ID: 1155912356

View in Genome Browser
Species Human (GRCh38)
Location 18:31518583-31518605
Sequence ATATATACACAGATGCATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 782
Summary {0: 1, 1: 0, 2: 8, 3: 73, 4: 700}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155912356 Original CRISPR ATATATACACAGATGCATAA AGG (reversed) Intronic
903391614 1:22967604-22967626 ACATATACACATATATATAATGG + Intergenic
903987179 1:27236821-27236843 ATAAATACATACATACATAAAGG - Intronic
904197776 1:28798687-28798709 AGATTTAGACAGATGCACAAAGG + Intergenic
904336183 1:29799955-29799977 ATATATATATATATGTATAAAGG - Intergenic
904970370 1:34414723-34414745 ATATACACACACATGCATGAAGG + Intergenic
907805828 1:57818800-57818822 ATATATATACATATGGTTAACGG + Intronic
908362241 1:63380682-63380704 ATATATAATCAAATGCTTAATGG + Intronic
908493911 1:64675179-64675201 ATATATACACAGCTGTTCAATGG + Intronic
909116142 1:71539605-71539627 ATATATACAGAGATACGTATAGG - Intronic
909529499 1:76666370-76666392 ATATATACACATATATATATGGG - Intergenic
909876003 1:80804332-80804354 ATATATATACACATACATATAGG - Intergenic
910011581 1:82470290-82470312 ATATGTGCACAGATGAATGATGG + Intergenic
910054715 1:83019013-83019035 ATATATATACATATGTATATAGG - Intergenic
910213009 1:84813189-84813211 ATATACACACACATGCATGGAGG + Exonic
910220252 1:84882845-84882867 ATAGATACTCACATGCAAAAGGG + Intronic
910272484 1:85411589-85411611 ATATCTAGACAGATGTATACAGG - Intronic
910325447 1:86001753-86001775 ATATATACACACACACACAAAGG + Intronic
910509037 1:87983263-87983285 ATATATAGACAGAGGTAGAATGG - Intergenic
911001932 1:93175290-93175312 ATATATATATATAGGCATAAGGG - Intronic
911263978 1:95721457-95721479 AGATGTACACATATGTATAATGG + Intergenic
911409752 1:97488413-97488435 ATATACACACACATACACAAAGG + Intronic
911494609 1:98615859-98615881 ATATAAATACATATGCATATAGG + Intergenic
911964220 1:104345797-104345819 ATATATATATATATGCACAATGG - Intergenic
912174889 1:107142153-107142175 AGATATCCACAGATCCATACAGG - Intronic
912538303 1:110392782-110392804 ATATACACACATATACATATAGG + Intergenic
913021706 1:114794605-114794627 ATGTATACATACATGCACAAAGG + Intergenic
914324669 1:146600723-146600745 ATATATCCACACATACATACAGG + Intergenic
915012048 1:152696681-152696703 ACATACACACACATTCATAAAGG + Intergenic
915658985 1:157385975-157385997 GTATATTCACAGATGCAGAAAGG + Intergenic
915749355 1:158191269-158191291 ATATACACATATATACATAAAGG - Intergenic
915986206 1:160467453-160467475 ATATATACACAAAAGAAGAAAGG - Intergenic
916269449 1:162924417-162924439 ATAAACACACACATGCAAAAGGG - Intergenic
916315451 1:163443402-163443424 AAATGTAAACAGATGCATATAGG + Intergenic
916337607 1:163691054-163691076 ATATATACAAGATTGCATAAAGG + Intergenic
917014073 1:170509871-170509893 ATATATACACGTATGTATCATGG + Intergenic
917048620 1:170892198-170892220 ACATATGCACACATGCATGAAGG - Intergenic
917052899 1:170944099-170944121 ATATAAACACAAATGCATAAAGG + Intronic
918681686 1:187362967-187362989 ATATATATATATATGTATAAAGG - Intergenic
918850779 1:189686759-189686781 ATATATACATATATGTATGATGG - Intergenic
919138989 1:193546375-193546397 ATTAAGACACAGATTCATAAAGG - Intergenic
919157253 1:193782101-193782123 ATACATAAACAGATGCTGAAGGG + Intergenic
919232649 1:194794438-194794460 ATACACAAACACATGCATAAAGG + Intergenic
919288322 1:195595026-195595048 ATATATACACACACACACAATGG + Intergenic
919340132 1:196294795-196294817 ATATATATATATATACATAATGG + Intronic
921215981 1:212937102-212937124 ATATCTACACTGATATATAAGGG + Intergenic
921440295 1:215177707-215177729 ATATATACACATATATATATAGG - Intronic
923202342 1:231724605-231724627 GTCTATACACAGATGACTAAAGG - Intronic
923478877 1:234364129-234364151 ATATATACATACATACATATAGG + Intergenic
923927512 1:238650022-238650044 CTAGATACATAGATGCCTAAAGG + Intergenic
924193659 1:241582358-241582380 ATATATAGAGAGAGACATAAGGG - Intronic
924212163 1:241781643-241781665 ACATATACACACATACAGAAAGG + Intronic
1062811541 10:470114-470136 ATATGTAGACAGATGCAGAGAGG + Intronic
1063135924 10:3216145-3216167 ATGTATACACACATGCACACAGG + Intergenic
1063728037 10:8661284-8661306 ATATATACACATATGTATTCGGG + Intergenic
1064427575 10:15243753-15243775 ACATATACATATATACATAAAGG + Intronic
1064485060 10:15778404-15778426 ATTTATTCACAGATGTATAGGGG - Exonic
1064789585 10:18941254-18941276 ATATATACACATACACACAATGG + Intergenic
1065079521 10:22113688-22113710 ATATATACACACACACACAATGG - Intergenic
1065823319 10:29546621-29546643 ATATATACACAGATGTGTACAGG + Intronic
1066119709 10:32273721-32273743 ATATATACACAGAGCCATTAGGG - Intronic
1068079507 10:52302098-52302120 ATATATACATAAATACATATGGG - Intergenic
1068350516 10:55838766-55838788 ATGTATACACATATACATATGGG - Intergenic
1068557453 10:58474939-58474961 ATATATACACACACACATATAGG - Intergenic
1068897551 10:62223978-62224000 ATACACATACATATGCATAATGG + Intronic
1068981058 10:63062579-63062601 AGAAATACACAGATGCAAGAAGG + Intergenic
1069141644 10:64834974-64834996 ATAGATACAAAGAGGTATAAGGG - Intergenic
1070053328 10:72910353-72910375 AAAAATACACAGATGTATAATGG + Intronic
1070575546 10:77674952-77674974 ATATAAACCCAAATGCATATTGG + Intergenic
1071348848 10:84719108-84719130 ATATATACAGATATACATATGGG + Intergenic
1071395702 10:85221765-85221787 ACATATACACAGAGGTATAGAGG + Intergenic
1071665317 10:87549954-87549976 GAATATACTCAGATGTATAAAGG + Intronic
1072206254 10:93207691-93207713 ATACATACATACATACATAAAGG + Intergenic
1072747687 10:97952899-97952921 ATATATTCACAGATGTGGAAGGG - Intronic
1072825550 10:98602582-98602604 ACATATACATATATGTATAAAGG + Intronic
1072859787 10:98991317-98991339 ATATATGAACAGATGCCTGAAGG + Intronic
1073174134 10:101541214-101541236 ATATATACACATATGTGAAACGG - Intronic
1073787435 10:106905771-106905793 ATATACATACAAATGCATACAGG - Intronic
1074628680 10:115223834-115223856 ATATATACACATATATATTAGGG - Intronic
1076211615 10:128651007-128651029 ATATATACACACATACACCATGG - Intergenic
1076245455 10:128944200-128944222 ACACACACACACATGCATAAAGG + Intergenic
1076989480 11:263785-263807 ATATATACACACACACATATAGG + Intergenic
1077928029 11:6701732-6701754 GTATATACACACATGCCTAATGG + Intergenic
1078327860 11:10395191-10395213 ATAGATACACACATACATACAGG + Intronic
1079173422 11:18117437-18117459 ATATATATACAGATATATAGTGG - Intronic
1079859632 11:25650340-25650362 ATATATACACATACACATACAGG - Intergenic
1080747535 11:35121842-35121864 ATATATACACACACTCATAATGG - Intergenic
1080801507 11:35614550-35614572 ATATATACACTGAGGCACAAAGG + Intergenic
1081141031 11:39500525-39500547 ATATATATATATATGCATTATGG - Intergenic
1081310216 11:41561578-41561600 ACATATACACAAATGCATGCAGG + Intergenic
1081429317 11:42958238-42958260 AGATACACACATATGCATGAAGG + Intergenic
1081481437 11:43493337-43493359 AAATTTAGGCAGATGCATAATGG + Intronic
1081548072 11:44086384-44086406 ATACATAGAAAGATGCATAGAGG - Intergenic
1082163219 11:48907335-48907357 ATACAGACACAGATACAAAAGGG - Intergenic
