28018320 TGCGCGCGCGGGGGGGGGGGCGG + Intronic
1183649445 22:39145655-39145677 TGCGTGCGCGCGGCCGGCGGGGG - Intronic
1184023076 22:41833674-41833696 TGGGCGCGCGAGGGAGGCGGCGG - Intronic
1184100342 22:42338619-42338641 TGCCTGCTCGGGAAAGGCGGAGG + Intronic
1184551945 22:45209286-45209308 TGAGCGCTCGGTGGAGGTGGGGG - Intronic
1184729549 22:46365167-46365189 AGCGGGCTCGGGGCAGGCCTTGG - Intronic
1184790674 22:46697962-46697984 TGGGGCCTCGGGCCAGGCGGCGG - Intronic
1185274866 22:49946143-49946165 TCTGCGCTGGGGCCAGGCGGCGG + Intergenic
1185313626 22:50169875-50169897 GGCGCGGCCGGGGCAGGTGGGGG + Intergenic
1203281180 22_KI270734v1_random:131757-131779 TACGCGGGCGGGGCGGGCGGCGG + Intergenic
953641317 3:44711013-44711035 TGCGCTCGCTGGGCAGTCGGAGG - Intergenic
953705285 3:45226045-45226067 TACGCGCGCGAGGCCGGCGGCGG + Exonic
961450305 3:126999573-126999595 TCCGGGCTGAGGGCAGGCGGGGG - Intronic
962804202 3:138915569-138915591 GGCGCGCTCGGGGCCGCCAGGGG - Intergenic
966886560 3:184380472-184380494 TGGGCGCCCGGGGGAGGCGCGGG + Intronic
967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG + Intergenic
974385955 4:61201957-61201979 TGGGCGCTCGGGTCTGGCGCGGG + Intronic
977607221 4:98995548-98995570 TGCGCGCGCGGGGCGGGGGCGGG + Intergenic
980013552 4:127623131-127623153 TGGGAGCTCGGGGCAGGTGGGGG - Intergenic
980354318 4:131723954-131723976 TGCGCGCTCGGTCCAGGAAGAGG + Intergenic
980354855 4:131726460-131726482 TGCGCGCTCGGTCCAGGAAGAGG + Intergenic
980355394 4:131728937-131728959 TGCGCGCTCGGTCCAGGAAGAGG + Intergenic
980355941 4:131731438-131731460 TGCGCGCTCGGTCCAGGAAGAGG + Intergenic
980357013 4:131736414-131736436 TGCGCGCTCGGTCCAGGAAGAGG + Intergenic
980357555 4:131738909-131738931 TGCGCGCTCGGTCCAGGAAGAGG + Intergenic
980358625 4:131743889-131743911 TGCGCGCTCGGTCCAGGAAGAGG + Intergenic
980359167 4:131746362-131746384 TGCGCGCTCGGTCCAGGAAGAGG + Intergenic
980360246 4:131751325-131751347 TGCGCGCTCGGTCCAGGAAGAGG + Intergenic
980361332 4:131756280-131756302 TGCGCGCTCGGTCCAGGAAGAGG + Intergenic
980362415 4:131761235-131761257 TGCGCGCTCGGTCCAGGAAGAGG + Intergenic
980362955 4:131763718-131763740 TGCGCGCTCGGTCCAGGAAGAGG + Intergenic
981331385 4:143513952-143513974 GGCGCGCTCTCGGGAGGCGGGGG - Exonic
983649753 4:170026387-170026409 TCCGCGCTCCCGGCAGCCGGCGG - Exonic
984952691 4:185018895-185018917 CGCGCCCTCGGGAGAGGCGGTGG - Intronic
985666614 5:1184447-1184469 TGCGGGGTCGGGTCAGGCTGTGG + Intergenic
986136311 5:4982358-4982380 TGTGTGCAGGGGGCAGGCGGGGG + Intergenic
986766014 5:10927267-10927289 TGTGGGTTGGGGGCAGGCGGAGG + Intergenic
988780945 5:34521478-34521500 TGGGCTCTCGGGGCGGGAGGGGG - Intergenic
992828085 5:80569515-80569537 TGGGCGCTGGGGGCGGGCTGGGG - Intronic
992962691 5:81971949-81971971 CGCGCGCTCTGGGCAGGGCGGGG - Intergenic
995224783 5:109690090-109690112 AGGGCGCGCGGGGCAGGCGGAGG - Exonic
999270050 5:150291604-150291626 TGCTCGCTGGGGGCAGGTGCTGG - Intergenic
999399363 5:151252834-151252856 TGCGCGCGCGGGAGGGGCGGGGG - Intronic
1001396004 5:171419964-171419986 TGCGCCCTCCGGGCTGGCGCAGG - Exonic
1001556599 5:172641357-172641379 GGCGCGCTCTGGGCGCGCGGAGG - Exonic
1001958970 5:175868448-175868470 TGAGCCCTGGGGGCAGGAGGAGG - Intronic
1002140482 5:177134362-177134384 AGCGCGGCCCGGGCAGGCGGCGG + Intronic
1004561804 6:16759968-16759990 TGCGCGCGCGCGCCGGGCGGGGG - Intronic
1006396229 6:33789131-33789153 TGCGCGCCAGGGGCGGGCGGGGG - Exonic
1007736401 6:43984924-43984946 TGAGCCCTGTGGGCAGGCGGGGG - Intergenic
1011075170 6:83430997-83431019 CGCACGCGCGGTGCAGGCGGCGG + Exonic
