ID: 1155918380

View in Genome Browser
Species Human (GRCh38)
Location 18:31578150-31578172
Sequence GAAAATGAACAAATGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155918373_1155918380 9 Left 1155918373 18:31578118-31578140 CCCAGTCTCAGGTATGTCTTTAT 0: 2779
1: 6067
2: 10377
3: 11010
4: 9585
Right 1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG No data
1155918371_1155918380 30 Left 1155918371 18:31578097-31578119 CCTCTTTTACTTTACAAATTACC No data
Right 1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG No data
1155918374_1155918380 8 Left 1155918374 18:31578119-31578141 CCAGTCTCAGGTATGTCTTTATC 0: 1651
1: 4048
2: 7021
3: 9867
4: 10371
Right 1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155918380 Original CRISPR GAAAATGAACAAATGCAGGT GGG Intergenic
No off target data available for this crispr