1082169592 11:48987301-48987323 ATATAGACACAGATACAAAAGGG + Intergenic
1082211763 11:49512314-49512336 ATATATATACACATACATACAGG + Intergenic
1082608324 11:55269472-55269494 ATACAGACACAGATACAAAAGGG - Intronic
1082658442 11:55879784-55879806 ATACAGACACAGATACAAAAGGG - Intergenic
1082716158 11:56616369-56616391 ATACATACACACATACATTAGGG - Intergenic
1082717806 11:56636484-56636506 ATATATATACACATACATACAGG - Intergenic
1082753908 11:57052800-57052822 ACATATATACAGCTGCATGAAGG - Intergenic
1082764296 11:57154982-57155004 ATATAGACACAGATCCCCAAAGG + Intergenic
1083017709 11:59473264-59473286 ATGTATACACAGACACATATGGG - Intergenic
1084549242 11:69831081-69831103 TTATAGACACAGATGCTCAACGG - Intergenic
1084841194 11:71850415-71850437 AGATATCAACATATGCATAATGG - Intergenic
1086156056 11:83667110-83667132 ATATATAAAAATATGAATAAAGG + Intronic
1086365270 11:86103072-86103094 AAATATAAACAAATACATAATGG + Intergenic
1086429934 11:86726879-86726901 ATATCTTCCCAGATGCATTATGG + Intergenic
1086462802 11:87022262-87022284 ATATATAAATAAATGCAAAATGG + Intergenic
1086546672 11:87976159-87976181 ATATATACCTATATACATAAAGG - Intergenic
1086637872 11:89112506-89112528 ATATATATACACATACATACAGG - Intergenic
1086696244 11:89849340-89849362 ATACAGACACAGATACAAAAGGG - Intergenic
1086702284 11:89913049-89913071 ATACAGACACAGATACAAAAGGG + Intronic
1086703883 11:89931401-89931423 ATACAGACACAGATACAAAAGGG - Intergenic
1086709912 11:89995149-89995171 ATACAGACACAGATACAAAAGGG + Intergenic
1087333309 11:96811617-96811639 ATATATACACACATACACAATGG - Intergenic
1087471597 11:98582663-98582685 ATATATACACAAACACACAATGG - Intergenic
1087495189 11:98882081-98882103 ATATATACACATATATATATGGG + Intergenic
1087766718 11:102163414-102163436 ATATGTACAAAGGTACATAATGG - Intronic
1087860563 11:103149274-103149296 ATATACACATACATACATAATGG + Intronic
1087862707 11:103181535-103181557 ATACAAACACACATGCATATAGG - Intronic
1087974266 11:104525149-104525171 ATATATACACACACACACAATGG - Intergenic
1088089926 11:106025589-106025611 ATACATATACATATGCACAATGG - Intergenic
1088145237 11:106669048-106669070 ATATATACACATACACATAATGG + Intergenic
1088766387 11:112983871-112983893 ATACATACATACATACATAAAGG - Intronic
1089554468 11:119308581-119308603 ATATATACATACATATATAAAGG + Exonic
1089624383 11:119741950-119741972 ATACACACACAGAGGCATACAGG + Intergenic
1090102445 11:123814000-123814022 ATATATATATATATGCAGAAAGG - Intergenic
1091119359 11:133043876-133043898 ATGTATGCACAAATGAATAAAGG - Intronic
1092943441 12:13431577-13431599 ATATTTACACAGATATATGAAGG - Intergenic
1093072465 12:14721266-14721288 ATGTATACACACATACACAATGG - Intergenic
1093491168 12:19706439-19706461 ATATATACACATATGCACAATGG + Intronic
1093848290 12:24002399-24002421 AGAAATACAAAGATGTATAAAGG + Intergenic
1096289345 12:50327853-50327875 ATATATATAAAGTTACATAAAGG + Intronic
1096945117 12:55397313-55397335 ATATATACACATATGTATATAGG + Intergenic
1097490776 12:60268058-60268080 GCATATACACTCATGCATAAAGG - Intergenic
1097717926 12:62986288-62986310 ATATATACATAGACTCATCATGG - Intergenic
1097815228 12:64066683-64066705 AAATATACACATTTGAATAAGGG - Intronic
1098184290 12:67879716-67879738 ATACATACATACATACATAATGG - Intergenic
1098265894 12:68718843-68718865 ATACATACATACATACATAATGG - Intronic
1098477499 12:70921659-70921681 ATAAAGACACAGAGGCAGAAAGG - Intergenic
1098625572 12:72661657-72661679 ATATATACACACATATATAAAGG - Intronic
1098973827 12:76881251-76881273 ATAAAGAAACAGATGCATAGAGG - Intergenic
1099099818 12:78424738-78424760 ATACATACACACATACACAAAGG - Intergenic
1099418605 12:82424546-82424568 ATATATATATATATGTATAAAGG + Intronic
1099537400 12:83861443-83861465 ATATAAACAAACATACATAATGG - Intergenic
1099573193 12:84351917-84351939 ATATATACACACACACATACAGG + Intergenic
1099735987 12:86566633-86566655 ATATATACATAAATGTATATAGG + Intronic
1099751223 12:86775479-86775501 GTACAAACACAGATGCACAAAGG + Intronic
1100203398 12:92323672-92323694 AAATATACAAAATTGCATAATGG - Intergenic
1100215532 12:92444142-92444164 ATATATACACATATGTAAGATGG - Intergenic
1100267803 12:92994736-92994758 ATATATATACAAAGGGATAAAGG - Intergenic
1101392240 12:104312016-104312038 ATATATACACACATATATATGGG + Intronic
1104795325 12:131513069-131513091 ATATATAGATAGATAGATAAAGG - Intergenic
1104996193 12:132658933-132658955 TTACATACACGGAGGCATAAGGG + Intronic
1105757398 13:23480842-23480864 ATATATCAACATATGCATAATGG - Intergenic
1107437549 13:40393591-40393613 AAATATACACATATGCAAACCGG + Intergenic
1108069236 13:46610681-46610703 ACATATACAGAGATAGATAATGG - Intronic
1108723205 13:53153046-53153068 ATATATACACATATACCCAAAGG + Intergenic
1108948676 13:56058986-56059008 ATATATACACATATATATATAGG + Intergenic
1109393325 13:61721736-61721758 ATATATACACACATACACATAGG - Intergenic
1109564706 13:64096734-64096756 ATATATACATACATACACAAAGG + Intergenic
1109618088 13:64863243-64863265 AGATACACAGAGTTGCATAATGG - Intergenic
1109660280 13:65449608-65449630 ATATATACACACACACGTAATGG - Intergenic
1109753908 13:66733650-66733672 ATATATAGAAAAATGTATAAAGG + Intronic
1109915246 13:68976469-68976491 ATATATACAAGGATGCAATAGGG - Intergenic
1109966126 13:69698816-69698838 ATATATACACACATACACAATGG + Intergenic
1110444451 13:75563124-75563146 ATACATACATACATACATAAAGG - Intronic
1110546142 13:76757580-76757602 ACATATACACATATACACAATGG - Intergenic
1110613423 13:77514406-77514428 ATATATACACACAAACATAGAGG + Intergenic
1110885236 13:80624650-80624672 ATATATACACACACACACAATGG - Intergenic
1110945737 13:81413516-81413538 ATTTATTCACAAATGAATAAAGG + Intergenic
1111173789 13:84565591-84565613 ATACATACACAGATATATATTGG + Intergenic
1111216505 13:85149607-85149629 ATATATACACATATGTATTCTGG - Intergenic
1111224398 13:85251001-85251023 ATATATATAAACATGCATATAGG + Intergenic
1111261911 13:85751749-85751771 ATATATATATATATGGATAAAGG + Intergenic
1111897987 13:94165278-94165300 ATATATATATATATACATAATGG + Intronic
1111945931 13:94665873-94665895 ATATATGCAGAGGTTCATAAGGG + Intergenic
1112603748 13:100882773-100882795 ATATATACACATATATATAAAGG - Intergenic
1112696374 13:101953535-101953557 ATATATATACACATACAGAAAGG - Intronic
1112702342 13:102024947-102024969 ATATATATACATATGTAAAATGG + Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1114242934 14:20885781-20885803 ATATTTTCACAGAAGAATAAAGG + Intergenic
1114245326 14:20907807-20907829 ATATTTTCACAGAAGAATAAAGG + Intergenic
1114249861 14:20949718-20949740 ATATTTTCACAGAAGAATAAAGG + Intergenic
1114731535 14:24998012-24998034 ATATTTGCACAGATGCACAATGG - Intronic
1114869479 14:26639154-26639176 GTATATACACAAATTCATTAAGG - Intergenic
1115039467 14:28905855-28905877 ATATATACATATATACACAATGG - Intergenic
1115047751 14:29017983-29018005 ATATATACACACATGTATATAGG - Intergenic
1115065295 14:29252492-29252514 ATATATATGCTTATGCATAAGGG - Intergenic
1115233302 14:31184769-31184791 ATACACACACATATGCATATAGG + Intronic
