ID: 1155923557

View in Genome Browser
Species Human (GRCh38)
Location 18:31629976-31629998
Sequence CCTCCTTCCTTTTTTTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 995
Summary {0: 1, 1: 0, 2: 5, 3: 99, 4: 890}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155923557_1155923565 14 Left 1155923557 18:31629976-31629998 CCAGCAAAAAAAAAGGAAGGAGG 0: 1
1: 0
2: 5
3: 99
4: 890
Right 1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG 0: 1
1: 0
2: 20
3: 285
4: 2100
1155923557_1155923567 22 Left 1155923557 18:31629976-31629998 CCAGCAAAAAAAAAGGAAGGAGG 0: 1
1: 0
2: 5
3: 99
4: 890
Right 1155923567 18:31630021-31630043 GGAGAAGCAGGAAGGAAGGAAGG 0: 2
1: 10
2: 277
3: 3257
4: 18810
1155923557_1155923562 -5 Left 1155923557 18:31629976-31629998 CCAGCAAAAAAAAAGGAAGGAGG 0: 1
1: 0
2: 5
3: 99
4: 890
Right 1155923562 18:31629994-31630016 GGAGGAGGAGAAGGATGAGGTGG 0: 7
1: 347
2: 3210
3: 8162
4: 16416
1155923557_1155923564 10 Left 1155923557 18:31629976-31629998 CCAGCAAAAAAAAAGGAAGGAGG 0: 1
1: 0
2: 5
3: 99
4: 890
Right 1155923564 18:31630009-31630031 TGAGGTGGAGAAGGAGAAGCAGG 0: 1
1: 0
2: 14
3: 275
4: 2439
1155923557_1155923566 18 Left 1155923557 18:31629976-31629998 CCAGCAAAAAAAAAGGAAGGAGG 0: 1
1: 0
2: 5
3: 99
4: 890
Right 1155923566 18:31630017-31630039 AGAAGGAGAAGCAGGAAGGAAGG 0: 1
1: 6
2: 89
3: 1121
4: 7424
1155923557_1155923561 -8 Left 1155923557 18:31629976-31629998 CCAGCAAAAAAAAAGGAAGGAGG 0: 1
1: 0
2: 5
3: 99
4: 890
Right 1155923561 18:31629991-31630013 GAAGGAGGAGGAGAAGGATGAGG 0: 4
1: 115
2: 1131
3: 6318
4: 14355
1155923557_1155923563 1 Left 1155923557 18:31629976-31629998 CCAGCAAAAAAAAAGGAAGGAGG 0: 1
1: 0
2: 5
3: 99
4: 890
Right 1155923563 18:31630000-31630022 GGAGAAGGATGAGGTGGAGAAGG 0: 1
1: 0
2: 159
3: 1230
4: 7515
1155923557_1155923568 28 Left 1155923557 18:31629976-31629998 CCAGCAAAAAAAAAGGAAGGAGG 0: 1
1: 0
2: 5
3: 99
4: 890
Right 1155923568 18:31630027-31630049 GCAGGAAGGAAGGAAGGAAGAGG 0: 6
1: 327
2: 810
3: 1832
4: 5129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155923557 Original CRISPR CCTCCTTCCTTTTTTTTTGC TGG (reversed) Intronic
900157704 1:1210097-1210119 CTTTCTTTTTTTTTTTTTGCCGG - Intergenic
900250511 1:1666278-1666300 CCTCGTCCCTTCTTTTTTGAGGG + Intronic
900490024 1:2943277-2943299 CAACCTTACTTTTTTTTTCCTGG + Intergenic
900920326 1:5666116-5666138 CTTCTTTTCTTTTTTTTTGTGGG + Intergenic
901091724 1:6646101-6646123 CCTCCTGCTTTTTTTTTTACTGG - Intronic
901376940 1:8846237-8846259 CTTTCTTTCTTTTTTTTTCCTGG - Intergenic
901543894 1:9941200-9941222 CCTCTTTCTTTTTTTTTTGATGG + Intronic
901688993 1:10960409-10960431 CTTCCTTTCTTTTTTTTTCTTGG - Intronic
901826585 1:11865853-11865875 CCTCTTTTTTTTTTTTTTTCTGG + Intergenic
902767447 1:18626819-18626841 CCTCCTCCCTTTTTTCTTCCTGG - Intergenic
902822140 1:18949930-18949952 CCTGCTTCCTTTTCTTTTCTGGG + Intronic
902998214 1:20244270-20244292 CCACCTTCTTTTTTTCTTGTTGG + Intergenic
903303310 1:22394159-22394181 CTTCCTTCCTTTTCTTTTATGGG - Intergenic
903517863 1:23924509-23924531 CTTTCTTTCTTTTTTTTTGGTGG + Intergenic
904558887 1:31383703-31383725 CCACCTTCCTTTCTTTTCCCAGG - Intergenic
905255925 1:36684477-36684499 TCTTCTTCTTTTTTTTTTGATGG + Intergenic
905957888 1:42014360-42014382 CCTCCTTCCTTGCTGTGTGCTGG - Intronic
906116796 1:43362562-43362584 CCTCCTCCCTTTTTTTTCAATGG - Intronic
907095572 1:51776970-51776992 CTTTCTGCCTTTTATTTTGCAGG + Intronic
907632130 1:56093133-56093155 TTTCATTCCTTTTTTTTTCCTGG - Intergenic
907652931 1:56312820-56312842 CATCCTTCCTCTCTTTTTTCAGG - Intergenic
907872035 1:58452232-58452254 CCTGCATCCTTTTTTTTTAAAGG + Intronic
908713796 1:67048403-67048425 CCTCCTACCTTTCTTTTTAGAGG - Intronic
909017686 1:70397486-70397508 CTTCCTTTTTTTTTTTTTGGTGG - Intergenic
909031346 1:70544996-70545018 CTTTCTTCCATTTTTTTTGAAGG - Intergenic
909609769 1:77539811-77539833 CCTCCTCCCTGTTGTTTTACTGG + Intronic
909709203 1:78625063-78625085 TTTCCTTCCTTTTTTTTTTTTGG + Intronic
910047801 1:82938879-82938901 CCACCTGCCTTTTTTATTTCTGG + Intergenic
910338175 1:86156521-86156543 CCTCCTTTTTTTCTTGTTGCGGG - Exonic
910360071 1:86407053-86407075 TCTCCTTCCTGCTTTCTTGCTGG - Intergenic
910396389 1:86798496-86798518 CTTCCTTCCTTTTTTTTTTTTGG - Intergenic
910783765 1:90971415-90971437 CTTTCTTTCTTTTTTTTTGGTGG + Intronic
910964213 1:92791744-92791766 CATCCTTTTTTTTTTTTTGGTGG - Intronic
911885109 1:103288218-103288240 TCTCCTTGCTTTTTTTTCACAGG + Intergenic
911929708 1:103886332-103886354 CTTCCATCCCTTTATTTTGCTGG - Intergenic
911953229 1:104203851-104203873 CCCCCTTGCTTTTTTTTTCCAGG + Intergenic
912389102 1:109289483-109289505 CCTTCTTTTTTTTTTTTTCCTGG - Intergenic
912427489 1:109607450-109607472 CCTCTTGCCTTTTTTTTTTTTGG - Exonic
912862486 1:113226350-113226372 CCTCCTTCGTTTTCTTTTCCTGG + Intergenic
913083172 1:115409005-115409027 CCTCTTTCATTTTTTTTACCTGG - Intergenic
913616880 1:120569448-120569470 TCCCCTTGCTTTTTTTTTTCTGG + Intergenic
914226494 1:145723572-145723594 CCTGTTTCCTTTTTTTATGGGGG + Intronic
914863385 1:151405188-151405210 GTTCCTTCCATTTTTTATGCAGG + Exonic
914945900 1:152065930-152065952 ACTCCTTTTTTTTTTTTTCCTGG + Intergenic
915176210 1:154017280-154017302 CCCCCTTTTTTTTTTTTTGTTGG - Intronic
915666703 1:157451599-157451621 CTTTCTTCCCTTTTTTTTGGTGG - Intergenic
916071087 1:161170332-161170354 TCTCCTTCCCATTTTTTTGGGGG - Intronic
916196594 1:162229502-162229524 CATCCTTTATTTTTATTTGCTGG + Intronic
916308310 1:163364706-163364728 CATCCTTTTTTTTTTTTTCCTGG + Intergenic
916623968 1:166533715-166533737 TTTCTTTCCTTTTTTTTTGATGG + Intergenic
916670178 1:167010364-167010386 CCTCCTTCATGTTTTTTTGGGGG + Intronic
916709260 1:167388041-167388063 CTTTCTTCCTTTTATTTTTCAGG - Intronic
916811603 1:168310293-168310315 CATCCTTTTTTTTTTTTTGGAGG - Intronic
916899958 1:169210875-169210897 CTTCCTTCCCCTTTGTTTGCAGG + Intronic
917051899 1:170933491-170933513 CTTTCTTTCTTTTTTTTTGAAGG - Intergenic
917647721 1:177045463-177045485 CCCTCTTCCTTCTTTTCTGCTGG + Intronic
918037838 1:180893095-180893117 CCCCCTTCCTTCTTTTTTCAAGG - Intergenic
918808522 1:189083392-189083414 CCTCCCTTCTTTTTTTCTGTGGG - Intergenic
919146094 1:193637126-193637148 CTTCTTTCATTTTTTTTTTCTGG + Intergenic
919312047 1:195923303-195923325 CCTGATTCCTCTTTCTTTGCTGG - Intergenic
920005498 1:202830548-202830570 CCTCCTTTTTTTTTTTTTTTTGG + Intergenic
920215208 1:204358051-204358073 CCCACCTGCTTTTTTTTTGCTGG - Intronic
921008861 1:211121406-211121428 CCTCATTGCTTGTTTTTTTCAGG - Intronic
921068111 1:211637180-211637202 ACTGCCTCCTTTTTTTGTGCAGG - Intergenic
921409357 1:214818532-214818554 CCTCCCTCCTTTTTTCTTTTTGG + Intergenic
921746464 1:218745844-218745866 CTTCCTGCCTTTTTTTGTGAAGG - Intergenic
921783170 1:219193041-219193063 TTTCCTTTCTTTTTTTTTGGGGG + Intronic
921934536 1:220785067-220785089 CCTCCTCCATTTTCCTTTGCTGG + Intergenic
922600547 1:226848474-226848496 CCTCTTTTTTTTTTTTTTGCTGG - Intergenic
922809874 1:228409411-228409433 CCTCCGTCCCTGTCTTTTGCAGG - Exonic
923892116 1:238227526-238227548 CCTTCTTTCTTTCTTTTTGTTGG + Intergenic
1063051446 10:2453728-2453750 CCTGCTTTTTTTTTTTTTTCCGG - Intergenic
1063618146 10:7620187-7620209 CCTTCTATTTTTTTTTTTGCGGG - Intronic
1063674164 10:8125129-8125151 CCTCCTCCCTTTGTTTCTGTTGG - Intergenic
1063916291 10:10886170-10886192 CTTCCTTCCTCTCTTTTTGTAGG + Intergenic
1063930154 10:11019587-11019609 CCCCCCTCCTTTTTTTTGGTGGG - Intronic
1064848469 10:19683131-19683153 CTTCTTTCTTTTTTTTTTTCCGG - Intronic
1065098183 10:22303576-22303598 CCTCTTTCCTCTTTTATTTCTGG - Intergenic
1065168903 10:23008910-23008932 CCTCCATCCTTTTTCTTTGGTGG - Exonic
1065187356 10:23181328-23181350 CGTCCTTTCCTTTTTCTTGCTGG + Intergenic
1065598880 10:27348358-27348380 CTTTCTTCTTTTTTTTTTTCTGG + Intergenic
1065689779 10:28321173-28321195 CCTAATTTCTATTTTTTTGCAGG - Intronic
1065699781 10:28413846-28413868 CCTCCTTTCTTTTATTCTACAGG - Intergenic
1065804915 10:29385333-29385355 ATTTCTCCCTTTTTTTTTGCTGG - Intergenic
1066325558 10:34354522-34354544 CCTCTTTGATTTTCTTTTGCTGG - Intronic
1066493627 10:35919118-35919140 CTTCCTGCCTTATTTTTTCCTGG + Intergenic
1066799095 10:39164049-39164071 CTTCCTTCCTGTTTTTTTCCTGG - Intergenic
