ID: 1155910349

View in Genome Browser
Species Human (GRCh38)
Location 18:31498188-31498210
Sequence TGCGCGCTCGGGGCAGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155910336_1155910349 15 Left 1155910336 18:31498150-31498172 CCGGGCCGGGGGGAGGCCGGGGC 0: 1
1: 2
2: 4
3: 96
4: 911
Right 1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG 0: 1
1: 1
2: 2
3: 12
4: 242
1155910341_1155910349 -1 Left 1155910341 18:31498166-31498188 CCGGGGCCAGGGAGGAGCCGAGT 0: 1
1: 0
2: 5
3: 74
4: 601
Right 1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG 0: 1
1: 1
2: 2
3: 12
4: 242
1155910342_1155910349 -7 Left 1155910342 18:31498172-31498194 CCAGGGAGGAGCCGAGTGCGCGC 0: 1
1: 0
2: 2
3: 8
4: 180
Right 1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG 0: 1
1: 1
2: 2
3: 12
4: 242
1155910338_1155910349 10 Left 1155910338 18:31498155-31498177 CCGGGGGGAGGCCGGGGCCAGGG 0: 1
1: 0
2: 8
3: 151
4: 1086
Right 1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG 0: 1
1: 1
2: 2
3: 12
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155910349 Original CRISPR TGCGCGCTCGGGGCAGGCGG CGG Exonic