1115961835 14:38842729-38842751 ATATATACACACACACATACAGG + Intergenic
1116182966 14:41558513-41558535 ACATATATACAGAGGAATAAAGG + Intergenic
1116218855 14:42055404-42055426 ATAGATATATAGATACATAAAGG + Intergenic
1116258121 14:42584135-42584157 ATATATACACACATATATATGGG - Intergenic
1116351040 14:43863179-43863201 ATATATACACACATACATATAGG + Intergenic
1116615984 14:47139896-47139918 ATATATACACATATGGAGAGAGG + Intronic
1116631156 14:47335742-47335764 ATATATACATACATACATACAGG + Intronic
1117109599 14:52436724-52436746 ATACATACAAATATACATAATGG + Intronic
1117847520 14:59927157-59927179 ATGTATACACACATGCCTATGGG + Intronic
1118794715 14:69131161-69131183 ATACAAAGACAGATGCAAAATGG + Intronic
1119134344 14:72203252-72203274 ATATAGGCACAAATGCATACTGG + Intronic
1119212187 14:72840344-72840366 ATATGTATACATATGCATAAAGG - Intronic
1119300114 14:73565131-73565153 ATATTTACACACATTCATTAAGG + Intergenic
1119744082 14:77032205-77032227 ATATATACACACATACATGCTGG + Intergenic
1120075929 14:80158337-80158359 ATATAAACACATATATATAATGG + Intergenic
1120408410 14:84118147-84118169 ATACTTACACAGATGTTTAATGG - Intergenic
1120974086 14:90233872-90233894 ATATATACACACACACATAAAGG - Intergenic
1121944471 14:98105764-98105786 ATACATACATAGATAGATAATGG + Intergenic
1122026220 14:98879329-98879351 ATATATAAACAAATCCATCATGG - Intergenic
1122928207 14:104919754-104919776 ATATATACACACACACACAATGG - Intergenic
1123484845 15:20681814-20681836 GTATATAAACAAATACATAAAGG + Intergenic
1123537576 15:21250882-21250904 GTATATAAACAAATACATAAAGG + Intergenic
1124560118 15:30764952-30764974 ATACACACACATATGCACAAAGG + Intronic
1124671125 15:31640827-31640849 ATACACACACATATGCACAAAGG - Intronic
1124910730 15:33917458-33917480 ATATATATACACATACATCATGG + Intronic
1125063475 15:35453289-35453311 ATATATACACATATATGTAATGG + Intronic
1125102895 15:35935470-35935492 ATATATGCACACATACATACTGG - Intergenic
1125120560 15:36153937-36153959 ATATATACACAGAGTAATGATGG + Intergenic
1125356044 15:38818336-38818358 ATATATACACACAGGCACACAGG + Intergenic
1125611440 15:40973819-40973841 AAATATACACACATGCAAATGGG - Intergenic
1126575133 15:50189043-50189065 ATACATACATACATACATAATGG + Intronic
1126977746 15:54203928-54203950 ATATATACACACACACACAATGG + Intronic
1126999814 15:54489474-54489496 ATATATACACACATACATTGAGG - Intronic
1127523244 15:59764714-59764736 ATAGATAGAGATATGCATAAAGG + Intergenic
1128106269 15:65047382-65047404 ATATATACACACATTAAAAATGG + Intronic
1129551823 15:76459344-76459366 ATATATGCACACACACATAATGG - Intronic
1130130700 15:81139681-81139703 ATTTATACACAAATGCACACTGG - Intronic
1130365103 15:83229073-83229095 ATATATACACACATATATGATGG - Intergenic
1130711533 15:86286670-86286692 ATATATACATACATACACAATGG - Intronic
1130864800 15:87923558-87923580 ATAGATACTCAGATATATAATGG - Intronic
1131242924 15:90763531-90763553 ATATATGCATATATGCATAGTGG + Intronic
1132100484 15:99019527-99019549 ATATATACACACATATATGAAGG + Intergenic
1132777116 16:1600475-1600497 AAATGTACACAGGTGCAAAATGG + Intronic
1133140789 16:3742371-3742393 ATATTTGCACATATGCATAACGG - Intronic
1133458464 16:5964672-5964694 ATATATACACAAACACACAATGG - Intergenic
1133749585 16:8714003-8714025 GCATGTACACAGATGCACAAGGG - Intronic
1137043211 16:35632802-35632824 ATATATACAGACATGTAAAAGGG - Intergenic
1137284863 16:47007101-47007123 AAATAGACACAGATGCAATAGGG + Intergenic
1138159436 16:54739609-54739631 ATATATAAACAGATACAGATAGG - Intergenic
1138926833 16:61602388-61602410 ATATAAACACAGAACCAGAAAGG + Intergenic
1139043640 16:63030643-63030665 ATATATAGACTCATGAATAAGGG + Intergenic
1139243973 16:65422719-65422741 ATATATAAACAGAGACATCATGG + Intergenic
1139798035 16:69498713-69498735 ACATAGACAGAGATGGATAAGGG - Intergenic
1140008893 16:71110223-71110245 ATATATACACACATACATACAGG - Intronic
1140245808 16:73247009-73247031 TTATATACACACACGCATATAGG - Intergenic
1140283027 16:73572926-73572948 AGATATACAAAGATGAATATAGG - Intergenic
1140320150 16:73942892-73942914 ATATATACACATATACATTATGG + Intergenic
1141044337 16:80703028-80703050 ATATATACACACATGAATCTAGG + Intronic
1141258112 16:82422512-82422534 ATATGTAGACAGATGGATAATGG + Intergenic
1142846329 17:2679730-2679752 AAATATACACACATACATGAAGG - Intronic
1144122713 17:12171548-12171570 ATCTAGAAACAGATGCATGATGG - Intergenic
1144180707 17:12749584-12749606 ATATATACACACATATATATAGG - Intronic
1144246299 17:13369189-13369211 ATATATACACACACGCACCATGG - Intergenic
1145961155 17:28887215-28887237 ACATATAGACAGCTGCAGAAAGG + Intronic
1146238850 17:31195337-31195359 AAAACTACACAGATCCATAAGGG - Intronic
1146293369 17:31629356-31629378 ATATAATCACAGCTGCACAAGGG + Intergenic
1146364914 17:32215496-32215518 ATATTTAGAAAGATGCTTAAAGG - Intronic
1147027977 17:37605500-37605522 ATACATAAACAGATGTATAAAGG + Intronic
1148925279 17:51078974-51078996 ATACACACACACTTGCATAATGG + Intronic
1149236425 17:54595574-54595596 ATATATATATATATGTATAAAGG + Intergenic
1149236439 17:54595989-54596011 ATATATACACATATATATAAAGG + Intergenic
1149377134 17:56055465-56055487 ATATATACACACAGACATAATGG - Intergenic
1149946061 17:60928902-60928924 ATATACACACACATACATAGAGG + Intronic
1150584142 17:66502161-66502183 ATCCATGCACAGATGCATAATGG - Intronic
1151069124 17:71188158-71188180 AAATTTACTCAGATGCAAAATGG - Intergenic
1151353377 17:73544599-73544621 ATACATGGACAGATGGATAATGG + Intronic
1152285824 17:79412806-79412828 ATATACACACACATGCATAGAGG - Intronic
1152866308 17:82725729-82725751 ATATTTACACGTATGCAAAATGG + Intronic
1152884151 17:82839018-82839040 ATATAGACACAGATACAAAAGGG - Intronic
1152939156 17:83157540-83157562 ATATATACACATATATATATTGG + Intergenic
1153130917 18:1854872-1854894 ATATATACATATATATATAAAGG + Intergenic
1153254241 18:3154696-3154718 ATATATACACATACATATAATGG - Intronic
1154250579 18:12740904-12740926 ATATACACACACATACATATAGG + Intergenic
1155263005 18:24062901-24062923 ATACACACACATATGCCTAATGG - Intronic
1155276622 18:24194410-24194432 ATATATACATATTTGCATACTGG + Intronic
1155706363 18:28819614-28819636 ATAAATACAAAAATACATAAAGG - Intergenic
1155912356 18:31518583-31518605 ATATATACACAGATGCATAAAGG - Intronic
1155914249 18:31540342-31540364 CTACATATACAGATACATAACGG + Intronic
1155992546 18:32294200-32294222 AAATATACACTGATGTATTAAGG + Intronic
1156277917 18:35602377-35602399 ATAAATACACAGATACAGGAAGG - Intronic
1156475025 18:37400301-37400323 ATATATACACACATATATAAAGG - Intronic
1156799898 18:41097581-41097603 ATATATACACACACACATACAGG + Intergenic
1156805178 18:41169829-41169851 ATATATATATAAATGTATAAGGG + Intergenic
1156973868 18:43192839-43192861 ATATATACACACATATATATGGG + Intergenic
1157150596 18:45213551-45213573 CTATATAGACAGAGCCATAATGG - Intronic
1157317770 18:46607434-46607456 ATATATACACACATATATATGGG + Intronic
1157670986 18:49528452-49528474 AAATATGCACATATACATAATGG - Intergenic
1157838482 18:50931591-50931613 ATATAAACACTGATGAATGAAGG - Intronic