1067202997 10:44190531-44190553 CCTCCATTCTTTTTTTTTTTTGG - Intergenic
1067647815 10:48126290-48126312 CCTCTTTTTTTTTTTTTTCCAGG - Intergenic
1067690923 10:48501739-48501761 CCACCTTCTTTTTTTTTTTTTGG - Intronic
1067977433 10:51042023-51042045 CCTCCTCCATTTTACTTTGCTGG - Intronic
1068266357 10:54655203-54655225 CCTCCCTTCCTTTTTTTTGACGG - Intronic
1068534459 10:58225988-58226010 ATTCCTTCCTTCTTTTTTGTGGG - Intronic
1068581357 10:58743553-58743575 TCTCCTTGCTTTATTTCTGCTGG - Intronic
1068599326 10:58939020-58939042 CCTCCTGTCTCTTCTTTTGCTGG - Intergenic
1069355481 10:67580320-67580342 CCTCCTTTCTTGTTTTTGTCAGG + Intronic
1070183267 10:74035252-74035274 CTTTCTTTTTTTTTTTTTGCTGG + Intronic
1070479177 10:76864945-76864967 CCTCCTTCTTTTTTGTTTGCTGG + Intergenic
1070533008 10:77353953-77353975 CATCCTGCCTCTTTTTTTGGGGG + Intronic
1071142784 10:82530679-82530701 AGTCTTTCCTTTATTTTTGCAGG - Intronic
1071401347 10:85275667-85275689 CCCCATTGCTTTTTTTTTTCAGG + Intergenic
1071410689 10:85390663-85390685 CATCCTTACCTTTTTTTTTCTGG - Intergenic
1071613902 10:87056965-87056987 CCTCCTTTCTTTTTTTTGGCGGG + Intronic
1071757884 10:88565669-88565691 CTTCTTTCCTTTTTTTTTAGTGG - Intronic
1071848042 10:89540022-89540044 CTTCCTTCCTTTCTTTTCTCTGG + Intronic
1072351809 10:94564610-94564632 CATTCTTCCTTTTTTTTTCTTGG + Intronic
1072526505 10:96276497-96276519 CCTCCTTTCCTTTCTTGTGCTGG + Intergenic
1073401047 10:103258033-103258055 CCACTTTCCTTCTTTTTTTCTGG + Intergenic
1073538834 10:104301551-104301573 CCTCCTTCCCTCTTTTCTCCAGG - Intronic
1073548455 10:104374296-104374318 CTTTCTTTCTTTTTTTTTTCTGG - Intronic
1073804913 10:107087275-107087297 AATCCTTCTTTTTTTTTTCCTGG + Intronic
1074169848 10:110920542-110920564 CTTCCTTCCTTTCTTTAAGCAGG + Intronic
1074205212 10:111277190-111277212 CTTTTTTCTTTTTTTTTTGCAGG - Intergenic
1074546053 10:114403509-114403531 CCTCTTGCCTTCTCTTTTGCTGG - Intronic
1074693511 10:116028011-116028033 CCTCCTTCCAATTTTCTTTCAGG - Intergenic
1075160636 10:120021776-120021798 TCTCCTTACTTTTTTTTAGGGGG + Intergenic
1076005104 10:126942550-126942572 GCTCCTTCCTTCTGATTTGCAGG + Intronic
1076244204 10:128933438-128933460 TCTTTTTCCTTTATTTTTGCTGG + Intergenic
1076826326 10:132971417-132971439 CCTCCCTCCTTTTCTTTTTTTGG + Intergenic
1076845416 10:133066992-133067014 CAGCCTTCCTCTTTTTTTGAAGG - Intergenic
1078072345 11:8124061-8124083 CTTTCTTTCTTTTTTTTTTCAGG - Intronic
1078398294 11:11001305-11001327 CCTGCTTCCTTCCTTTCTGCAGG + Intergenic
1078973123 11:16438379-16438401 CCTCTTTTCATTTATTTTGCTGG + Intronic
1079039128 11:17045791-17045813 CTTTCTTTCTTTTTTTTTGATGG - Intergenic
1079181162 11:18194723-18194745 TTTCCTTCCTTTTCTTTTCCTGG + Intronic
1079393650 11:20043387-20043409 GCTCTTTCCTTCTTTTTTCCTGG + Intronic
1080156486 11:29117706-29117728 CTTCCTTCCTTATTTTTGACAGG - Intergenic
1080156609 11:29118672-29118694 CTTCCTTCCTTCTTTTTGACAGG - Intergenic
1080513242 11:32996281-32996303 CCTCCTTGCTTGTTTTTGTCAGG + Intergenic
1080864624 11:36182380-36182402 CTACCTTTCTTTTTTTTTGCGGG - Intronic
1081082622 11:38761934-38761956 CCTCATTGCTTGTTTTTTTCAGG + Intergenic
1081532868 11:43975782-43975804 CATCCTTTCTTTTTTATGGCAGG - Intergenic
1081595433 11:44455716-44455738 CTTTCTTTCTTTTTTTTTGATGG + Intergenic
1082127380 11:48449074-48449096 CCTCATTCCTTGTTTTTGTCAGG + Intergenic
1082138264 11:48575930-48575952 CCTCATTCCTTGTTTTTGTCAGG - Intergenic
1082576714 11:54815171-54815193 CTTCCTTCCAGTTTTTATGCTGG + Intergenic
1082585955 11:54940560-54940582 CATCCTTCCAGTTTTTTTCCTGG + Intergenic
1082589118 11:54983369-54983391 CTTCCTTCACGTTTTTTTGCTGG - Intergenic
1082594189 11:55054475-55054497 CTTCCTTCCAGTTTTTATGCTGG + Intergenic
1082958354 11:58895856-58895878 CCTCTTTTTTTTTTTTTTGAAGG + Intronic
1083227307 11:61293445-61293467 CTCCCTTCCTCTTCTTTTGCTGG - Intronic
1083536822 11:63477232-63477254 CCTCTTTCCTGTTTCTTTGCAGG + Intronic
1083640570 11:64143104-64143126 CTTCTTTCCTTTTTTTTGACAGG - Intronic
1083649442 11:64192885-64192907 CCTGCTTATTTTTTCTTTGCTGG + Intronic
1084164005 11:67366752-67366774 CCTCCTCCCTTTTCTTTCCCTGG + Intronic
1084392337 11:68885791-68885813 CCCCCTGCCTTTTTTTTTGTCGG + Intergenic
1085332078 11:75660967-75660989 CCTTCTCGCTTTTTTTTTTCAGG - Intronic
1085478073 11:76800161-76800183 CTTCGTTCTTTTTTTTTTCCAGG - Intergenic
1085505943 11:77059163-77059185 TTTCTTTTCTTTTTTTTTGCGGG - Intergenic
1086456439 11:86963346-86963368 CCTCATTGCTTTTTTTTGTCAGG + Intergenic
1086825256 11:91488671-91488693 CCTCCTGAATTTTTTTTTTCAGG + Intergenic
1086850420 11:91801052-91801074 CCTTTTTCCTTTCTTTTGGCTGG + Intergenic
1087039952 11:93788905-93788927 CTTCCTTCCCTTTTTTTTTAAGG + Intronic
1087434924 11:98102577-98102599 CCTTTTTTCTTTTTTTTTTCAGG - Intergenic
1087435981 11:98118082-98118104 CCTCATTGCTTCTTTTTGGCAGG + Intergenic
1087666411 11:101053822-101053844 CCTCCTTCCTTTCTCTGTGTGGG + Intronic
1087687903 11:101286132-101286154 CCTCCTTATTTTTTTTGTGGGGG + Intergenic
1087772196 11:102222858-102222880 CCTACTTCTTTTTTTTTGGCGGG + Intronic
1088123742 11:106398774-106398796 CTTCCTTCCTTTCTTTTAGGAGG + Intergenic
1088205038 11:107382837-107382859 TCTCCTACCTTTTTTATTGTGGG + Intronic
1088421080 11:109647717-109647739 CATCTGTCCTTTTTTTTTTCTGG - Intergenic
1088780268 11:113127475-113127497 CTTCATTCCTTTCTTTTTACAGG - Intronic
1089049527 11:115534158-115534180 ATTGATTCCTTTTTTTTTGCGGG - Intergenic
1089310399 11:117554701-117554723 CCTGCCTCCTTTTTTCCTGCTGG + Intronic
1089336751 11:117730191-117730213 CCTCCCTCTTTTTTTTTAGATGG - Intronic
1089417679 11:118306180-118306202 CCTCCTTCTTCTTTTTTTTAAGG - Intronic
1089429452 11:118410352-118410374 TCTCCTACCTTGTTTTTTTCTGG - Intronic
1089445215 11:118546482-118546504 CTTCCTTCCTTTTTTTTTACAGG - Intronic
1089589661 11:119532325-119532347 CCTGCTTCATTTTTTTCTGTGGG - Intergenic
1089627615 11:119761622-119761644 CTTCCTTTCTTTGTTTTTGATGG + Intergenic
1089786847 11:120913726-120913748 CCTCATTCCATTTTTTCTCCTGG + Intronic
1089870670 11:121670204-121670226 CCACCTTCCTTCTTCTTTCCGGG + Intergenic
1090209000 11:124902960-124902982 CCTCCCTCCTTTCTTTTTTCAGG + Intergenic
1090315196 11:125780163-125780185 ACTCCTTCCATTTTATTTTCTGG - Intergenic
1090319908 11:125833242-125833264 CCTCCCTCCTTTCTATTTACTGG + Intergenic
1090555086 11:127865604-127865626 CATACTTCCTTTTTTATTCCTGG - Intergenic
1090931255 11:131299968-131299990 CCTGCTCTCTTTTTTTATGCTGG - Intergenic
1091432586 12:449128-449150 TCACCTGCCTTTTTTTCTGCTGG - Intergenic
1091620786 12:2087127-2087149 CCTCATTTCTCTTTTCTTGCTGG + Intronic
1091774664 12:3176641-3176663 CTTCCTTCCTTTTCCTTTGGTGG + Intronic
1092043928 12:5411915-5411937 CCCACCCCCTTTTTTTTTGCTGG + Intergenic
1092321149 12:7476463-7476485 CCTCATTGCTTGTTTTTGGCAGG - Intronic
1092490821 12:8943352-8943374 CTTCCTTCCTTTTGTTTTTAAGG - Intronic
1093120733 12:15268063-15268085 CCTCCTTTTTTTTTTTTTAATGG + Intronic
1093123802 12:15304560-15304582 ACTCCTGCCATTTTTTTTTCTGG + Intronic
1093472056 12:19512663-19512685 CCCCCTCTTTTTTTTTTTGCTGG + Intronic
1093545865 12:20346904-20346926 CCTCATTTTTTTTTTTTTTCTGG + Intergenic
1093584913 12:20823064-20823086 CCTCCTATTTTTTTCTTTGCAGG - Intronic
1094237503 12:28185610-28185632 CCTCCTTCCTTTTAATCTACTGG - Intronic
1094861692 12:34474811-34474833 CTTCCTTCTGTTTTTTTTTCTGG + Intergenic
1095208259 12:39462906-39462928 CTTCCTTCCTTTTTTTTATAAGG - Intergenic
1095470319 12:42529949-42529971 CTTCCTTTTTTTTTTTTTGGTGG + Intronic
1095693889 12:45121847-45121869 TCTCCATCCTTTTTTTTCTCTGG + Intergenic
1096022784 12:48336318-48336340 CCTCCTTCCCTTTTTGGTGATGG + Intergenic
1096481783 12:51946776-51946798 CCTTCTGTCTTCTTTTTTGCTGG + Intergenic
1096655747 12:53090594-53090616 CCCCCATCCTTTTGTTTTGTGGG + Intergenic
1097252212 12:57641804-57641826 CCTCCTTTTTTTTCTTTTGCTGG - Intergenic
1097287354 12:57888433-57888455 CTTCTTTCCTATTTTTTTCCAGG + Intergenic
1097502474 12:60422250-60422272 CTTTCTTCCTTTTTTTTTTGTGG + Intergenic
1097583937 12:61492671-61492693 CCTCCTTCCTTTATTTTATAAGG - Intergenic
1097825247 12:64168737-64168759 CCTCATTTCTTTTTTTTTTTTGG - Intergenic
1097988362 12:65808082-65808104 CTTCTTTCCTTTTTTATTGCTGG + Intergenic
