ID: 1155919624

View in Genome Browser
Species Human (GRCh38)
Location 18:31590336-31590358
Sequence CAGGAGAGGACTCCGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155919624_1155919630 0 Left 1155919624 18:31590336-31590358 CCACCTCCCGGAGTCCTCTCCTG No data
Right 1155919630 18:31590359-31590381 CACATTCTCATGTTCCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155919624 Original CRISPR CAGGAGAGGACTCCGGGAGG TGG (reversed) Intergenic
No off target data available for this crispr