1158049316 18:53196727-53196749 ATTTATACACACATACGTAATGG + Intronic
1158626289 18:59074440-59074462 ATTTATAGACACATGCATATTGG - Intergenic
1159111681 18:64066336-64066358 ATATATACACACACACACAATGG - Intergenic
1159500081 18:69257381-69257403 ATATATACACATGGACATAAGGG + Intergenic
1159850102 18:73516942-73516964 ATATATACACATATATATCAGGG + Intergenic
1159850808 18:73525264-73525286 ATATATACACATATACACAATGG - Intergenic
1159957319 18:74528828-74528850 ATAAATACACAGAAGCAACAAGG - Intergenic
1162216913 19:9142562-9142584 ATCAATAAACAGATACATAATGG - Intronic
1162276638 19:9661128-9661150 ATAGATACATAGATACATATAGG - Intronic
1163931267 19:20394613-20394635 ATGTATAAAATGATGCATAAAGG - Intergenic
1164142896 19:22489271-22489293 ATATATATACATATGTATATAGG - Intronic
1164499536 19:28805605-28805627 ATATATACACATATGTATATAGG + Intergenic
1166233931 19:41442470-41442492 ATATATATACATATATATAATGG - Intergenic
1167860957 19:52283715-52283737 ATACATACATACATACATAAAGG - Intronic
1168184591 19:54691311-54691333 ATATATACACAGAAGTAAAATGG - Intronic
1168360118 19:55732484-55732506 TTGGATACACAGATGCATGAAGG + Exonic
924968725 2:102891-102913 ATATATACACACACACACAAAGG - Intergenic
925540870 2:4966382-4966404 ATATATATATATATACATAATGG - Intergenic
925665727 2:6253189-6253211 ATATATACACATATACACCATGG - Intergenic
926026457 2:9549424-9549446 ATATATACACATAAGTATAGTGG + Intronic
926183413 2:10666775-10666797 GTATGTACACATATGCATATTGG + Intronic
926554123 2:14336670-14336692 ATATATACACATATATGTAAAGG - Intergenic
927974570 2:27328301-27328323 ATATATGCTCAGATGCAGTACGG + Intronic
928216277 2:29364050-29364072 CTATAAACACAGATTCAAAATGG + Intronic
928297775 2:30099781-30099803 ATATATACACACATACACCATGG - Intergenic
928334770 2:30387821-30387843 ACATATATACATATTCATAAAGG - Intergenic
928571042 2:32608842-32608864 ATATATACACATTAGAATAAGGG - Intronic
928610690 2:32989285-32989307 ATTTATAAATAGATGCAAAATGG + Intronic
928680508 2:33697474-33697496 ATATGTCAACAAATGCATAATGG + Intergenic
928808575 2:35193599-35193621 ATATATACACACATACACCATGG + Intergenic
929010090 2:37433319-37433341 AAATATACACAACTGCAGAATGG - Intergenic
929045920 2:37789609-37789631 AGAAATACACAGAATCATAAGGG - Intergenic
929324677 2:40594841-40594863 ATGTGTACACACATGCACAAAGG - Intronic
929369952 2:41210856-41210878 ATATATACACACATAGATATTGG + Intergenic
929372208 2:41239867-41239889 ATATATACACAGATATACACAGG - Intergenic
929662616 2:43803677-43803699 ATATACACACAGACACACAAAGG + Intronic
930080415 2:47442039-47442061 ATATATACACACACACACAATGG - Intronic
930414514 2:51074477-51074499 ATCTGTACACAGATGAAAAAAGG - Intergenic
930447584 2:51494352-51494374 ATATATACATATATGCATATAGG - Intergenic
931565262 2:63609387-63609409 ATATATACACACACTAATAAAGG + Intronic
931956432 2:67431214-67431236 ATAAATAAACATATGTATAAAGG - Intergenic
931961118 2:67484474-67484496 ATATATGCAGAGGTGCATATAGG - Intergenic
932409915 2:71539712-71539734 ATATATACATACATACAGAAAGG - Intronic
933580240 2:84117722-84117744 ATATATACCCACAGGCAGAAAGG - Intergenic
934981198 2:98843705-98843727 ATAGATACACAGAGACAGAAGGG - Intronic
935644862 2:105326224-105326246 GTATACATACATATGCATAAGGG + Intronic
935645829 2:105333612-105333634 ATACATACACATGAGCATAAAGG - Intergenic
935647106 2:105347261-105347283 ATACATACATATATGCAAAAGGG + Exonic
936843679 2:116804032-116804054 ATATATACACATATATATGATGG - Intergenic
936984225 2:118292880-118292902 ATATATACACACACACACAATGG - Intergenic
937784161 2:125875782-125875804 ATTTATTCCCAGTTGCATAAAGG + Intergenic
937808572 2:126173814-126173836 ATACATACACAGACACATATGGG - Intergenic
938220646 2:129564200-129564222 ATATTAACACATATACATAATGG - Intergenic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
939542255 2:143508540-143508562 ATAAATCCAAAAATGCATAAAGG + Intronic
940477248 2:154178492-154178514 ATATATACACATGTGCATGTTGG - Intronic
940818580 2:158325628-158325650 ATCTCTACACAGATACCTAATGG + Intronic
941169625 2:162120771-162120793 ATGTGTACACACATGCATCAGGG + Intergenic
941460506 2:165765891-165765913 ATCTATACACAGAATCAAAAGGG + Intronic
941883983 2:170509607-170509629 TTATATACACAAATGAATCAAGG - Intronic
942779573 2:179625518-179625540 ATATATAAACAGATGAATAAAGG + Intronic
943021208 2:182575700-182575722 ATATATATATAGATACATAATGG - Intergenic
943184206 2:184585634-184585656 ATATATACCCAGAAGAATATAGG - Intergenic
943229262 2:185225469-185225491 ATATATACATAGATTTTTAATGG + Intergenic
943477138 2:188370850-188370872 ACACATACACACATGCTTAAAGG - Intronic
943538114 2:189178401-189178423 ATATATAGACACATACATACAGG - Intronic
943556972 2:189417799-189417821 ATATATACACACACACACAATGG - Intergenic
943641735 2:190367131-190367153 ATATACACACACATACATACAGG + Intronic
944341713 2:198609206-198609228 ATATATTCACATATACATACAGG - Intergenic
944383123 2:199134804-199134826 ATGAATTCACAGATGCAAAATGG + Intergenic
944934488 2:204553692-204553714 ATATACACACATATATATAAAGG + Intronic
945163535 2:206918518-206918540 GCAGATGCACAGATGCATAAGGG - Intergenic
945429083 2:209743606-209743628 ATTTATATACAGATACATAATGG + Intergenic
945443060 2:209903665-209903687 ATATATACACACATGGTTAGAGG + Intronic
945598467 2:211826938-211826960 ATATATACACACATGCAAAAGGG - Intronic
945622697 2:212160896-212160918 AAATATACACACAGTCATAATGG - Intronic
945846327 2:214949343-214949365 ATATATATTCAGATGGTTAAAGG - Intronic
946102782 2:217341013-217341035 ATATATACACACACACACAATGG + Intronic
946557063 2:220870336-220870358 ATATATACACATATACATAAAGG + Intergenic
947279733 2:228437427-228437449 ATATATATATATATGCAAAATGG + Intergenic
947413339 2:229867074-229867096 ATATATACACACACACATAGAGG + Intronic
948068424 2:235100336-235100358 GTGGATACACAGGTGCATAAAGG - Intergenic
1169539882 20:6587936-6587958 ACATAGATACAGATGCAAAATGG + Intergenic
1170129576 20:13004512-13004534 ATATATACAGAGATGTATGATGG + Intergenic
1170339865 20:15312816-15312838 ATATATACACACACATATAATGG - Intronic
1170372325 20:15663012-15663034 TTATAAATACAGATGCTTAAAGG + Intronic
1170452756 20:16502310-16502332 ATGTATACAGAGATGTTTAATGG + Intronic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1171000127 20:21406113-21406135 ATATATACACATATATATACAGG - Intergenic
1171855850 20:30342385-30342407 ATATATACATATATGGAAAAGGG - Intergenic
1172531654 20:35635170-35635192 ATATATACATATATATATAAAGG + Intronic
1173281521 20:41632417-41632439 ATATACACACAAAAGAATAATGG + Intergenic
1173635432 20:44552601-44552623 ATTTATATACAGTTGCATAGTGG - Intronic
1177051989 21:16248030-16248052 ATACATACATACATACATAATGG - Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1177163525 21:17575033-17575055 ATACATACATACATACATAAGGG + Intronic
1177342389 21:19821054-19821076 ATATATACACACACACATATAGG - Intergenic
1177680638 21:24364608-24364630 ACATATACACACATGCATGGAGG + Intergenic
1178193423 21:30314267-30314289 ATATAAAGACAGATGGACAATGG - Intergenic
1178348625 21:31853361-31853383 ATATATACACACACACATACAGG - Intergenic