1098100231 12:67007481-67007503 CCTCATTCTTTGTTTTTTGGGGG - Intergenic
1098174143 12:67773350-67773372 TCACCTCCCTTTTGTTTTGCAGG + Intergenic
1098357237 12:69623221-69623243 CCTCCTTCCATTTGTCATGCTGG - Intergenic
1098397277 12:70032785-70032807 CCTCCTTAATCTTTTTTTGAAGG - Intergenic
1098617343 12:72544580-72544602 CTTCCTTTCTTCTTTTTTTCTGG + Intronic
1098968708 12:76824842-76824864 CCCCCTTTCTTTTTTTTTTTTGG - Intronic
1099279359 12:80624195-80624217 CCTCCTTCCTTAGTCTTGGCAGG - Intronic
1100432397 12:94542327-94542349 CCTCCTGCCTCTTTTTTGTCAGG - Intergenic
1100972324 12:100083686-100083708 ACTACTTTTTTTTTTTTTGCTGG - Intronic
1101192430 12:102348861-102348883 TCTTCTTCTTTTTTTTTTTCAGG + Intergenic
1102120442 12:110436556-110436578 CCATCTTCCTGTTTGTTTGCAGG + Exonic
1102182814 12:110924966-110924988 CTTCCATCCTTTTTTTTTGGGGG + Intergenic
1102630344 12:114273010-114273032 CCTCATTCCTTCTTTGTTGGAGG - Intergenic
1102697868 12:114814260-114814282 CTTTCTTTCTTTTTTTTTTCAGG + Intergenic
1103055872 12:117819843-117819865 CTTCCCTTCTTTTTTTTTGGAGG - Intronic
1103066790 12:117905505-117905527 CCTCCTTTCATTGTCTTTGCTGG - Intronic
1103309954 12:119997810-119997832 CCTCCTTACTTTTTTTAAGGAGG - Intronic
1103334279 12:120177555-120177577 CCTTATTCCTTTTTCTTTGTAGG - Exonic
1103533265 12:121617331-121617353 CTTCCTTCTTTTTTTTTCACAGG - Intergenic
1103666669 12:122572394-122572416 CCTTTTTTCTTTTTTTTTGGGGG - Intronic
1103768380 12:123299885-123299907 CCTCCTTCTTTTCTTTTCACAGG - Intronic
1104203001 12:126609997-126610019 CCTTCTCCTTTTTTTTTGGCGGG - Intergenic
1104455907 12:128911965-128911987 GCTCCTTTCTTCTTTTTTTCTGG + Intronic
1105392682 13:19995677-19995699 CCCCCCACCTTTTTTTTTGAAGG + Intronic
1105683040 13:22749180-22749202 GCTCCTTCCTTTTATCTTCCTGG - Intergenic
1106161649 13:27206430-27206452 CCTCATTCCTTTTTTATTCTGGG - Intergenic
1106171498 13:27292607-27292629 CCTCCTTCTTGTTTGTTTGCAGG - Intergenic
1106324140 13:28671627-28671649 CCCACTTCCTTTTTTTTTTTAGG + Intronic
1106372711 13:29152069-29152091 CCTCCTTGATTTTTTTTGGGGGG + Intronic
1106559515 13:30836328-30836350 CCTCCTTCCGTTCTCTTTGCAGG - Intergenic
1106633301 13:31500174-31500196 CCTCCTTTCTTTTTTCTTTCTGG - Intergenic
1106934619 13:34704529-34704551 CCACCTCCATTTTTTTTTGAAGG - Intergenic
1107166770 13:37291386-37291408 CCTTCTTCCTTTCATTTTGGCGG + Intergenic
1107328974 13:39276343-39276365 CCTCTTTTCTTCATTTTTGCGGG + Intergenic
1107365676 13:39671403-39671425 TTTTCTTCCTTTTTTTTTGTGGG + Intronic
1107472482 13:40703578-40703600 CCTCCTCCCTTTGGCTTTGCTGG - Intergenic
1107750637 13:43561961-43561983 CTTCCTTCCTTTTTTTTGACAGG - Intronic
1107780183 13:43892181-43892203 CATCCTTACTTTTTTTTTTTTGG - Exonic
1107839658 13:44443020-44443042 TCTCCTTTTTTTTTTTTTTCAGG - Intronic
1108043720 13:46363213-46363235 CCTCCTTCCTTTCTTTGTCTAGG - Exonic
1108047437 13:46396542-46396564 CCTCCTTCCATTTTTTTCAAAGG - Intronic
1108633994 13:52314515-52314537 GCTCTGTTCTTTTTTTTTGCAGG + Intergenic
1108833148 13:54504570-54504592 CCTCCTACATTTTTTTTTCTGGG + Intergenic
1109180639 13:59210309-59210331 CTTCCTTCCTTTTTTTGAGACGG - Intergenic
1109298299 13:60562327-60562349 TTTCTTTTCTTTTTTTTTGCCGG - Intronic
1109846905 13:68005279-68005301 CCTCCTTACTATTTGTTTGGTGG + Intergenic
1110015807 13:70400441-70400463 CCTACTCCCTTTTTTTTTCAGGG - Intergenic
1110136447 13:72073366-72073388 CCTTCTTCCTTATTTTTGCCAGG - Intergenic
1110253958 13:73410825-73410847 CATCCTTCCTCTTTTTTTATTGG + Intergenic
1110721834 13:78770104-78770126 TCTCCCTCATTTTTTTTTGGCGG - Intergenic
1111388025 13:87554798-87554820 TCTCCCTCCTTTTGTTTTTCTGG + Intergenic
1111477022 13:88762732-88762754 CCTCCTTTTTTTTTTTTTTAAGG - Intergenic
1111547569 13:89762412-89762434 CCTCCATCTTTTTCTTTTGCCGG + Intergenic
1111799315 13:92962078-92962100 TTTCCTTTTTTTTTTTTTGCGGG + Intergenic
1111861959 13:93718848-93718870 CCTCATTCCTTGTTTTTGTCAGG + Intronic
1112013098 13:95308371-95308393 CATTCTTTCTTTTTTTTTGAAGG - Intergenic
1113001607 13:105644896-105644918 CTTCCTTCCTTTTTTCTTTCAGG + Intergenic
1113176323 13:107568279-107568301 CCTTGTTCCCTTTTTATTGCTGG + Intronic
1113382443 13:109816419-109816441 TCTCCTTCGTTTTTCTTTGAGGG + Intergenic
1113851189 13:113419110-113419132 CTTTCTTTCTTTTTTTTTTCAGG + Intergenic
1114751634 14:25210559-25210581 CCTCCTTTTTTTTTTTTTAATGG + Intergenic
1115156570 14:30346647-30346669 CTCCCTTCCTTTATTTTTTCAGG - Intergenic
1115569163 14:34650783-34650805 CCTTCTTTCTTTTTTTTTCCTGG + Intergenic
1115796108 14:36937349-36937371 CCTCCTTGCTTTGTTTGTGAAGG - Intronic
1115824265 14:37248958-37248980 CATCCTTCCATTTGTTTTTCAGG - Intronic
1116233211 14:42244875-42244897 TCTTCTTCCTTTTTTTTTTTTGG + Intergenic
1116315748 14:43389961-43389983 CATTCTTCTTTTTTTTTTTCAGG + Intergenic
1116512547 14:45764792-45764814 TCTCTTTTCTTTTTTTTTTCTGG + Intergenic
1117162433 14:53002403-53002425 TCTCCTTTGTTTTTCTTTGCAGG - Intergenic
1117406528 14:55409559-55409581 CCTCCTTTGTTTTTTTTTTTAGG - Intronic
1117595156 14:57319836-57319858 CCTCCTTTCTTTTTTCTTCCTGG - Intergenic
1117611329 14:57486033-57486055 TCTCCTTCCCCTTTTCTTGCAGG - Intronic
1117882625 14:60327371-60327393 CCTCCCGCCTTTGTGTTTGCTGG - Intergenic
1118397867 14:65353046-65353068 CATCCTTTTTTTTTTTTTCCAGG - Intergenic
1119101261 14:71881885-71881907 CTTCCTTCCTTTATTTTTATTGG + Intergenic
1119124014 14:72107402-72107424 ATTCCTTCCTTTTTTATTACAGG + Intronic
1120321347 14:82965551-82965573 CCTCCTTGCTTGTTTTTGTCAGG + Intergenic
1120596386 14:86442451-86442473 CCTCCATCTTTTTCTCTTGCTGG - Intergenic
1120653555 14:87162537-87162559 TCTTCTTCCTTTTCTTTTTCTGG - Intergenic
1120747086 14:88162137-88162159 CCTCCTCCCTTTTTTTTATTAGG - Intergenic
1120992140 14:90386548-90386570 TGTCCTTCCTTTTTTTTTGGTGG + Intergenic
1121656296 14:95598388-95598410 TCTCTTTCCTTTTTTAATGCGGG + Intergenic
1122193137 14:100063853-100063875 ACTTCTTCCTTTGTTTTTCCTGG - Intronic
1122578496 14:102756544-102756566 CTTCCTTCCTTTCTTTCTTCCGG + Intergenic
1123712416 15:22998455-22998477 CTTTCTTTCTTTTTTTTTGTTGG + Intronic
1123802128 15:23832318-23832340 CATCCTACCTTTTTTTTTTTTGG + Intergenic
1123814695 15:23965022-23965044 CCTCCTTTTTTTTTTTTTTTGGG + Intergenic
1123849389 15:24339613-24339635 CTTCCTTCCTTTTTTTTGTGTGG + Intergenic
1123880181 15:24671414-24671436 CCTCCTCCCTTTTATTCTTCAGG - Intergenic
1123900633 15:24873165-24873187 CCCTGTTGCTTTTTTTTTGCGGG - Intronic
1124070305 15:26386159-26386181 CTTCCTTCCTTTTTCTTTCTTGG + Intergenic
1124478287 15:30056039-30056061 AATTCTTCCTTTTTTTTTTCTGG - Intergenic
1124581666 15:30961236-30961258 ACTCCTTTTTTTTTTTTTGACGG + Intronic
1124597040 15:31100082-31100104 CCTTCTTTTTTTTTTTTTGATGG + Intronic
1124714215 15:32044276-32044298 CTTCCTTCCTTCTTTTTTTGGGG + Intronic
1124912784 15:33938826-33938848 CTTTCTTCCTTTTTTTTTGTGGG + Intronic
1124961227 15:34397125-34397147 TCTTCTTCTTTTTTTTTTGGTGG + Intronic
1124977857 15:34543349-34543371 TCTTCTTCTTTTTTTTTTGGTGG + Intronic
1125096043 15:35853103-35853125 CTTTCTTCCTTTTTTTTGGGGGG - Intergenic
1125235476 15:37508006-37508028 CTTCATTTCTTTCTTTTTGCCGG + Intergenic
1125808736 15:42518017-42518039 CTTCTTTCTTTTTTTTTTTCTGG + Intronic
1125848164 15:42878047-42878069 TGTACTTCCTTTTTTTTTCCCGG + Intronic
1126170295 15:45690078-45690100 CCTCCTTTTTTTTTTTTTTTTGG + Intronic
1127195432 15:56579864-56579886 TTTCCTTTCTTTTTTTTTTCGGG - Intergenic
1127464750 15:59233107-59233129 CTTTCTATCTTTTTTTTTGCTGG + Intronic
1127588880 15:60402858-60402880 CCTCCATCCTGTTTTCCTGCTGG + Intronic
1128269889 15:66299590-66299612 CCTCCTCCCTTCTTTTTTCCAGG - Intronic
1128367498 15:67014837-67014859 CCTCTTCTTTTTTTTTTTGCGGG + Intergenic
1128713274 15:69887893-69887915 CCTCCTTCCTTTTCTCCTGCTGG - Intergenic
1128805934 15:70531364-70531386 CCTCCCTCCTTTCTTTTTGGAGG - Intergenic
1128972536 15:72119750-72119772 CCTCCATCTTTTTTTTCTGGGGG - Intronic
1129078535 15:73019369-73019391 CCTCTTGCCTTTTTGTTTTCTGG - Intergenic
1129142357 15:73611580-73611602 CCTCCTTCCTTCTTATCTCCTGG - Intronic
1129417356 15:75393380-75393402 CTTTCTTTCTTTTTTTTGGCAGG + Intronic
1129442412 15:75591276-75591298 CCACCTTTCTTTCTTTTGGCAGG - Intergenic