1012245790 6:96924500-96924522 AGCGCGCTGGCGGCGGGCGGTGG + Intergenic
1012929567 6:105302841-105302863 TTAGCCCTCGGAGCAGGCGGCGG - Intronic
1014632531 6:123803908-123803930 GGCGCGCTCGGGGCCCGCAGGGG - Intergenic
1014797880 6:125747737-125747759 AGGGCGCTCGGGGCGGGAGGTGG + Intronic
1015625751 6:135180457-135180479 TGCGCGCTCTGTGCAGGGAGGGG + Intergenic
1017880657 6:158560378-158560400 TTCGCGGGCGGGTCAGGCGGAGG + Intronic
1018865876 6:167746704-167746726 CGCCCGCTCGGGGCGGGGGGAGG - Intergenic
1019343584 7:519517-519539 GGCGAGCGCGGGGCCGGCGGTGG - Intronic
1019431000 7:999713-999735 TGCGCGCTGGGGGCAGGGGGCGG - Intronic
1019558771 7:1645573-1645595 GGAGCACTCGGGGCAGGCAGGGG + Intergenic
1019676241 7:2314283-2314305 CGCGCGCCCTGGGCAGGTGGGGG + Intronic
1019770774 7:2882616-2882638 TGCGGGCTCTGGGCAGGGTGCGG + Intergenic
1019989588 7:4682400-4682422 TGCGGCCGCGGGGAAGGCGGCGG - Exonic
1023177441 7:37448126-37448148 AGCGCGCTCGTGGGAGGGGGCGG - Intronic
1023937259 7:44748849-44748871 TGTGCCCTCGGAGCGGGCGGCGG + Intronic
1023965777 7:44962462-44962484 TGCGTGGACGGGGCAGGCTGGGG + Intergenic
1025069704 7:55887686-55887708 TGCGCGCCGGGAGGAGGCGGAGG + Intronic
1030983255 7:116210740-116210762 GGGGCGCTCGTGGCGGGCGGCGG + Intronic
1034434477 7:151056854-151056876 TGGCCGCTTGGGGGAGGCGGGGG - Intronic
1036767932 8:11560709-11560731 TGCCCCCACGGGGCAGGCGCTGG + Intronic
1037882366 8:22579394-22579416 TGCGGGCTGGGGGCTGGAGGAGG - Exonic
1037961840 8:23103392-23103414 CGCGGGCTCGGGGCAGCCAGGGG - Intronic
1039595453 8:38787130-38787152 CGCGCGCGCGGGGGCGGCGGCGG - Intronic
1041044854 8:53879950-53879972 CGAGCGCTGGGAGCAGGCGGAGG - Intronic
1041107998 8:54459651-54459673 GGCTCGCCCGGGGCGGGCGGCGG + Exonic
1045510025 8:102806736-102806758 TGGGCGCCCGCGGCAGGCGTAGG + Intergenic
1045510037 8:102806781-102806803 TGCGCGCTCGGCCTCGGCGGCGG + Intergenic
1047951472 8:129939394-129939416 TGAGCGCCGGGGGCAGGCCGGGG + Intronic
1048391715 8:133973175-133973197 TGTGTGCTGGGGGCAGGAGGGGG + Intergenic
1049673092 8:143878334-143878356 TGCGGGCTCGGGGCCGGGCGGGG - Intronic
1049798371 8:144506646-144506668 AGCGCGCTCAGGTCAGGCGGGGG + Exonic
1052509067 9:29390984-29391006 TGCGCACTGGGAGCAGGGGGTGG - Intergenic
1052807521 9:33025685-33025707 TGCTCGCTCGGGGTGGGGGGGGG + Intronic
1053312339 9:37027630-37027652 TGTGCGCGCCGAGCAGGCGGAGG - Intronic
1057222243 9:93263683-93263705 TGCGCGCTCCCGGCAGGAGAGGG + Exonic
1058058546 9:100473235-100473257 GGCGCGCGCGCGGCGGGCGGGGG - Exonic
1060106783 9:120877442-120877464 CGCGCCCGCGGGGCGGGCGGGGG - Intronic
1060389948 9:123268771-123268793 TGCGCACTTGGCGCAGGCGGCGG - Intergenic
1061975887 9:134067900-134067922 TGCGCGCGCGGGGCGGCGGGCGG - Intronic
1061976104 9:134068542-134068564 CGCGCGCGCGGGGCGGGGGGCGG + Intergenic
1062413953 9:136438821-136438843 TCCAGGCTCAGGGCAGGCGGTGG + Exonic
1062517698 9:136944477-136944499 GGCGGGCTCGGGGCGGACGGCGG + Intronic
1062542046 9:137045848-137045870 AGCGCGCTGGGCGCAGGCCGCGG - Intronic
1062600106 9:137315744-137315766 TGCCCGCCCAGGGCAGGCCGGGG - Intronic
1187419608 X:19122707-19122729 TGGGAGCTCGGGGCAGGGGCAGG + Intergenic
1187859315 X:23666432-23666454 TGCGCACTGGGGGCAGGCCCAGG - Intronic
1189002823 X:36963828-36963850 CGCGCGCTCGGCGCTGGTGGGGG - Intergenic
1190598841 X:52069425-52069447 TGCGCGCCCGCGGTAGGAGGAGG - Intergenic
1190609983 X:52184648-52184670 TGCGCGCCCGCGGTAGGAGGAGG + Intergenic
1199798673 X:151227929-151227951 AGCGCAGTCGGGGCGGGCGGCGG - Intergenic
1202584590 Y:26409506-26409528 GGCGCGCCCAGTGCAGGCGGCGG - Intergenic