1179200420 21:39213920-39213942 ATATATACATATATATATAAGGG + Intronic
1179300423 21:40103819-40103841 ATATATAGACATATATATAATGG - Intronic
1179644828 21:42769225-42769247 ACATATACACATATGCACACAGG + Intronic
1183330147 22:37215129-37215151 ATGTATGCACCGAGGCATAAGGG - Intergenic
1183562775 22:38589369-38589391 ATATATATACAGATGCCAAGAGG + Intronic
1184959154 22:47916549-47916571 ATATATAGATAGATATATAAAGG + Intergenic
1185094995 22:48801295-48801317 ATACATACACACATGCACACAGG + Intronic
949214059 3:1543924-1543946 ATAAATACACCAATACATAATGG + Intergenic
949632818 3:5947342-5947364 ATATTTACATAGATGGATAAAGG - Intergenic
949841898 3:8328903-8328925 ACATATACACACATACATGAAGG + Intergenic
950997951 3:17524872-17524894 ATAAATACATACATACATAAAGG + Intronic
951011593 3:17688233-17688255 ATATATATACACATACATATAGG + Intronic
951367202 3:21797933-21797955 ATATTTAGACAAATGTATAATGG - Intronic
951806609 3:26651441-26651463 ATATACACACAGATACACACAGG - Intronic
952479038 3:33741122-33741144 ATATTTACACATATACACAATGG - Intergenic
952581717 3:34841135-34841157 ATATATACCCAGGAGCAAAAGGG - Intergenic
953587145 3:44212777-44212799 ATAAATACACAGAAGTATACTGG + Intergenic
954873027 3:53782280-53782302 ATATATATATATATGCATACTGG + Intronic
954900749 3:54017236-54017258 ATAGATACACAGATACACATAGG - Intergenic
955296716 3:57742122-57742144 ATATGTACACATAGGCATCAGGG - Intergenic
955485943 3:59434509-59434531 TTATCTATACAGATGCATATTGG - Intergenic
955764606 3:62328765-62328787 TTAGATACTCAGATGCATAAAGG + Intronic
956030413 3:65031057-65031079 ATATATACTCAGATGACTCATGG - Intergenic
956147808 3:66209787-66209809 ATATATACACACCTATATAAAGG + Intronic
956660285 3:71590730-71590752 ATATATACACATATACATGTGGG - Intergenic
957632499 3:82735331-82735353 AAAAATACACAAATGCATAAAGG - Intergenic
957843043 3:85695562-85695584 ATATATACACATATATATACGGG + Intronic
958514078 3:95090074-95090096 ATAAATACATAGATGCATAATGG - Intergenic
959074336 3:101734382-101734404 GTACATACACACATGCATTATGG + Intronic
959175187 3:102899794-102899816 ACACACACACAGATGCACAAAGG + Intergenic
959374767 3:105575101-105575123 ATATAGACACACATACATAATGG + Exonic
959600543 3:108179027-108179049 ACATATACTCAGATGCAGGAAGG + Intronic
959642157 3:108653492-108653514 ATATATACACACACACACAATGG - Intronic
960152154 3:114261456-114261478 ATAAATACACAGACAGATAAAGG + Intergenic
960252986 3:115477561-115477583 ATATATACATATATGCTTTATGG + Intergenic
960694383 3:120381797-120381819 ATATGGACATAGATGCAGAAAGG + Intergenic
961575625 3:127833674-127833696 AGCTACCCACAGATGCATAAGGG + Intergenic
963570800 3:146993018-146993040 ATATATACATATATGTATAGAGG + Intergenic
963594865 3:147313623-147313645 TTAAATAGACAGCTGCATAATGG + Intergenic
964516265 3:157511792-157511814 ATAAATACATAGATGTAGAAAGG - Intronic
964774209 3:160257286-160257308 ATATATACACACACACACAAAGG - Exonic
965819568 3:172671645-172671667 ATACATACACACATGCACACAGG + Intronic
965819570 3:172671738-172671760 ATACATACACACATGCACACAGG + Intronic
965893136 3:173539363-173539385 ATATATACACATATATATGATGG - Intronic
965934860 3:174095522-174095544 ATATATATATAGATATATAATGG - Intronic
966505225 3:180693094-180693116 ATATATACTCTGATGCCTTAAGG - Intronic
966780778 3:183582230-183582252 ATATATATACATAAGCAGAAAGG + Intergenic
967480759 3:189970313-189970335 ATATATACACACATACCTATAGG + Intronic
968675886 4:1879156-1879178 ATATACACATAGATACATAAAGG - Intronic
969090137 4:4687753-4687775 ATATAAACACACATACATACAGG - Intergenic
969146013 4:5124719-5124741 ACACATACACACATGCATACAGG - Intronic
969287178 4:6210320-6210342 ATATATACATACATACATATGGG + Intergenic
969761301 4:9185058-9185080 ATATATATATATATGCATAATGG + Intergenic
969782291 4:9416445-9416467 AGATATCAACATATGCATAATGG - Intergenic
970678944 4:18485072-18485094 ATATAAAAAAAGATACATAATGG + Intergenic
971083956 4:23248434-23248456 ATATATTTACATATGCATGAGGG - Intergenic
971139776 4:23911730-23911752 ATATATACTAACATGCATATTGG + Intergenic
971579846 4:28322263-28322285 ATATAGAAACAGATGGATATTGG + Intergenic
971901598 4:32666317-32666339 CTATATACATATATGCATATAGG + Intergenic
972008725 4:34147217-34147239 ACATACACACAAATGCACAAAGG + Intergenic
972705195 4:41535493-41535515 ATATGGACACAGATACATACAGG - Intronic
973013145 4:45102869-45102891 ATCTAACCACAGAAGCATAAGGG - Intergenic
974138864 4:57855260-57855282 AGATATAAATAGATACATAAAGG - Intergenic
974434952 4:61844843-61844865 ATAAATACACAGTAGCAGAAGGG - Intronic
974450571 4:62051184-62051206 ATATATACATACATACACAAAGG + Intronic
974574762 4:63703909-63703931 ACTGATACAGAGATGCATAAGGG - Intergenic
974720511 4:65732184-65732206 ATATATACACACATATATATAGG + Intergenic
975428789 4:74263086-74263108 ATATATACACATATATATATAGG - Intronic
975616169 4:76249899-76249921 ATATATACACATATATATAATGG - Intronic
976268617 4:83208210-83208232 ATATATAGTGAGATGCATCAAGG + Intergenic
976585913 4:86796954-86796976 ATAGATAGACAGAAGCATTATGG - Intronic
976821433 4:89211859-89211881 ATAGATACATAGATACATAGAGG + Intergenic
977158749 4:93608150-93608172 ATATATACACATATGTATTCTGG + Intronic
977664601 4:99631438-99631460 AGATACACAGAGATGCTTAAAGG + Intergenic
977876953 4:102161500-102161522 AGACATACAAAAATGCATAATGG + Intergenic
978180983 4:105795551-105795573 ATAGATACACACATGCACACAGG - Intronic
978192937 4:105936783-105936805 TTATAAACAGAGATCCATAAAGG + Intronic
978677428 4:111336560-111336582 ATATATACACATATACACCAAGG + Intergenic
978881407 4:113707653-113707675 AAATATACTAAAATGCATAAAGG + Intronic
978977576 4:114897144-114897166 AGATTTAGACAGATGTATAATGG + Intronic
979114864 4:116810702-116810724 ATAAATATACAGCTGCATAAGGG + Intergenic
979286771 4:118934897-118934919 AAATAAACACCGATGAATAAAGG - Intronic
979497934 4:121405664-121405686 ATATATACACACACACATAATGG - Intergenic
979549194 4:121971546-121971568 ATATATACCCACATGTATAAAGG + Intergenic
979709684 4:123764309-123764331 ATATATACACACACACACAATGG - Intergenic
979799729 4:124893989-124894011 GTATATACATATATGCATACAGG + Intergenic
980420619 4:132555319-132555341 ATAGATAGACAGATAGATAATGG - Intergenic
980572751 4:134642255-134642277 ATATACACACATATACACAATGG - Intergenic
980835865 4:138191485-138191507 AAATGTGCAGAGATGCATAAAGG + Intronic
980941384 4:139278743-139278765 ATATATACACTGATGAAGTAGGG - Intronic
981437539 4:144743613-144743635 ATATATACACACATGTATTTTGG - Exonic
982214696 4:153070698-153070720 ATATATAGACAAAGGCAAAATGG - Intergenic
982449670 4:155537647-155537669 AATTATACATATATGCATAATGG - Intergenic
982481458 4:155916784-155916806 TTAAATACACAGAAGCATGACGG - Intronic
982613253 4:157605250-157605272 ATATATATACATATATATAATGG + Intergenic
982920828 4:161272890-161272912 ATTTCCACACAGATACATAAAGG - Intergenic
983000662 4:162409705-162409727 AAATATAAACAGATACATGAGGG - Intergenic
983075585 4:163321993-163322015 ATATATACACATAATAATAATGG - Intergenic
983155790 4:164346589-164346611 ATATATACATACATACATACAGG - Intronic