1129615757 15:77097886-77097908 CCTCCATGTTTTTTTTTTGTGGG + Intergenic
1129920413 15:79314850-79314872 CCTCCTTCCCTTTCATATGCAGG + Intronic
1130616167 15:85410147-85410169 TCTCCTTCCTTTCTTTTTCATGG + Intronic
1130673525 15:85933088-85933110 ACACCTTCTTTTTTTTTTGCGGG + Intergenic
1130673649 15:85934086-85934108 CTTCCTTCCAGTTTTTTTGGGGG + Intergenic
1131494967 15:92900222-92900244 TCTCCTTTTTTTTTTTTTGGTGG + Exonic
1131666932 15:94580623-94580645 CCTCCTTCCTTTACTTTCCCTGG - Intergenic
1131689299 15:94809356-94809378 CCTCCTCCCTCTTTTTCTTCAGG - Intergenic
1131835281 15:96384131-96384153 CTTCCTTCCTTTTTTTTTCGGGG + Intergenic
1132200925 15:99954280-99954302 CCTCCTTCCTGCTTTCTTTCAGG + Intergenic
1132238255 15:100238005-100238027 CGTCTTTGCTTCTTTTTTGCAGG - Intronic
1133532204 16:6665625-6665647 CCTTCTTCTTTTTTTTTTTTTGG - Intronic
1133794351 16:9033882-9033904 CTTTCTTCCTTTTTTTTTGACGG + Intergenic
1134132038 16:11656607-11656629 CTTTCTTTCTTTTTTTTTGGAGG + Intergenic
1134253011 16:12587909-12587931 CCTCCTGCCTTTTTTCTGGGGGG + Intergenic
1134361466 16:13534705-13534727 TCTCCTTCAGTCTTTTTTGCTGG + Intergenic
1134793199 16:17009837-17009859 CCTCTTTCCTGCTTTTTTACTGG - Intergenic
1135090175 16:19507958-19507980 CCTTCTTCCTTGTTTGCTGCTGG - Intronic
1135171797 16:20190805-20190827 CCACCTACTTTTTTTTTTTCTGG + Intergenic
1135574548 16:23575242-23575264 TCCCCTGCCTTTTTTTTTGGCGG - Intergenic
1135588091 16:23686448-23686470 CCTCCTGCCTTTTTTGTTACCGG + Intronic
1135797970 16:25463742-25463764 ACTCATTCTTTTTTTTTTGATGG - Intergenic
1135963989 16:27020969-27020991 TCTCTTTTCTTTTTTTTTGACGG - Intergenic
1136270101 16:29143377-29143399 CCTCTTTCCTTTTTTGTGACAGG - Intergenic
1136506479 16:30707387-30707409 CTTCCTTCCTTTTCCTTTTCAGG + Intronic
1136738393 16:32486389-32486411 CTTCCTTCCTGTTTTTTTTCTGG - Intergenic
1138654563 16:58483363-58483385 CCTTCTTCTTTTTTTTTTAAAGG - Intronic
1138726130 16:59141208-59141230 CTTCCTTCCTTTCTTTTTGATGG + Intergenic
1138748747 16:59394030-59394052 CTTCTTTCTTTTTTTTTTGATGG + Intergenic
1138872090 16:60902628-60902650 GTTTCTTCCTTTTTTTTTGATGG - Intergenic
1138938109 16:61755807-61755829 TCTCCTTCTTCTTTTTTTGGTGG + Intronic
1139011453 16:62639633-62639655 CTTTTTTTCTTTTTTTTTGCAGG + Intergenic
1139726948 16:68907987-68908009 CCTCCTTCATTTCATTTTGCAGG + Intronic
1140196305 16:72858409-72858431 CCCCCCTCTTTTTGTTTTGCCGG - Intronic
1140749479 16:78010236-78010258 CCTCTTACATTTTTTTTTCCTGG + Intergenic
1141204260 16:81921176-81921198 CTTTCTTTCTTTTTTTTTCCAGG + Exonic
1142073694 16:88105215-88105237 CCTCTTTCCTTTTTTGTGACAGG - Intronic
1203029639 16_KI270728v1_random:564650-564672 CTTCCTTCTATTTTTTTTCCTGG - Intergenic
1203042082 16_KI270728v1_random:769781-769803 CTTCCTTCTATTTTTTTTCCTGG + Intergenic
1143616630 17:8055228-8055250 CCTTCTTTCTTTTTTTTGGGGGG + Intergenic
1144096097 17:11901998-11902020 ACTTCTTCCTTTTCTTGTGCTGG - Intronic
1144425675 17:15139190-15139212 CCTCCTTCCTTCTTGTTTGGGGG + Intergenic
1145104702 17:20105455-20105477 CCTCCTTCCTGTGTGATTGCAGG + Intronic
1145202017 17:20953980-20954002 GCTCCTTCTTTTTTTTTAGACGG - Intergenic
1145376289 17:22351935-22351957 CTTTCTTTCTTTTTTTTTGGGGG + Intergenic
1146252992 17:31366361-31366383 CCTTCTTCCATTTTTATTTCTGG + Intronic
1146383675 17:32350251-32350273 TCTCCTCCCTTTTACTTTGCCGG + Exonic
1146695130 17:34903102-34903124 CCTCCCTCCTCATTTTATGCTGG - Intergenic
1146966349 17:37034358-37034380 CCTCCTTTGTTTTTTTTTAGTGG + Intronic
1147654227 17:42079673-42079695 CCTTCTTTCTTTTTTTTGGGGGG - Intergenic
1147854128 17:43465876-43465898 CCTTCTTCTTCTTTTTTTGATGG + Intergenic
1147964817 17:44188913-44188935 ACTCCTTTTTTTTTTTTTTCAGG + Intronic
1148665337 17:49370612-49370634 TTTCCTTCCTTTTTTTTGGGGGG - Intergenic
1148752708 17:49954680-49954702 CTTTCTTTCTTTTTTTTTGGAGG + Intergenic
1149419070 17:56490930-56490952 CTTCCTTGCTTTTTTTTCTCTGG - Intronic
1149490528 17:57081858-57081880 CCTCATTCCTTTTTTCTGGCAGG + Intergenic
1149982571 17:61322982-61323004 GCGCCTTCCTTTTTTTTTAAAGG + Intronic
1150066640 17:62115592-62115614 CTTTCTTTCTTTTTTTTTGTGGG - Intergenic
1150067996 17:62127650-62127672 CCTTCCCCCTTTTTTTCTGCCGG + Intergenic
1150462358 17:65363251-65363273 CTTTATTCCTTTTTTTTTTCAGG + Intergenic
1150581128 17:66474986-66475008 CCTCCACCCTTTGTTTCTGCAGG + Intronic
1150621121 17:66808319-66808341 CCTGTTTTTTTTTTTTTTGCTGG + Exonic
1150807532 17:68330959-68330981 CTTTATTTCTTTTTTTTTGCGGG + Intronic
1151013671 17:70530878-70530900 TATCCTTGCTTTTTTTTTGAAGG + Intergenic
1151287575 17:73124041-73124063 CTTCCTTCCTGTTTTTATGAGGG + Intergenic
1151360059 17:73583486-73583508 CCTCCTTTCTCTTTATTTGGTGG - Intronic
1151483724 17:74385641-74385663 CCTTCTTCTTCTTTTTTTTCAGG - Intergenic
1151519929 17:74620635-74620657 CTTCCTTTTTTTTTTTTGGCCGG - Intronic
1153327238 18:3833237-3833259 CCTCCTTGTTTTTTTTTGACAGG + Intronic
1153911770 18:9710913-9710935 CTTCCTTTTTTTTTTTTTGAGGG + Intronic
1154052596 18:10975054-10975076 ACTCCTTCCTTTCTTGTTCCAGG - Intronic
1154377556 18:13822631-13822653 CATCCTTTGTTCTTTTTTGCTGG + Intergenic
1155923557 18:31629976-31629998 CCTCCTTCCTTTTTTTTTGCTGG - Intronic
1155951213 18:31915456-31915478 CCCCCCCCCTTTTTTTTTGATGG - Intronic
1156139582 18:34090650-34090672 CCTCCCCCCCTTTTTTTTTCTGG - Intronic
1156215000 18:34989123-34989145 CCTCCTTCCTTTTTTGGTTTGGG - Intronic
1156617041 18:38799448-38799470 CCCCCTTCCTTTTCTTTTTTGGG + Intergenic
1156739257 18:40304079-40304101 CCTTTTTTCTTTATTTTTGCTGG + Intergenic
1157368827 18:47091394-47091416 TCTCCTTTCTTTTGTTTTTCTGG - Intronic
1157438912 18:47695348-47695370 TCTTCTTCTTTTTTTTTTGTTGG + Intergenic
1157979927 18:52367932-52367954 CCTGCTTCCTTTTTGTTTGGAGG + Intronic
1158081585 18:53598808-53598830 CCCCCTTTTTTTTTTTTGGCAGG + Intergenic
1158197145 18:54900763-54900785 CTTCCTTTCTTATTTTTTGGTGG - Intergenic
1158795328 18:60838931-60838953 GCTCCTTCCTTCCTTTTTGCTGG + Intergenic
1159180958 18:64903578-64903600 CTTCCTTTTTTTTTTTTTGGAGG - Intergenic
1159516055 18:69459104-69459126 CTTCCTTCCTTTTTTTTGGGGGG - Intronic
1159604183 18:70457951-70457973 CCTCCTTCCTTCTGAGTTGCAGG - Intergenic
1159830576 18:73273256-73273278 TCTCCTTTCTTTTTTTTGACGGG - Intergenic
1160032138 18:75271379-75271401 CCTTCTTCCATCTTTTTAGCTGG + Intronic
1160320127 18:77883196-77883218 CCTCATTGCTTATTTTTTGTCGG + Intergenic
1160354616 18:78216433-78216455 CCTCCTTCCTTTTTCTTTCTAGG + Intergenic
1160357796 18:78243332-78243354 CTTCCTTTCTTTATTTTTGAGGG - Intergenic
1160935241 19:1591694-1591716 CCTCTTTTTTTTTTTTTTCCTGG - Intronic
1161003266 19:1921815-1921837 CCTTCCTCTTTTTTTTTTTCTGG - Intronic
1161148878 19:2696150-2696172 TCTCTTTTCTTTTTTTTTGACGG - Intronic
1161915911 19:7227972-7227994 TCCCCTCCCTTTTTTTTTTCTGG - Intronic
1161994215 19:7702579-7702601 CCTCTTCCCTTTTTTCTTGCTGG - Intergenic
1162541371 19:11298432-11298454 CCTATTTTTTTTTTTTTTGCGGG + Intronic
1162826981 19:13258930-13258952 TCTTCTTCTTTTTTTTTTTCAGG + Intronic
1162873712 19:13604870-13604892 CTTCCTTCCTTCCTTTTTGACGG - Intronic
1163412790 19:17166831-17166853 CCTCATTCCTTTTTTATGGCTGG + Intronic
1164712923 19:30371639-30371661 CCTCCCTGCTGTATTTTTGCAGG + Intronic
1165051799 19:33146525-33146547 CCTTCTTTCCTTTTTTTTGATGG + Intronic
1165315512 19:35053022-35053044 CCACCTCGCTTTTTTTTTCCTGG + Intronic
1165467248 19:35982303-35982325 CTTCCTTGCTCTTTTTTTGGAGG - Intergenic
1165796762 19:38524152-38524174 CTTCTTTCCTTTTTTTTTTCTGG + Intronic
1166752593 19:45171637-45171659 CCTCCCTCCTGTTTTTCTTCTGG - Intronic
1166816246 19:45547997-45548019 ACTCTTTCCTTCTTTATTGCCGG + Intronic
1166870449 19:45867274-45867296 CCTCATCCCTTTTCTTTTTCTGG + Intronic
1167688367 19:50970070-50970092 CTTTCTTTCTTTTTTTTTGACGG + Intergenic
1167691191 19:50984302-50984324 CTTCCTTTCTTTTTTTTGGATGG + Intergenic
1168350387 19:55672334-55672356 CCCCCCTCCTTTTTCTTTGCTGG + Intronic
1168411072 19:56140877-56140899 CCTCCTCCCTCTTTTTTTCCCGG + Intronic
1168710116 19:58494726-58494748 CCTCCTCCCTTTGTTTCTGTTGG + Intronic
925227487 2:2198075-2198097 TTTCCTTCTTTTTTTATTGCTGG - Intronic
925850479 2:8076677-8076699 CCTGCTTCCTTTTTGTTTAAAGG + Intergenic
