ID: 1155918161

View in Genome Browser
Species Human (GRCh38)
Location 18:31576247-31576269
Sequence GCCCCATGGCACCACAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155918156_1155918161 -1 Left 1155918156 18:31576225-31576247 CCCATCTCAGGAACTGGCTTCAG No data
Right 1155918161 18:31576247-31576269 GCCCCATGGCACCACAGGGATGG No data
1155918157_1155918161 -2 Left 1155918157 18:31576226-31576248 CCATCTCAGGAACTGGCTTCAGC No data
Right 1155918161 18:31576247-31576269 GCCCCATGGCACCACAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155918161 Original CRISPR GCCCCATGGCACCACAGGGA TGG Intergenic
No off target data available for this crispr