983630695 4:169846333-169846355 ATAAATACAAAGATGAATGAGGG - Intergenic
983732905 4:171019512-171019534 ATATACACACATTAGCATAAAGG - Intergenic
983779906 4:171655662-171655684 ATATATTTACAAATGCACAATGG - Intergenic
983796690 4:171872952-171872974 ATAGATACACAAATGAATTATGG + Intronic
983818373 4:172161282-172161304 AAATATACACATATACATAAAGG - Intronic
984207834 4:176807963-176807985 ATGTATACATATATACATAAGGG + Intergenic
985141743 4:186847022-186847044 ATGTATACACATATACAAAATGG - Intergenic
985192870 4:187395831-187395853 ATATATACATATGTACATAAAGG - Intergenic
985514929 5:337382-337404 ATATACACACACATACATACAGG + Intronic
986124518 5:4872951-4872973 ATATTTACACAGAAGCACCAGGG - Intergenic
986153575 5:5150937-5150959 ACATATCAACATATGCATAATGG - Intronic
986294515 5:6426544-6426566 ATATATACACACACACATATAGG - Intergenic
986312388 5:6562112-6562134 ATATATACACATACACACAATGG + Intergenic
986842440 5:11713611-11713633 ATATATATACATATATATAAAGG + Intronic
987009845 5:13751469-13751491 ATATACACACATATATATAATGG + Intronic
987443214 5:17983295-17983317 ATATATACATATATACATCATGG + Intergenic
987489834 5:18565206-18565228 ATATATACACACATACACACAGG - Intergenic
987561552 5:19530123-19530145 ATAAATACACAAATGCTCAAGGG + Intronic
987779220 5:22411098-22411120 GTATATACAAAGATATATAATGG + Intronic
987883720 5:23784080-23784102 ATTTGTACACACATACATAAAGG - Intergenic
988891806 5:35625618-35625640 ATACATCCATAGATGAATAATGG + Intronic
989770800 5:45142949-45142971 ATATATACACAAATTCTTTAAGG + Intergenic
989785994 5:45330444-45330466 ATATATACATATATATATAATGG + Intronic
990014509 5:51043295-51043317 ATACATACATACATACATAAGGG - Intergenic
990094363 5:52093391-52093413 ATACACACACACATGCATATGGG + Intergenic
990409858 5:55531349-55531371 ATATACACACACATGCACACAGG + Intronic
990904501 5:60789630-60789652 ATACATACACATATTCAGAAGGG + Intronic
991369757 5:65905869-65905891 AAATATATACAAATACATAAAGG + Intergenic
991408114 5:66321260-66321282 ATATATACACACACACACAATGG + Intergenic
992536068 5:77704992-77705014 CTACATACACAGATGTAAAAGGG - Intronic
992594360 5:78330679-78330701 ATATATACATAAATACACAAAGG - Intergenic
992823679 5:80525867-80525889 ATATATATATATATGCATACAGG - Intronic
993005697 5:82425979-82426001 ATTTATACACAGAAGGATTAAGG - Intergenic
993019839 5:82578886-82578908 ATATACACACACATACACAAAGG - Intergenic
993366510 5:87040700-87040722 ATATGCACCCAGATTCATAAAGG - Intergenic
993476635 5:88374262-88374284 ACATAGACACAGATGAATAAAGG + Intergenic
993847001 5:92956598-92956620 ACATATACACAGAAGAAAAAAGG + Intergenic
994466313 5:100137842-100137864 ATATATACACATAGACATAGAGG + Intergenic
994564810 5:101430165-101430187 ATATATACACATATATATATGGG - Intergenic
994580412 5:101634098-101634120 ATATACACATAGATACATATGGG - Intergenic
994842685 5:104947074-104947096 ATATATATATATATGTATAATGG - Intergenic
995602937 5:113818186-113818208 ACATAAACACACATGCAAAATGG - Intergenic
997018552 5:129967356-129967378 ATATATACACATATCTAAAATGG - Intronic
997123872 5:131205804-131205826 ATAGAGACACACATTCATAATGG - Intergenic
997317179 5:132946463-132946485 ATATATACACACATACATAATGG + Intronic
998304216 5:141057118-141057140 ATATATACACACATACACAATGG + Intergenic
998927734 5:147145158-147145180 ATACAGACAGACATGCATAAAGG - Intergenic
1000193098 5:158931757-158931779 ATATATAGAGAGAGGCATAGGGG + Intronic
1000416499 5:160989772-160989794 AAACATACACACATGCACAATGG - Intergenic
1000483668 5:161811468-161811490 AGATACAAACAGATGCATAAAGG - Intergenic
1000908601 5:166994023-166994045 ATATGTACACACAGACATAATGG - Intergenic
1000975313 5:167758005-167758027 ATGTATTGACAGATGCATGAAGG - Intronic
1002113775 5:176940886-176940908 ATTATTTCACAGATGCATAAAGG + Intronic
1002973967 6:2055321-2055343 ATAAATCTACAGATTCATAAAGG + Intronic
1004296933 6:14421591-14421613 ATATATAGAGAGAAGCCTAAAGG - Intergenic
1004351874 6:14897265-14897287 ATACACACACACATGCACAATGG + Intergenic
1005080169 6:21949017-21949039 ATACATACATATATGCATAAAGG + Intergenic
1005664324 6:28035791-28035813 ATTTATACACACAAGCATTATGG + Intergenic
1005717899 6:28569059-28569081 ATATATAAATAGATAGATAATGG + Intergenic
1005722798 6:28619420-28619442 ACATATACACAGGAGCATAGTGG + Intergenic
1005774197 6:29112262-29112284 GTCTACACACAGCTGCATAACGG - Exonic
1005780092 6:29181881-29181903 GTCTACACACAGCTGCATAACGG - Intergenic
1006978778 6:38128690-38128712 ATATATACATATATACATGATGG - Intronic
1007017583 6:38484159-38484181 AGACATGCACAGAAGCATAAAGG + Intronic
1007201193 6:40110713-40110735 ATTGAGACACAGATGCTTAAAGG + Intergenic
1007634672 6:43291678-43291700 ATATATACACATATATATGATGG - Intergenic
1007830323 6:44633487-44633509 AGAAATACACATATCCATAAAGG - Intergenic
1008090388 6:47288045-47288067 GTATATACACACATGCCTAATGG + Intronic
1008424456 6:51340724-51340746 ATATATACACACATGTATAAAGG + Intergenic
1010451323 6:76006505-76006527 ATATATACCCATATGTATATAGG - Intronic
1011247735 6:85337300-85337322 ATTTATAGATAGATGCAAAATGG - Intergenic
1012013162 6:93818711-93818733 ATATTTACACACATGAATGATGG - Intergenic
1012107649 6:95184662-95184684 ATACATTCACAGATACATTAGGG - Intergenic
1012369872 6:98490658-98490680 ATATATATATAAATGCAAAAAGG - Intergenic
1012764139 6:103342855-103342877 ATACATACACACATGCATCAGGG - Intergenic
1012992088 6:105936266-105936288 ATTTCTTCACAGATGCATGAAGG + Intergenic
1013438028 6:110132895-110132917 ATATATACACAGACACACCATGG - Intronic
1013694960 6:112691140-112691162 TTATATACTCAGATGCTGAAAGG + Intergenic
1013749989 6:113393995-113394017 TTATATACACATGTGCATGAGGG + Intergenic
1013939375 6:115643785-115643807 AAATATACACACATACATACAGG + Intergenic
1014355977 6:120410739-120410761 TTATATACACAGATGTATGTAGG + Intergenic
1014449185 6:121563951-121563973 TTATATAGACAGTTTCATAAAGG - Intergenic
1014465155 6:121747855-121747877 ATACATACATATATCCATAAAGG - Intergenic
1015011559 6:128355512-128355534 ATATACACACACATGCATGTGGG + Intronic
1015096790 6:129424839-129424861 GTAAATACACAGAAGCAGAATGG - Intronic
1016038863 6:139411266-139411288 ATATACACACATATATATAAAGG + Intergenic
1016146980 6:140689965-140689987 ATATATACACACACACACAAAGG + Intergenic
1016165383 6:140935682-140935704 ATATATATATATATGCATTATGG - Intergenic
1016689498 6:146920204-146920226 AAATATACAGAGATGCATAGGGG - Intergenic
1017043810 6:150328797-150328819 ATATATACACACAAACATATTGG + Intergenic
1017119697 6:151012704-151012726 ATATATACACACATCCTTATTGG - Intronic
1017518224 6:155177389-155177411 ATATATTCACAGTTGCTTTATGG + Intronic
1017967988 6:159283345-159283367 ATATATACGTATATGCATATAGG - Intergenic
1017967996 6:159283553-159283575 ATATATACATATATGTATATAGG - Intergenic
1017967997 6:159283579-159283601 ATATATACATATATGTATATAGG - Intergenic
1017967998 6:159283605-159283627 ATATATACATATATGTATATAGG - Intergenic
1018202282 6:161406093-161406115 ATATATATACGTATGTATAAAGG - Intronic
1018222073 6:161591155-161591177 ATATGTACACAGATGGAGACAGG + Intronic
1018492443 6:164307773-164307795 ATATTTATACAGATGCCTCAGGG - Intergenic