926338259 2:11881070-11881092 CCTGTTTTTTTTTTTTTTGCAGG + Intergenic
926611467 2:14952314-14952336 CCTCCTGTCTTTTTTCTTTCTGG + Intergenic
927185975 2:20482794-20482816 CCTACTTCCTTTTCTTTTTAAGG + Intergenic
927798092 2:26069671-26069693 CCTTTTTTCTTTTTTTTTGGGGG - Intronic
927996004 2:27486945-27486967 CCTTCTTTTTTTTTTTTTGACGG + Intronic
928319270 2:30270213-30270235 CCTCCTTCCTTTTATCTTAAAGG + Intronic
928455463 2:31416678-31416700 GCTCCTTCCTTCTTTCTTTCAGG - Intergenic
928640027 2:33288550-33288572 CCAACTTCTTTTCTTTTTGCGGG - Intronic
929322234 2:40558164-40558186 CCTCCGTCTTATTTTTTTTCAGG + Intronic
929767359 2:44857039-44857061 CTTTCTTTCTTTTTTTTTGTGGG - Intergenic
929839155 2:45438676-45438698 TCTCCTTCTTTTTTTATTTCTGG - Intronic
929880623 2:45834090-45834112 CCTACTTCCTCTTTTTTAGCAGG - Intronic
930114654 2:47708155-47708177 CCTCTTGCCTTCTTTTTTCCTGG + Intronic
930190962 2:48459142-48459164 CCTCCTTACTTATTTTTTTTTGG + Intronic
930197359 2:48522872-48522894 CTTCTTTCTTTTTTTTTTTCTGG - Intergenic
930201203 2:48553489-48553511 CCTCTTTCCTTTTTTTGAGGTGG + Intronic
930328159 2:49946647-49946669 CCTCATTCCTTGTTTTTGTCAGG + Intronic
930378263 2:50595134-50595156 CCTCCTTACTATTTTATTCCAGG - Intronic
930418889 2:51124477-51124499 ACTCTTTCCCTTTTTTTTGGTGG - Intergenic
930558079 2:52924857-52924879 TCTCCTTCCTCTTATTTTCCAGG - Intergenic
930653565 2:53986339-53986361 CCTCTTTTTTTTTTTTTTGATGG + Intronic
930659435 2:54039286-54039308 TCTTTTTCCTTTTTTTTGGCGGG + Intronic
930814638 2:55581899-55581921 CCTTCTTCTTTTTTTTTTCTCGG - Intronic
930875538 2:56211398-56211420 CCTCCTGCATTTTTTTATTCTGG + Intronic
930890774 2:56384244-56384266 ACTCCTTCTTTTTTTTTTTAAGG + Exonic
931001573 2:57790289-57790311 CCTCCTCCCCTATTTTTTTCAGG + Intergenic
931025396 2:58108510-58108532 CTTTCTTTCTTTTTTTTTCCTGG + Intronic
931151411 2:59578229-59578251 CCTCCTTTCTTGTCTTTTGTTGG - Intergenic
931184633 2:59938160-59938182 CATCCACCCTTTTTATTTGCAGG + Intergenic
931256964 2:60582174-60582196 CCTCCTTCTACTTTTTCTGCTGG - Intergenic
931468465 2:62513610-62513632 CCACCCTCATTTTTTTTTTCTGG - Intergenic
931855756 2:66300225-66300247 CATCCTTCCTGTTTTTTCACCGG - Intergenic
931913152 2:66924250-66924272 CCTCCTCCCTTGTTTTATTCTGG + Intergenic
932555727 2:72823778-72823800 CATCCTTCTTTTTTTTTTTTGGG - Intronic
932772653 2:74509477-74509499 CTTCCTTGCTCTTTTTTTTCTGG + Intergenic
933177512 2:79192073-79192095 ATTCCTTCTTTTTTTTTTCCAGG + Intronic
933279823 2:80321241-80321263 CCAATTTCCTTTTTTTTTCCAGG - Intronic
934657631 2:96124271-96124293 CCTCCTGTCTTTTCTGTTGCAGG - Exonic
935141222 2:100354573-100354595 TGTCCTTATTTTTTTTTTGCGGG - Intergenic
935558175 2:104533518-104533540 CTTCCTTCCTTTCTTTTTGATGG + Intergenic
935835854 2:107052542-107052564 CCTCATTCCTTGTTTTTGTCAGG - Intergenic
935940159 2:108229533-108229555 AGTCCTTCTTTTTTTTTTTCTGG + Intergenic
936259072 2:110942875-110942897 CTGCCTTCCTTTTTTTTTCAGGG - Intronic
936261874 2:110966669-110966691 CCTCCTCCCCTATTTTTAGCAGG + Intronic
937736706 2:125299350-125299372 CCCCCCTTCTTTTTTTTTTCTGG - Intergenic
937827603 2:126383887-126383909 CCTCCTTCCTGCTTTTGTGTAGG - Intergenic
939014305 2:136884408-136884430 CCTCCTTCCTATTTTGCTGCAGG - Intronic
939206589 2:139113184-139113206 CCACATTCCATTTTTTTTCCTGG - Intergenic
939704966 2:145441481-145441503 CCTCATTTCTTGTTTTTGGCAGG - Intergenic
940159273 2:150693820-150693842 ACTCCTTACTGTTTTTTTCCTGG - Intergenic
940211352 2:151259136-151259158 CTTTCTTCCTTTTTTTTTTTGGG - Intronic
940443553 2:153748865-153748887 CTTTCTTTCTTTTTTTTTCCAGG - Intergenic
940628140 2:156202391-156202413 CATTCTTCCTTTTCTTTTTCTGG + Intergenic
940768211 2:157812415-157812437 CCTCCTTGCCTTTTTTTTAATGG - Intronic
940812026 2:158255292-158255314 CCGCCCCCCTTTTTTTTTCCTGG - Intronic
941862039 2:170292856-170292878 CCTCCCACCTTTGTCTTTGCAGG + Intronic
941973305 2:171375890-171375912 CTTCTTTCCTTTTATTTTGCAGG + Intronic
942413674 2:175736647-175736669 CCTTCTCCCCTTTTTTTTTCTGG - Intergenic
942428672 2:175885879-175885901 TCTTTTTCCTTTTTTTTTCCCGG - Intergenic
942688419 2:178559322-178559344 ACTCCTTCCTTTGTTTCAGCTGG + Exonic
942755188 2:179332321-179332343 CTTTCTTCCTTTTTTTTTTGTGG - Intergenic
942972589 2:181974970-181974992 ACTCCTTTCATTTATTTTGCAGG - Intronic
943055220 2:182968952-182968974 CCTCATTCCTTCTTCTTTTCTGG - Intronic
943265419 2:185725686-185725708 CTTTCTTCCTTTTTTTGTGGGGG - Intergenic
943607166 2:189989276-189989298 TTTTTTTCCTTTTTTTTTGCGGG - Intronic
943729755 2:191289570-191289592 CCTGCTTCCTTATTTTCTTCAGG - Intronic
943766509 2:191668428-191668450 CCTTCTTCCTCTTTTCTTTCTGG + Intergenic
944134152 2:196379894-196379916 CCTTTTTTTTTTTTTTTTGCTGG - Intronic
944599467 2:201288781-201288803 CATCTTTCCTTTCTTTTTACAGG - Exonic
944842319 2:203636029-203636051 TCTCCTCCCTTTTATTTTGTTGG - Intergenic
944846232 2:203670952-203670974 TCTACTTCCTCTCTTTTTGCAGG + Intergenic
945514494 2:210746519-210746541 TCTCCTTCCTTTCTTTTTATTGG + Intergenic
945562752 2:211358634-211358656 ACTCCTTTTTTTTTTTTTTCTGG - Intergenic
945626869 2:212219951-212219973 CCACTTTTTTTTTTTTTTGCGGG - Intronic
945697765 2:213129478-213129500 CCTCTTCCCTTTTTCTTTTCCGG - Intronic
945856258 2:215073091-215073113 CTTTCTTTCTTTTTTTTTGGAGG - Intronic
945956897 2:216094770-216094792 TGTCCTTCATTTTTTTTTCCTGG - Intronic
946151800 2:217778782-217778804 CGGCCTTCATTTTTGTTTGCCGG - Intergenic
946155681 2:217805134-217805156 CCACCTTCCCTTTTATTTTCTGG - Intronic
946753116 2:222913557-222913579 CCCCCCGCCTTTTTTTTAGCAGG + Intronic
946820608 2:223625369-223625391 CTTCTTTTCTTTTTTTTTGTGGG - Intergenic
946973416 2:225121013-225121035 CCTCTTTTTTTTTTTTTTGAAGG + Intergenic
947185671 2:227453204-227453226 CCTTCTTTTTTTTTTTTTCCAGG + Intergenic
947536063 2:230941116-230941138 CTTCTTTTCTTTTTTTTTTCTGG - Intronic
947668465 2:231922196-231922218 CTTTCTTTCTTTTTTTTTCCTGG - Exonic
947673858 2:231960570-231960592 CCTCTCTCTTTTTTTTTTTCTGG + Intergenic
947737169 2:232461675-232461697 CCTCCTTCTTTTTTTTGAGAGGG - Intergenic
947778892 2:232739372-232739394 ACCCTTTTCTTTTTTTTTGCGGG - Intronic
947802961 2:232943159-232943181 CTTCCTTCCTTTTTTTGTGGGGG + Intronic
948113343 2:235474548-235474570 CTTCCTTTCTTTCTTTTTGTCGG + Intergenic
948551633 2:238776465-238776487 CGTCCTTCCTCTTTCTATGCTGG - Intergenic
1169130257 20:3163146-3163168 CCTCCTCCAATTTTTATTGCTGG + Exonic
1169354149 20:4893795-4893817 CATCCTACCTTTCATTTTGCTGG + Intronic
1169506942 20:6221270-6221292 TTTTCTTCCTTTTTTTTTTCAGG - Intergenic
1169944386 20:10973291-10973313 CTTCATTCCATTTTTTTTTCTGG - Intergenic
1170304808 20:14926542-14926564 CTTCCTTTTTTTTTTTTTGACGG - Intronic
1170556427 20:17518661-17518683 CCTCCACCCTTTTCTGTTGCTGG - Intronic
1170639973 20:18143390-18143412 CCATTTTCCTTTTTTTCTGCTGG + Intronic
1171473134 20:25388073-25388095 CCTCTTCTCTTTTTTTTTGTAGG - Intronic
1172265715 20:33611520-33611542 TCTTCTTTCTTTTTTTTTGAGGG + Intronic
1172376845 20:34449739-34449761 GCCCATTCCTTTTTTATTGCTGG - Intronic
1172819946 20:37723519-37723541 CCTACTACCTTTTTTTCTGGAGG - Intronic
1173312653 20:41912989-41913011 TTTGCTTCCTTTTTTTTTTCGGG + Intergenic
1173786937 20:45800993-45801015 CCTACTTCCTTTTTTTTTTTTGG - Intronic
1174167478 20:48595402-48595424 CTTCCTTCCTTTTTTCTGGCTGG - Intergenic
1174498170 20:50964414-50964436 GCTGCTGCCTTTTTTTTTGTGGG + Intergenic
1174632473 20:51969736-51969758 TCTTTTTCTTTTTTTTTTGCGGG - Intergenic
1175978555 20:62725756-62725778 CCTCCCTCCTCTTGGTTTGCTGG - Intronic
1176786755 21:13265976-13265998 CCTCCTTCCTATGTCTTTGAAGG - Intergenic
1176893340 21:14345893-14345915 CTTCCTTCCTTTCTTTTAGATGG - Intergenic
1177705781 21:24702350-24702372 CTTCCTTTCTTTTTTTTAGATGG - Intergenic
1178018712 21:28383705-28383727 CCACCTTCCATGGTTTTTGCTGG - Intergenic
1178204266 21:30444708-30444730 TCTTCTTCTTTTTTTTTTTCTGG + Intergenic
1178365940 21:31988841-31988863 CCTCCTTCCTTTTTCTTTCTCGG + Intronic
1178636136 21:34305929-34305951 CCTCCTCCTTTTTTTTTTTTTGG + Intergenic
1178785452 21:35649260-35649282 CCTCCTGCCTTCTCTTTTCCTGG + Intronic
1178903010 21:36612851-36612873 CCTCCTTCCTGCTTTTATTCCGG + Intergenic