1018526225 6:164712853-164712875 ATATATACACATATATGTAATGG - Intergenic
1018926460 6:168210226-168210248 ATACACACACACATGCATACAGG - Intergenic
1019099899 6:169621216-169621238 ATATACACACACATGCACACAGG + Intronic
1019897382 7:3992938-3992960 ATTTATAAATAGATGCAAAACGG - Intronic
1019974648 7:4571010-4571032 ATATATACACACACACATAAAGG - Intergenic
1020521612 7:9195505-9195527 ACATATACACAGAGGCAAACAGG + Intergenic
1020557299 7:9686444-9686466 ATACATACACATATACATCATGG - Intergenic
1020624644 7:10562250-10562272 ACATATACACAGATACACATAGG - Intergenic
1021103289 7:16608168-16608190 ACATATACATAGATGCCCAAAGG - Intronic
1021344004 7:19500388-19500410 ATATATACACATGTACATATAGG - Intergenic
1021345489 7:19522310-19522332 ATATATACACACATATATATAGG - Intergenic
1021624583 7:22580175-22580197 ATATTTAAACAGATGTTTAATGG - Intronic
1021626432 7:22597830-22597852 ATAAACACACAAATGCAAAAAGG - Intronic
1022319278 7:29273318-29273340 ATATATATATATATGCATGATGG - Intronic
1022483870 7:30762660-30762682 ATATATATATAGATATATAAAGG - Intronic
1023867764 7:44246595-44246617 ATGTATACACACATGCACACAGG + Intronic
1024451354 7:49547518-49547540 TTATATGCACAGATACATACAGG - Intergenic
1024560693 7:50642500-50642522 ATATATATACACATACATATAGG + Intronic
1025740858 7:64194306-64194328 ATATATACACATATATATGAAGG - Intronic
1026727900 7:72884732-72884754 ATATATACACACACGTATATAGG - Intronic
1027115940 7:75481055-75481077 ATATATACACATACGTATATAGG + Intronic
1027980452 7:85213612-85213634 ATTTCTTCACAGATGGATAAAGG + Intergenic
1028027180 7:85858944-85858966 ATAAATACACTGTTGCATGATGG - Intergenic
1028264086 7:88701852-88701874 ATATATACACACATACACAATGG - Intergenic
1028485632 7:91354530-91354552 ACATATACACTGATGTATAGGGG - Intergenic
1028514517 7:91661626-91661648 ATATATACACAGAAGTGAAATGG + Intergenic
1028864276 7:95689780-95689802 ATATTGACACACATGCAAAATGG + Intergenic
1029290272 7:99497047-99497069 ATATATACACATATATATATAGG - Intronic
1029421420 7:100473747-100473769 ATATATATATATATACATAAAGG - Intronic
1030503674 7:110392067-110392089 ATATATACACACACACATATGGG - Intergenic
1030522376 7:110614087-110614109 ATATATATACATATACACAATGG + Intergenic
1031536467 7:122939715-122939737 ATATATACACACACACATATAGG + Intergenic
1031678163 7:124636649-124636671 ATATACACACACATACATACAGG - Intergenic
1031780615 7:125958097-125958119 ATATATACACATATATATATAGG - Intergenic
1032797563 7:135289906-135289928 ATTTATACACATATACATAGTGG - Intergenic
1033369258 7:140694296-140694318 ATAAATACATACATACATAAAGG + Intronic
1033622097 7:143070712-143070734 ATATATATGCACATACATAAAGG + Intergenic
1033891759 7:146021491-146021513 ATATATACACACACACATAAAGG + Intergenic
1034043351 7:147902293-147902315 AAATATAAACATAAGCATAAAGG - Intronic
1034693564 7:153034209-153034231 AAATATACACAAATTCATCATGG + Intergenic
1036054993 8:5241855-5241877 ATGAATAGACAGATACATAATGG + Intergenic
1036074811 8:5484794-5484816 AGATATACATATATGCATATGGG + Intergenic
1036349950 8:8003446-8003468 ATATATATATATATGCACAATGG - Intergenic
1036739786 8:11349355-11349377 ATATATACATATATGCATGCAGG + Intergenic
1036836835 8:12077985-12078007 AGATATCAACATATGCATAATGG + Intergenic
1036845220 8:12163973-12163995 ATATATATATATATGCACAATGG - Intergenic
1036858627 8:12324231-12324253 AGATATCAACATATGCATAATGG + Intergenic
1036866589 8:12406296-12406318 ATATATATATATATGCACAATGG - Intergenic
1037037887 8:14190346-14190368 ATACATACATACATACATAATGG - Intronic
1037100771 8:15042690-15042712 ATATTTAGACATGTGCATAAAGG - Intronic
1037204604 8:16300585-16300607 ATATACACACACATGAATAAAGG + Intronic
1037221934 8:16534186-16534208 ATATTTACACAGATGAATCGGGG - Intronic
1038261128 8:25995682-25995704 ATATGTAAAAAGATGTATAAGGG + Intronic
1038923027 8:32106839-32106861 ATATTTACAGAGATGAATAAAGG - Intronic
1039174566 8:34788678-34788700 ATATATATACATATGTACAATGG - Intergenic
1039270157 8:35871244-35871266 ATACAAATACAGATGCCTAATGG - Intergenic
1039603356 8:38860703-38860725 ATGTATACATAGATGAAAAATGG + Intergenic
1039605815 8:38879585-38879607 ATATATACACATATATATATGGG + Intergenic
1039635777 8:39163128-39163150 ATATATACACAGTTTAATAATGG + Intronic
1039673480 8:39632161-39632183 ATGTATACATAAATGCAAAACGG - Intronic
1039872228 8:41556170-41556192 ATATATACACACATATAAAATGG - Intergenic
1040395713 8:46998299-46998321 ATATATACATATATGGATATAGG - Intergenic
1041123761 8:54613585-54613607 ATATTTATACAGATAGATAAGGG + Intergenic
1041279685 8:56197726-56197748 AGACAGACACAGATGCATGAGGG - Intronic
1041819704 8:62017175-62017197 ATATATACATACATATATAATGG + Intergenic
1042260990 8:66859005-66859027 ATAAACACACAAATTCATAAAGG + Intronic
1042493032 8:69423210-69423232 ATATATACACACATGTAGAGGGG - Intergenic
1042525962 8:69765212-69765234 ATATATACACACACACACAATGG + Intronic
1042573169 8:70189437-70189459 AGAGATACACAGATGAAAAATGG - Intronic
1042991670 8:74647139-74647161 ATATATGCATATATGCAGAAAGG - Intronic
1043110914 8:76180238-76180260 ATATATACATATATACATAGTGG - Intergenic
1043141165 8:76592049-76592071 ATTAAAACACAGAGGCATAAGGG - Intergenic
1043240679 8:77930512-77930534 ATCTATACTCAGAGACATAAAGG + Intergenic
1043242161 8:77947801-77947823 ATACATATACATATACATAATGG - Intergenic
1044180003 8:89179974-89179996 ATATATACACAAACACACAATGG + Intergenic
1044216861 8:89622591-89622613 ATATATACACACATGCACACAGG - Intergenic
1044474614 8:92611775-92611797 ATCTGTAGAGAGATGCATAATGG - Intergenic
1045032683 8:98152822-98152844 AAATATATAAAGATGCATACAGG - Intronic
1045065295 8:98438659-98438681 ATAGATACACACATGCACACCGG - Intronic
1045582194 8:103494134-103494156 CAATGGACACAGATGCATAATGG - Intergenic
1045725355 8:105166705-105166727 GTATATACATACATGCATACAGG - Intronic
1046112536 8:109743213-109743235 ACATATACATAGAGGCATAATGG + Intergenic
1046214802 8:111129903-111129925 ATATAGCTACAGATGCAAAATGG - Intergenic
1046331295 8:112718523-112718545 ATATATATATATATGCATAAAGG + Intronic
1046648573 8:116812271-116812293 ATATATACACACTAGTATAAGGG + Intronic
1046733608 8:117752188-117752210 ACATTTACACAGCTGCATAGTGG + Intergenic
1047033017 8:120904117-120904139 GAGTATACACAGATGAATAAGGG + Intergenic
1047383711 8:124388590-124388612 AGACATACAGAGAGGCATAATGG - Intergenic
1047544927 8:125806461-125806483 ATATACATACAGAAGCAAAATGG + Intergenic
1048607569 8:135985485-135985507 ATATATACACAAATATATATAGG - Intergenic
1050045422 9:1539212-1539234 ATACACACACAGATATATAATGG + Intergenic
1050119238 9:2291282-2291304 ATATATCCACAGAGGGAAAAGGG - Intergenic
1050842163 9:10164734-10164756 ATATATACACACATACATCCAGG + Intronic
1051111434 9:13641924-13641946 ATATATACACACATATATAATGG + Intergenic
1051206780 9:14696345-14696367 ATATATACACACACACATACAGG + Intergenic
1051486486 9:17614241-17614263 ACAAATACACATATGCACAATGG - Intronic
1051718881 9:20014512-20014534 ATATATACACACACACACAATGG + Intergenic
1052011059 9:23409772-23409794 AAATATAAACAGATACATATTGG + Intergenic