1179644378 21:42766745-42766767 CCTCCTTCCCTTGGTTTTTCAGG - Intronic
1182163660 22:28149902-28149924 CCTACTTACCATTTTTTTGCTGG - Intronic
1182513389 22:30836494-30836516 CCTCCTTCCTTTTCTTTGCCTGG + Intronic
1183354704 22:37351899-37351921 TCTCCTTCCTGTTCTGTTGCAGG + Intergenic
1183867995 22:40719436-40719458 TTTCTTTCTTTTTTTTTTGCTGG + Intergenic
1184063482 22:42100771-42100793 CCTCATTGCTTTTTTTTTTGAGG - Intergenic
1184547684 22:45182951-45182973 TCTCCCTCCTTTTTTTTTTGTGG - Intronic
1185109151 22:48891228-48891250 CCTCCTTCAGTTTTCTTTTCTGG + Intergenic
949302578 3:2601465-2601487 CCTCATTCCTTGTTTTTGTCAGG + Intronic
949417269 3:3828384-3828406 CTGCCTGCCTTTTTTTTTGCTGG + Intronic
949487969 3:4558826-4558848 CTTTTTTCTTTTTTTTTTGCTGG + Intronic
949672221 3:6412356-6412378 CCATCTTCCTTTTTTTTTCAAGG - Intergenic
949744775 3:7276791-7276813 CTTCCTTCCTTCCTTTTTGGTGG + Intronic
949933363 3:9097930-9097952 TTTCCTCCCTTTTTTTCTGCAGG + Intronic
949947632 3:9202880-9202902 CCTCCTTCCTTTCCTTTTGTGGG + Intronic
950822163 3:15772181-15772203 CATCCTTCTGCTTTTTTTGCTGG - Intronic
951033021 3:17903858-17903880 TATCCTTCCTTATTTTTTTCTGG + Intronic
951210127 3:19965735-19965757 CTTCCTTCCTTTATTTTTTGGGG + Intronic
952011624 3:28906449-28906471 CATCTTTCCTTTTTCCTTGCAGG + Intergenic
952184178 3:30950914-30950936 CCTATTTATTTTTTTTTTGCAGG - Intergenic
953097285 3:39790942-39790964 CTTGCTTCCTTTTATTTTCCAGG + Intergenic
953597291 3:44329482-44329504 CCTCCTTGCTTTTTCTTTCTTGG - Intronic
954062994 3:48084572-48084594 CCCCTTTTTTTTTTTTTTGCAGG + Intronic
954101158 3:48373626-48373648 GCTCCTTCCTTCTTTGATGCAGG - Exonic
954774877 3:53008065-53008087 CCGCCTTTTTTTTTTTTTGCGGG - Intronic
955807230 3:62749726-62749748 CCTCCCTCCTCTTTCCTTGCTGG - Intronic
955973838 3:64462200-64462222 CTTCTTTCTTTTTTTTTTGGGGG - Intergenic
956333117 3:68133131-68133153 CCTCCTTGCTTGTTTTTGTCAGG + Intronic
956610853 3:71121366-71121388 CCCCCCCCCTTTTTTTTTTCTGG - Intronic
956816804 3:72915337-72915359 CCTTTTTTTTTTTTTTTTGCGGG + Intronic
957665494 3:83219576-83219598 CCTCCCCCCTTTTTTTTTTTTGG + Intergenic
957697951 3:83667800-83667822 CATTTTTCCTTTTTTTTTTCTGG + Intergenic
957981448 3:87516423-87516445 ACTCCTTACTTTTTTTTTTTGGG - Intergenic
958478401 3:94615119-94615141 CTTTCTTCCTTTTTTTTTTTTGG + Intergenic
958818172 3:98941253-98941275 CCTCCTCCCTGTCTTTGTGCTGG + Intergenic
959164224 3:102757144-102757166 CCTGCTTCTTTTTTTTTTTCAGG + Intergenic
959825026 3:110783930-110783952 CCTGCATCCATTATTTTTGCTGG - Intergenic
960035401 3:113097489-113097511 TTTCCTTACTTTTTTTTTTCTGG + Intergenic
960085938 3:113591480-113591502 CGTTCTTCTTTTTTTTTTTCAGG - Intronic
960115532 3:113888493-113888515 CCTTCTTTCTTTTTTTGTACTGG - Intronic
960229952 3:115214064-115214086 CTTCCTTCCTTTTTTTTTTTTGG - Intergenic
960347341 3:116550149-116550171 CCTCTTTCTGTGTTTTTTGCTGG - Intronic
960387882 3:117043270-117043292 TCTGCTTCTTTTTTTTCTGCTGG - Intronic
960490483 3:118312014-118312036 TCTCCTTCCATGTCTTTTGCAGG - Intergenic
961219051 3:125185572-125185594 CCTCCTTCTCTATTTTTTGGAGG - Intronic
961425666 3:126845234-126845256 CCTCTTTGCTTCTTTCTTGCAGG + Intronic
962013710 3:131419661-131419683 CTTTCTTTCTTTTTTTTTGATGG + Intergenic
962598420 3:136970655-136970677 CTTCCTTCCTTTTTTTGAGATGG + Intronic
962668737 3:137683614-137683636 TTTCCTTCCTTTTTTTCTGATGG - Intergenic
962711165 3:138087237-138087259 CCAGCTTCCTATTTTTTTTCAGG - Intronic
963508214 3:146214421-146214443 CCCTCTTCCTTTTTTTTTAATGG + Intronic
963941716 3:151102309-151102331 CCTCCACCCTTTTTATTTTCAGG - Intronic
964443718 3:156739024-156739046 CCTCCTCCCATCTTCTTTGCAGG + Intergenic
964973417 3:162589016-162589038 CTTTCTTTCTTTTTTTTTGACGG + Intergenic
965032807 3:163395157-163395179 CCTCCTTGATTTTTTTTGGAAGG - Intergenic
966097319 3:176220006-176220028 GCTCCATCCATTTTTTTTGGAGG - Intergenic
966297255 3:178438794-178438816 TGTCATTCTTTTTTTTTTGCGGG - Intronic
966396523 3:179509650-179509672 CCTCTTTTTTTTTTTTTTTCTGG + Intergenic
966836455 3:184053069-184053091 CCTCCTTCCATTCTTCTTTCTGG - Exonic
966839783 3:184079094-184079116 TCTCCTACCCTTTTTTTTTCTGG + Intergenic
967132946 3:186489318-186489340 CCACATTCCTTTTTCTTTTCTGG - Intergenic
967134919 3:186504987-186505009 CCTCCTTCCTTTTTTGAGTCAGG + Intergenic
967346211 3:188458865-188458887 TTTCCTTCTTTTTTTTTTTCTGG + Intronic
967385163 3:188904016-188904038 CCTCCTGTCTTTCTTTTTCCAGG - Intergenic
967658684 3:192078857-192078879 CCTCCTTACTATTTTTTTAATGG + Intergenic
967699777 3:192578306-192578328 CCTTGTTCCTTTCTTTTTACTGG + Intronic
968822400 4:2864676-2864698 CTTCCTTCCTTTTTCTTGTCAGG + Intronic
969272545 4:6112718-6112740 CCACCTTGCTTTTTTCCTGCTGG + Exonic
969449787 4:7266406-7266428 CCTCCTCCCTTCTTTCTTTCAGG + Intronic
969451982 4:7279167-7279189 CCTCCTCCCTTTTTTGGTGGTGG + Intronic
970205995 4:13655950-13655972 CCTGCTTATTTTTTTTTTTCTGG - Intergenic
970373238 4:15430226-15430248 CCTCCATCCTATTTTTCTGTAGG - Intronic
970986193 4:22161517-22161539 CCTCATTCCTTATTTTTGTCAGG - Intergenic
971079175 4:23189007-23189029 CCTTCTTCCTTTTATTTTTTTGG + Intergenic
971195216 4:24466882-24466904 CCTCTTTTTTTTTTTTTTGCTGG - Intergenic
971256057 4:25014479-25014501 TCTCCTTCCTTTTTTTTGGCGGG - Intronic
971298100 4:25418257-25418279 ACTTCTTCCTTTATTTTTACAGG - Exonic
971934607 4:33131808-33131830 CCTGATTCTTTTTTTTTTGGGGG + Intergenic
972094269 4:35328747-35328769 GCTACTTCCTTTTGTTTTACTGG + Intergenic
972544498 4:40067352-40067374 CCTCCTTTTTTTTTTTTTTAAGG + Intronic
972761057 4:42104821-42104843 CCTTCTTCCTCTTCTTTTTCTGG - Intergenic
973341408 4:49008739-49008761 CCTCCTTTCTTGTTTTTGTCAGG + Intronic
973622443 4:52741036-52741058 TTTCTTTCCTTTTTTTTTGACGG - Intronic
973786207 4:54335018-54335040 CTTCCTTCCTTCATTTTTCCTGG + Intergenic
974568844 4:63617004-63617026 CCTCCTTCCCATTTTTTTCCTGG - Intergenic
974680116 4:65149734-65149756 TCTTCTGCCTTTTTTTATGCTGG + Intergenic
975266416 4:72374285-72374307 ACTCCTTTTTTTTTTTTTGCTGG + Intronic
975711128 4:77160514-77160536 CCTGCTGCCTTTTTTTTTGGGGG + Intronic
975982293 4:80174750-80174772 TCTGCTTCCTTTATATTTGCTGG + Intergenic
976518818 4:86003103-86003125 CTTTCTTTCTTTTTTTTTGTGGG + Intergenic
976799472 4:88972601-88972623 CCTCCTTCACTTTTTTTTGGGGG + Intronic
977143192 4:93401593-93401615 CCTACTGCCTTTTCTTTTGGAGG - Intronic
977208169 4:94187231-94187253 CCTCCTTTATTTATTTTAGCTGG - Intergenic
977848508 4:101795120-101795142 TCTCATTCCTTTTTTGTTACAGG + Intronic
977885852 4:102250857-102250879 TCTCCTTCCATTTGTGTTGCAGG - Intergenic
978500520 4:109404255-109404277 CTTCTTTCTTTTTTTTTTTCTGG - Intergenic
978730356 4:112018952-112018974 TTTCTTTCCTTTTTTTTTGGGGG - Intergenic
978943011 4:114460104-114460126 CCTTCTTTTTTTTTTTTTTCAGG - Intergenic
979726437 4:123967948-123967970 ACTCCTTCCTCTTTCATTGCAGG - Intergenic
979810173 4:125027051-125027073 CCTCCATCTTTCTTTTGTGCTGG + Intergenic
980331652 4:131418234-131418256 CCCCATTGCTTGTTTTTTGCAGG - Intergenic
980439104 4:132817725-132817747 CCTCCTTCCTTTCTTGTCGGGGG - Intergenic
980592472 4:134908505-134908527 CATCTCTACTTTTTTTTTGCTGG - Intergenic
980648132 4:135671827-135671849 CCTTCTTTCTTTCTTTTTTCTGG + Intergenic
980733715 4:136855261-136855283 CCTGCTTTTTTTTTTTTTGTAGG + Intergenic
980829619 4:138114037-138114059 TCACCTTTCTTTTTTTTTTCTGG + Intergenic
980917975 4:139051959-139051981 CCATCTTCCTTTTTTTTTTTTGG - Intronic
981012717 4:139942128-139942150 CCTTCTTTCTTTCTTTTTGATGG - Intronic
981203024 4:142005118-142005140 CCTCATTGCTTGTTTTTTGTCGG + Intergenic
981409811 4:144416557-144416579 CCTCTTTCATTTTTCTTTGGAGG - Intergenic
982239057 4:153280383-153280405 CCTTTTTTTTTTTTTTTTGCTGG + Intronic
982791547 4:159597875-159597897 CCTTTTTCCTTTTTTTTGGGGGG - Intergenic
983099608 4:163608741-163608763 CCTTCTTCCTTTTCTGTTCCTGG - Intronic
983523257 4:168733576-168733598 TTTCCTTCCCTTTTTTTTGAGGG + Intronic
983950292 4:173631446-173631468 CCTCCTCCCTTTTTTTTGTTGGG + Intergenic
984204221 4:176767002-176767024 CTTTCTTTCTTTTTTTTTACTGG - Intronic
984595572 4:181663651-181663673 ACTCCTTCCTTTAATTTTGAAGG - Intergenic
985546061 5:509769-509791 CCTCATTCCTGGTTCTTTGCAGG - Intronic
985632638 5:1021981-1022003 CCTCCTTCCCTGTTTCCTGCTGG + Intronic
986269589 5:6219093-6219115 CCTCCTACCTGATTTTGTGCCGG - Intergenic
986935963 5:12886952-12886974 CAGCCTTCCTTTTTTTTTCATGG + Intergenic
987055461 5:14186577-14186599 CCTTCTTTCTTTTTTTTTTGAGG + Intronic
987262570 5:16218598-16218620 TCTCCTTCTTTTGTTTTTGCAGG - Intergenic
987428792 5:17805556-17805578 CCTTCTTCCTTCTTTCTTGAAGG + Intergenic
987866036 5:23540357-23540379 CCTTCTTCCTTTTGTTTTCAGGG + Intergenic
988248487 5:28722044-28722066 CCTCCGTACTTTTTTTATTCAGG + Intergenic
988514362 5:31891906-31891928 CATGCCTTCTTTTTTTTTGCGGG + Intronic
988701821 5:33682953-33682975 CTTCCTACCTTCTTTTTTTCAGG - Intronic
988831060 5:34987778-34987800 CCTCCCTACTTTTTTTTTAATGG - Intergenic
988916430 5:35898816-35898838 CCTCCATCCTCTCTTTTTTCTGG + Intergenic
989127030 5:38065001-38065023 CCTCATTCCTTGTTTTTGTCAGG + Intergenic
989584361 5:43063149-43063171 CTTCCTTCCTTTCTTTTCGACGG - Intergenic
989749184 5:44870839-44870861 CCTCCTTTTTTATTTTTTGAAGG + Intergenic
989830523 5:45912225-45912247 CTTCCTTCCAGTTTTTTTCCTGG + Intergenic
989844291 5:46120985-46121007 CTTCCTTCTTGTTTTTATGCTGG + Intergenic
989852263 5:46228656-46228678 CCTCCTTCTATTTTTTATCCTGG - Intergenic
990096774 5:52124094-52124116 TCTCTTTCTTTTTTTTTTTCTGG - Intergenic
990209859 5:53470910-53470932 CCTCTTTCTTTTTTTTTAGATGG + Intergenic
990532850 5:56690935-56690957 CTTTCTTCCTTTTTTCTTCCTGG - Intergenic
991461138 5:66860601-66860623 CCTTTTTCGTTTTTTTTTTCTGG + Intronic
992914573 5:81434758-81434780 TCTTCTTCCTTTTGTTTTCCTGG - Intronic
993333965 5:86634056-86634078 CCTCCTTCCTCTTTATAAGCAGG + Intergenic
993362121 5:86990495-86990517 TCTTTTTCCTTTTTTTTTGGGGG - Intergenic
993649556 5:90502797-90502819 CATCCTTCTTTTTTTTTTTTTGG + Intronic
993741321 5:91543848-91543870 CCTTCTTCTTTTTTTTTTTTTGG + Intergenic
994011988 5:94915643-94915665 CCTCCTTTCATTTTGTTTTCTGG + Intronic
994077974 5:95674511-95674533 TCTCCCTCTTTTTTTTCTGCTGG + Intronic
994352048 5:98757524-98757546 TCTCCTTCCTTTGGTTTTTCTGG - Intergenic
994904440 5:105819174-105819196 CCTCTTTCCTTTGTATTTTCTGG + Intergenic
995171700 5:109121627-109121649 CCTTCTTCCTGTATTTTTGGGGG + Intronic
995553986 5:113308803-113308825 CTTTCTTTCTTTTTTTTTGCAGG - Intronic
995555769 5:113327057-113327079 TCTGCTTCCTTCTTTTTTGTTGG - Intronic
995590714 5:113697021-113697043 CCTCCTTTTTTTTCTTTTGAGGG - Intergenic
995643232 5:114281030-114281052 CCTCCTTCCTTATTTCATTCAGG + Intergenic
996183374 5:120448341-120448363 CCTCCTTTTTTTTTTTTTTTTGG - Intergenic
996430580 5:123371691-123371713 TCTACTTCCTTTATTTTCGCTGG - Intronic
996813617 5:127548100-127548122 CCTTCCTCCTTTTGTTTTCCAGG + Intronic
997176544 5:131784004-131784026 CCTTCTTTTTTTTTTTTTGTTGG - Intronic
997665878 5:135629241-135629263 CCTCCTTTCTTTCTTTAAGCTGG - Intergenic
998397682 5:141829423-141829445 CTTCCTTTTTTTTTTTTTGACGG - Intergenic
998618711 5:143770952-143770974 TGTCCTTCCATTATTTTTGCTGG - Intergenic
998652492 5:144136542-144136564 TCTCCTTCTTTCTTTTTTGTTGG - Intergenic
999330593 5:150671508-150671530 CCCCCGACCTTTTTTTTTGGTGG + Intronic
999777899 5:154825360-154825382 CGGCCTGCCTTTTTTTTTGATGG - Intronic
999796861 5:154996922-154996944 CCTGATACCTTTTTTTTTTCTGG + Intergenic
999963325 5:156780391-156780413 CTTCCTTTTTTTTTTTTTGACGG - Intergenic
1000105009 5:158051348-158051370 CCTCCTGACTTGATTTTTGCTGG + Intergenic
1000136574 5:158358482-158358504 CCTCCTTCTCTTTTTTTCCCTGG + Intergenic
1000274219 5:159718730-159718752 GCTCCTTTTTTTTTTTTTCCAGG + Intergenic
1000899904 5:166900291-166900313 CTTCCTTCCTTTTTTTTTCAGGG - Intergenic
1001145014 5:169176252-169176274 CCTTCTTCCTTCTTTTTCTCAGG + Intronic
1001180793 5:169518274-169518296 CCTCATTGCTTGTTTTTGGCAGG + Intergenic
1001333773 5:170781492-170781514 CCTCTTGCCTTTGTTTTTCCGGG + Intronic
1001339660 5:170831606-170831628 CCTCTTTTTTTTTTTTTTGTGGG + Intergenic
1001429802 5:171650298-171650320 CCTACTTTTTTTTTTTTTGGTGG - Intergenic
1001927316 5:175647905-175647927 CCTCCTTCCTTTGATCCTGCAGG - Intergenic
1002114320 5:176946508-176946530 TTTCTTTCCTTTTTTTTTGGAGG - Intronic
1002155917 5:177279491-177279513 CTTCCTTCCTTTTTTTGAGAGGG - Intronic
1002164218 5:177334575-177334597 CCTCCTCTCTTTTTTATTGCTGG - Intronic
1002256175 5:177959802-177959824 CCTCCTTTTTTTTTTTTTTTTGG + Intergenic
1002537518 5:179885591-179885613 CCTCCATCTTTTTTTTTTTGGGG - Intronic
1002923006 6:1586486-1586508 CCTCCTTCCTCTTGTTTTCAAGG + Intergenic
1003414213 6:5893644-5893666 GCTGCTTCCTCTTTGTTTGCTGG - Intergenic
1004016407 6:11735943-11735965 TCTCCCTACTTTTTTTTGGCGGG + Intronic
1004078279 6:12365492-12365514 CCTCCTTGCTTTTGTTTCTCTGG + Intergenic
1004151031 6:13120265-13120287 CTCCCCTCCTTTTTTTTTCCTGG + Intronic
1004807247 6:19217081-19217103 CTTCATTCATTTTTTTTTGTGGG - Intergenic
1005136873 6:22579207-22579229 CCTTCTCCATTTTTTTTTTCTGG + Intergenic
1005883467 6:30076653-30076675 CCTGCTTCCTGATTTTTTTCTGG + Intergenic
1005944597 6:30586130-30586152 CTTCCTTCGTTTGTTTTTCCTGG - Exonic
1006317240 6:33298107-33298129 CCTCCTTGTTTTTGTTTGGCGGG - Intronic
1006404367 6:33835709-33835731 ACTCACTCTTTTTTTTTTGCGGG + Intergenic
1006439989 6:34047954-34047976 TCTCCTTAGTGTTTTTTTGCTGG - Intronic
1006854291 6:37122451-37122473 CCTTCTTTCTTTCTTTTTGACGG + Intergenic
1006969787 6:38030688-38030710 CTTCTTTCCTTTATTTCTGCAGG - Intronic
1007157255 6:39757492-39757514 CTTCCTTTCTTTTTTTTGGAGGG + Intergenic
1007284316 6:40736710-40736732 ACTCATCCCTTTTTTTTTGTGGG - Intergenic
1007486264 6:42182886-42182908 CCTTCTTTCTCTTTTTTTGATGG + Intergenic
1007514531 6:42400718-42400740 CCTGCCTCCTTTTTTATTGCTGG - Intronic
1007613466 6:43165904-43165926 CTTTCTTTCTTTTTTTTTTCTGG + Intergenic
1007617774 6:43191906-43191928 CTTCCTTTTTTTTTTTTTGCTGG + Intronic
1007640404 6:43334604-43334626 CCTCCTTCCTTTTGGTTAGTGGG - Intronic
1008905818 6:56676691-56676713 CCTCCTTTTTTTTTTTTTTAAGG - Intronic
1008927341 6:56900874-56900896 CCTCCTTTTTTTTTTTTTTTTGG - Intronic
1009262343 6:61509205-61509227 CTTCCTTCTATTTTTTATGCTGG + Intergenic
1009461654 6:63920889-63920911 CTTTCTTCCTTTTTTTTTTTTGG + Intronic
1009985348 6:70775662-70775684 GTTCCTTCCTTTTTTTATGTAGG + Intronic
1010518221 6:76800989-76801011 CCTCTTTCTTTTTTTTTAGATGG + Intergenic
1011011904 6:82712387-82712409 CCACCTTCCTTCTTTTCTCCAGG - Intergenic
1011069690 6:83366481-83366503 CCTGTTTCCTTCTTTTTTGAAGG - Intronic
1011394082 6:86887742-86887764 CATCTTTCCATTTGTTTTGCTGG - Intergenic
1011398133 6:86931859-86931881 TCTTCTTCCTTTTTTTTTAGTGG - Intergenic
1011684601 6:89814380-89814402 CCTCCTTTTTTTTTTTTTTTTGG + Intronic
1011841242 6:91501840-91501862 CCTCCTTCCATTTATTTTACTGG - Intergenic
1011902158 6:92312518-92312540 CTTCCTTCCTTTTCTTTTTCAGG + Intergenic
1012207693 6:96480914-96480936 TCTCCCTCCTTTTTTTTTTTTGG - Intergenic
1012238207 6:96842546-96842568 CCTCCTTCCATTATTTTTGCAGG - Intergenic
1012563191 6:100613062-100613084 CTTTCTTTCTTTTTTTTTTCAGG + Intronic
1012614862 6:101264645-101264667 CTTTCTTCTTTTTTTTTTGACGG + Intergenic
1013000356 6:106015776-106015798 TTTCTTTCTTTTTTTTTTGCAGG + Intergenic
1013157177 6:107504217-107504239 CCTCCTTCCTTTTTTTCAGTGGG + Intronic
1013500388 6:110743641-110743663 CTTCATTCTTTTTTTTTTGTAGG - Intronic
1013674990 6:112448915-112448937 CTTCCTTCCTTTCTTTTTTTTGG + Intergenic
1014250505 6:119110984-119111006 CAACCTTCCTTTTCATTTGCTGG - Intronic
1014339356 6:120183847-120183869 TCTCTCTCCTTTTTTTTTGCTGG + Intergenic
1014360933 6:120472655-120472677 CCTCCTTCTTTCTTTTTGCCAGG + Intergenic
1014691144 6:124564926-124564948 TCCCCTTCCATTTTTTTTTCAGG + Intronic
1014768260 6:125432227-125432249 CCTCCTTCCTTTGTTTCAGCAGG + Intergenic
1015179284 6:130344755-130344777 CCTCCTTCTTTCTTTCTTTCTGG - Intronic
1015916232 6:138220016-138220038 TTTCCTTTCTTTTTTTCTGCAGG + Intronic
1016165765 6:140940786-140940808 CATACTTCCTTTTCTTTTTCAGG + Intergenic
1016673069 6:146731063-146731085 CCTCTTTCCTTATTTTTCGTAGG + Intronic
1016714756 6:147211915-147211937 CCTCCATCCTTTTTTGTTCATGG + Intronic
1016811467 6:148265306-148265328 CCTCCCTCCTTTTTCTTTCTTGG - Intergenic
1017032808 6:150238941-150238963 TTTCCTTCTTTTTTTTTTGGCGG + Intronic