1052018394 9:23497097-23497119 AAATAAACACATATACATAATGG + Intergenic
1052158019 9:25218996-25219018 AGATATGCACATAGGCATAAGGG + Intergenic
1052197638 9:25736838-25736860 ATATATACACATATGCATGCAGG - Intergenic
1052369003 9:27643611-27643633 ATATATACACATATGTATATGGG - Intergenic
1052371503 9:27670367-27670389 TTATATACACAGCTTAATAATGG + Intergenic
1052439080 9:28470029-28470051 CTATATATACATATACATAAAGG - Intronic
1052540283 9:29802779-29802801 ATAGATACACATATCTATAAAGG + Intergenic
1052593836 9:30533184-30533206 ATACATATACACATGTATAAAGG - Intergenic
1052617421 9:30858641-30858663 ACATATACATAGATGGATAACGG - Intergenic
1052636176 9:31107611-31107633 ATAAATACACATATGTAAAATGG - Intergenic
1052962479 9:34311627-34311649 ATATATACACATATGTAAAATGG - Intronic
1053127406 9:35593682-35593704 AGATATACCCAGGTGCATAGAGG + Intergenic
1053646846 9:40126239-40126261 ATATACACACATATGTATATAGG - Intergenic
1053646847 9:40126266-40126288 ATATACACACATATGTATATAGG - Intergenic
1053646848 9:40126293-40126315 ATATACACACATATGTATATAGG - Intergenic
1053646849 9:40126320-40126342 ATATACACACATATGTATATAGG - Intergenic
1053646850 9:40126347-40126369 ATATACACACATATGTATATAGG - Intergenic
1053646851 9:40126374-40126396 ATATACACACATATGTATATAGG - Intergenic
1053646852 9:40126401-40126423 ATATACACACATATGTATATAGG - Intergenic
1053646853 9:40126428-40126450 ATATACACACATATGTATATAGG - Intergenic
1053646854 9:40126455-40126477 ATATACACACATATGTATATAGG - Intergenic
1053646855 9:40126482-40126504 ATATACACACATATGTATATAGG - Intergenic
1054771935 9:69091291-69091313 ATATAAACACAGGTCCATCAAGG - Intronic
1055019843 9:71658016-71658038 ATACATACATACATACATAAAGG - Intergenic
1055207800 9:73753307-73753329 ATATATACACACACACACAATGG + Intergenic
1055465951 9:76566377-76566399 GTATATACATACATGCGTAAAGG + Intergenic
1056936761 9:90920472-90920494 ATACACACACAGACCCATAAAGG - Intergenic
1058129759 9:101238106-101238128 ATATATACACACACGTATATAGG - Intronic
1058245448 9:102618483-102618505 ATATACACACACACGCATATAGG - Intergenic
1058403952 9:104650369-104650391 ATATACACAGAGATGGAGAATGG + Intergenic
1058487471 9:105456908-105456930 AGATAAACAGAGATGAATAAAGG - Intronic
1058687464 9:107490571-107490593 AGATTTACTCAGAGGCATAAGGG + Intergenic
1059025854 9:110628530-110628552 ATATATACACATAAGCAAACAGG + Intergenic
1059469318 9:114492564-114492586 ATGCATACACAGATGCACACAGG + Intronic
1059642478 9:116231077-116231099 ATATATATATAGATATATAACGG + Intronic
1059980344 9:119764771-119764793 ATATATACAAAGATGCTCTAAGG + Intergenic
1060510165 9:124225982-124226004 ATGTATACACATATGCATGCAGG - Intergenic
1060607443 9:124928524-124928546 ATATTTACAAAGATGCCAAAAGG + Intronic
1062195930 9:135274095-135274117 ATATATACACCCATGAATAAAGG + Intergenic
1185544132 X:928315-928337 ATACATAGACAGATAGATAATGG - Intergenic
1185744609 X:2562410-2562432 ATATATATATACATACATAAAGG + Intergenic
1185775025 X:2795436-2795458 ATATATACATATATAAATAAAGG - Intronic
1185831497 X:3307349-3307371 ATAGATACACAGATAGATAAAGG - Intergenic
1185918221 X:4059854-4059876 ATATATGGATAGATGGATAAGGG - Intergenic
1185925792 X:4144267-4144289 ACATATACACAGAAACATACAGG - Intergenic
1185958693 X:4521730-4521752 ATAGATACATAGATGGATCATGG + Intergenic
1185959371 X:4531246-4531268 ATATATACACATATACACATAGG + Intergenic
1186064901 X:5752906-5752928 ATCTATACACAGATACAAACAGG + Intergenic
1186310732 X:8315709-8315731 ATATATACACACATATATATAGG - Intergenic
1186326085 X:8478150-8478172 AAATATACCCAGGTGAATAATGG - Intergenic
1186635846 X:11403966-11403988 AAAAAGACACAGATGCAGAAAGG + Intronic
1187899442 X:24013607-24013629 CTACATACACAAATGCATACTGG + Intronic
1187983580 X:24786063-24786085 ATGTATACACACATACAAAATGG - Intronic
1188453400 X:30334300-30334322 ATCTATACACACATACATACTGG + Intergenic
1188549753 X:31350085-31350107 TTATATACACAAAAGCATGAGGG + Intronic
1188706771 X:33343316-33343338 ATATATACACACACACACAACGG + Intergenic
1188713294 X:33429069-33429091 ACATATACACAAATGCAAAGTGG + Intergenic
1188746631 X:33852473-33852495 ATATATACACATACATATAAAGG + Intergenic
1188917033 X:35924583-35924605 ATATATACACACGTGCATGTGGG + Intronic
1189564156 X:42222471-42222493 ATATATATATATATGCACAATGG - Intergenic
1189762968 X:44341787-44341809 ATATACAGAAAGATGCACAATGG - Intronic
1189764723 X:44358785-44358807 ATATATATACATATATATAATGG + Intergenic
1190100844 X:47521868-47521890 ATATATACTCAGAAGTAAAATGG - Intergenic
1190578510 X:51867315-51867337 ATATATACACATAAAAATAAAGG + Intronic
1190616157 X:52234758-52234780 ATATATATACACACACATAATGG - Intergenic
1190659325 X:52640207-52640229 ATATATATAAATATACATAAAGG + Intergenic
1190996364 X:55614282-55614304 ATATATATACACATATATAAAGG - Intergenic
1193079905 X:77396245-77396267 ATAGATATACACATGCATGATGG - Intergenic
1193370208 X:80687085-80687107 ATATATACACACATACAGATAGG - Intronic
1193503044 X:82304038-82304060 ATATATACACACATACACATTGG + Intergenic
1193550867 X:82891155-82891177 ATATATATACATATACACAATGG + Intergenic
1193660545 X:84252020-84252042 ATATATACATATATATATAATGG + Intergenic
1194133308 X:90108180-90108202 ATATATAGACAGAGAGATAAAGG - Intergenic
1194295617 X:92122952-92122974 ATAAATACATACATACATAAAGG + Intronic
1195349412 X:103982731-103982753 ATATATAAAAAGATACATCATGG + Intergenic
1195358031 X:104056108-104056130 ATATATAAAAAGATACATCATGG - Intergenic
1196145359 X:112310361-112310383 ATATATATATATATGTATAAAGG - Intergenic
1196188422 X:112769833-112769855 ATATATATATATATGCAGAATGG + Intergenic
1196318639 X:114261744-114261766 ATATATATACACATACAAAAGGG + Intergenic
1196478513 X:116117157-116117179 ATATATACACATATATATGATGG + Intergenic
1196500691 X:116377828-116377850 AAATGTAAACAGATGCTTAATGG - Intergenic
1196675564 X:118417121-118417143 AAAGATACAGAGATGCAGAATGG - Intronic
1197328553 X:125124637-125124659 AAATATATACATATGCATCATGG - Intergenic
1197477040 X:126938838-126938860 ATATATATATATATGTATAAAGG + Intergenic
1197599630 X:128513118-128513140 ATATATACACATATATATGATGG + Intergenic
1198202405 X:134435061-134435083 ATATATATACAGACACATACCGG + Intergenic
1198202633 X:134437056-134437078 ATATGTACACAAATGCATTTTGG - Intergenic
1198424243 X:136498668-136498690 ATATATATACAAATACAGAATGG - Intronic
1198559386 X:137832263-137832285 ATATATACACACACACATCATGG - Intergenic
1198790955 X:140345388-140345410 ATATATACACATATATATATGGG + Intergenic
1199926215 X:152467360-152467382 ATATACACACACATATATAATGG + Intergenic
1199965885 X:152820573-152820595 ATATATACATATATGAATACTGG - Intergenic
1200245203 X:154519968-154519990 ATATTTACACAAATAAATAAAGG + Intergenic
1200366523 X:155671557-155671579 ATATATACATACATACAAAATGG - Intergenic
1201295282 Y:12457034-12457056 GTATATACACATATACATGAAGG + Intergenic
1201295289 Y:12457331-12457353 ATGTATGCATAGATACATAAAGG + Intergenic
1201668350 Y:16486148-16486170 ATACATAGATAGATGCATGATGG - Intergenic
1201747923 Y:17400140-17400162 ATATATACACACACACACAAAGG - Intergenic