1017055751 6:150434231-150434253 CTTCTTTCTTTTTTTTTTGATGG - Intergenic
1018333969 6:162764268-162764290 CCTCCCCCCTTTTTTTGTGATGG - Intronic
1018416773 6:163608378-163608400 CCTCGCTCATTTTCTTTTGCAGG + Intergenic
1019003968 6:168780789-168780811 CCCCCCCCCTTTTTTTTTTCTGG + Intergenic
1020061397 7:5155175-5155197 CTTTCTTTCTTTTTTTTTTCTGG - Intergenic
1020401341 7:7781364-7781386 CCTCTTTCTTTTTTTTTTAGTGG + Intronic
1020685093 7:11284738-11284760 CCTCATTCCTTGTTTTTGTCAGG + Intergenic
1021116347 7:16750038-16750060 CCTGCTACCTTTTTGTTTGCTGG + Intergenic
1021268103 7:18549938-18549960 CCTAGTTCTTTTTTTTTTGTAGG + Intronic
1021793905 7:24233986-24234008 CCTCCTTACTCATATTTTGCAGG + Intergenic
1021971038 7:25966523-25966545 CCTCCTTCCTTCCTTCTTTCTGG - Intergenic
1022162625 7:27726932-27726954 CCTCCCTCTCTTTTTTTGGCTGG - Intergenic
1022793805 7:33715653-33715675 GTTCGTTCCTTTTTTGTTGCTGG + Intergenic
1023298139 7:38737988-38738010 CCTGCTCCCTTTTATTTTTCTGG + Intronic
1023711236 7:42995127-42995149 CCTCCTTCTTATTTTTTTTTAGG + Intergenic
1024143983 7:46492335-46492357 CCTCTTTTTTTTTTTTTTGAGGG + Intergenic
1024883084 7:54111639-54111661 TTTCCTTCCGTTTTTTCTGCAGG - Intergenic
1024896673 7:54268824-54268846 CCTTCTTCCTTTTTCTTAGTAGG + Intergenic
1025583525 7:62750987-62751009 TCTCCTACCAGTTTTTTTGCTGG - Intergenic
1025589698 7:62841627-62841649 CTTCCTTCTTGTTTTTTTCCTGG - Intergenic
1025600087 7:62986162-62986184 CTTCCTTCCTGTTTTTATGCTGG - Intergenic
1026104644 7:67411172-67411194 CCTTCTGCCTGCTTTTTTGCAGG - Intergenic
1026545415 7:71317857-71317879 GCTTCTTCCTTTCTTTTTTCTGG + Intronic
1026700153 7:72634171-72634193 CCCACCTCCTTTTTTTTTTCTGG + Intronic
1027191090 7:75995805-75995827 CCCCCTTTCCTTTTTTTTGGAGG - Intergenic
1027764672 7:82324352-82324374 CCTTCTTCTTTTTTTTTTTTTGG - Intronic
1028381785 7:90208335-90208357 CTTCCTTTCTCTTTTTTTTCAGG - Intronic
1028538078 7:91911518-91911540 ACTCCTTTCTTCCTTTTTGCAGG - Intergenic
1028719218 7:94010607-94010629 CTTCCTTCCTTTTTTCTTCCAGG + Intergenic
1029295418 7:99536452-99536474 CCTTCTTTTTTTTTTTTTGACGG - Intergenic
1029368101 7:100129217-100129239 CCCTCTGCATTTTTTTTTGCTGG + Intergenic
1029519059 7:101048588-101048610 CCTTCTTTCTTTTTTTTGACAGG - Intronic
1030199911 7:106892099-106892121 CCTCCTGTCATTTTTCTTGCTGG + Intronic
1030595184 7:111529604-111529626 CCTCCTTTATTATTTTTGGCTGG - Intronic
1030766731 7:113419564-113419586 CCTCCTTCCTGATTTTCTGCTGG - Intergenic
1030909594 7:115230130-115230152 CTTATTTCCATTTTTTTTGCTGG + Intergenic
1030956777 7:115862835-115862857 TCTGTTTCCTTTTTTTTTTCTGG + Intergenic
1030968422 7:116023079-116023101 ACTCTTTTTTTTTTTTTTGCTGG - Intronic
1030978382 7:116155566-116155588 CTTTCTTTCTTTTTTTTTCCTGG - Intronic
1031013417 7:116547394-116547416 CCTCCTTTCCTTTTGTTTGAAGG - Intronic
1031102878 7:117504234-117504256 CCTCCTCTCTTTATTTTAGCTGG + Exonic
1031318727 7:120292807-120292829 CCTCCTTAGGCTTTTTTTGCTGG + Intronic
1031690649 7:124783285-124783307 CCTTTTTCCTTTTTTCTTCCTGG - Intronic
1031895195 7:127340199-127340221 CTTCCTTCCCTTTTTCTTTCTGG + Intergenic
1032073762 7:128826436-128826458 CCTCCTGTCTTTTTTTTTTTTGG - Intergenic
1032137280 7:129291513-129291535 CCTTTTTTTTTTTTTTTTGCAGG + Intronic
1032248457 7:130232633-130232655 TCTCCTCCCTTTTCTTTTCCAGG + Intergenic
1032443059 7:131957076-131957098 CTTCCTTTCTTTTTTTCTGCTGG - Intergenic
1032490199 7:132318592-132318614 CCTCCTTCCTTCCTGTTTTCCGG - Intronic
1033431069 7:141289981-141290003 CTTTCTTCTTTTTTTGTTGCGGG - Intronic
1033593677 7:142837589-142837611 CTTTCTTTCTTTTTTTTTGAAGG - Intergenic
1033711377 7:143950016-143950038 CCCCCCCCCTTTTTTTTTACTGG - Intergenic
1033973469 7:147071321-147071343 CATCTTTTTTTTTTTTTTGCAGG - Intronic
1033990360 7:147276216-147276238 CCTCCTTAATTTTTTTTTTTTGG + Intronic
1034061919 7:148099846-148099868 CCTCCCTCCTTTTTTTTTTTTGG + Intronic
1034070076 7:148175974-148175996 CCTCTCTCCCTTTCTTTTGCTGG + Intronic
1034339211 7:150341299-150341321 CCTCCTTCCTCTTTTTTCTGGGG + Exonic
1034340100 7:150347258-150347280 CCTCCCTCCTTTTTATTTTCTGG + Intergenic
1034482531 7:151333614-151333636 CCTCTTTTCTTTTTTCTTTCCGG - Intergenic
1034881111 7:154763325-154763347 CTTCCTTCCTTTTTTTGAGATGG - Intronic
1035419827 7:158717940-158717962 CCTCCTTCTTTTTTTTTTAAAGG + Intergenic
1035520157 8:269366-269388 CATCCTTCTTTTTTTCTTGGGGG - Intergenic
1036112710 8:5921721-5921743 CCTCCTTCCCTCTTTTTTTGGGG - Intergenic
1036238304 8:7061436-7061458 CTTTCTTTCTTTTTTTTTGGGGG - Intergenic
1036507900 8:9372416-9372438 TTTCTTTCCTTTTTATTTGCTGG - Intergenic
1036553171 8:9833110-9833132 CCTTCTTTTTTTTTTTTTTCAGG + Intergenic
1036730795 8:11262310-11262332 CCTCCTTACTTTTCTTTTTGTGG + Intergenic
1036777620 8:11624516-11624538 CCTTTTTTTTTTTTTTTTGCTGG + Intergenic
1037040841 8:14230740-14230762 TTTCCTTCTTTTTTTTTTGGTGG + Intronic
1037134221 8:15443168-15443190 CTTCCTTTCTTTTTTTTAGAAGG + Intronic
1037304614 8:17492464-17492486 CCTCCTTTTTTTTTTTTTAGAGG + Intergenic
1037361762 8:18081902-18081924 CCTCATTAATTTTTTTTTACTGG - Intronic
1037532603 8:19792205-19792227 AATCCTTCCTTGTTTTTTCCAGG + Intergenic
1037644436 8:20778737-20778759 CTTCCTTCTTTTTTTGTTGTTGG - Intergenic
1038130128 8:24720715-24720737 TTTCCTTTCTTCTTTTTTGCTGG - Intergenic
1039164868 8:34666924-34666946 CCTCCCACTTTTTTCTTTGCTGG + Intergenic
1039348059 8:36729841-36729863 CATCCTTCCTTGTCTTGTGCTGG - Intergenic
1039673601 8:39633826-39633848 CCACCTTTTTTTTTTTTTACAGG - Intronic
1040393171 8:46967292-46967314 CCTGTTTCCTTTTGTGTTGCGGG - Intergenic
1040629192 8:49189963-49189985 CATTCTTCCTTTTGTTTTGCAGG + Intergenic
1040903561 8:52441661-52441683 CTTCCTTCTTTTTTTTTTTGAGG - Intronic
1041125141 8:54629484-54629506 ACTCATTCCTTTATTTCTGCTGG + Exonic
1041448201 8:57976650-57976672 CTTCCTTCCTTCTTCTTTTCAGG + Intergenic
1041498369 8:58512220-58512242 CCTCCTCCCCTTTCTTTTTCAGG + Intergenic
1041518845 8:58732501-58732523 CCTCTCTCCTTCTTTCTTGCTGG + Intergenic
1041647802 8:60271326-60271348 TCTTCTTTCTTTTTTTTTTCAGG - Intronic
1042077380 8:65011157-65011179 CCTTCTTCCTTTTTCTTTCTTGG + Intergenic
1042097884 8:65238457-65238479 CATCTTGCCTTTTTTTTTCCTGG - Intergenic
1042203791 8:66307673-66307695 GCTCCTTCCTTTTCTTTTTTAGG - Intergenic
1042384716 8:68161089-68161111 CTTTCTTTCTTTTTTTTTGGGGG + Intronic
1044342314 8:91060633-91060655 CATTCTTCCTCTTTTTTTGAGGG + Intergenic
1044404402 8:91811250-91811272 TCTCATTCCTTTCTTTTTCCTGG - Intergenic
1044655292 8:94541969-94541991 CCCTCTTCCTTTTTCTTAGCTGG - Intronic
1045309179 8:100985648-100985670 GCTACTTTTTTTTTTTTTGCAGG + Intergenic
1045649465 8:104328673-104328695 TCTTCTTCCCTTTTTTCTGCTGG - Intergenic
1045782550 8:105884818-105884840 CTTCCTGCTTTTTTGTTTGCAGG + Intergenic
1045896016 8:107217823-107217845 CCTCCTTTCTTCTTTTTTTGGGG + Intergenic
1046211951 8:111087693-111087715 CCTCCTTTTTTTTTTTCTCCAGG + Intergenic
1046454424 8:114440205-114440227 TCTTCTTCTTCTTTTTTTGCTGG - Intergenic
1046955981 8:120063267-120063289 CATCCTTGCTTTTCTTCTGCAGG + Intronic
1047239081 8:123069198-123069220 TGTCTTTCCTTTTTTTTTGTTGG - Intronic
1047560324 8:125980612-125980634 CCCCCCTCTTTTTTTTTTTCAGG + Intergenic
1047914017 8:129562168-129562190 CACCCTTCATTTTTTCTTGCAGG + Intergenic
1048336956 8:133509754-133509776 CCTCCTTCACTAATTTTTGCTGG - Intronic
1048618460 8:136105243-136105265 TCCTCTTGCTTTTTTTTTGCTGG + Intergenic
1048651444 8:136483113-136483135 CCTTCTTCCTTTCTGTTTGTTGG + Intergenic
1049157430 8:141075525-141075547 CCTCCTTCCTCCTTCTTGGCCGG + Intergenic
1049430479 8:142560842-142560864 CATCCTTCCTTTTTCTGAGCCGG + Intergenic
1049521574 8:143094176-143094198 CCTCCTTCCTCCTGTTTTGAAGG + Intergenic
1049934658 9:489954-489976 CTTCCTTCCTTTATTTATTCTGG - Intronic
1050011364 9:1188765-1188787 CCTTCTTCCTTTCTTTCTGATGG + Intergenic
1050131791 9:2420557-2420579 CCTCCCTTGTTTTTTGTTGCGGG + Intergenic
1050157032 9:2678745-2678767 CCTGTTTCCGTTTGTTTTGCTGG - Intergenic
1050623026 9:7474417-7474439 CCCCCATCCTTCTGTTTTGCTGG - Intergenic
1051212181 9:14756805-14756827 TCTCCCTCCTTTTCTTTTGAGGG - Intronic
1051214225 9:14779106-14779128 CCTCCTTCCTATTTTATTGTGGG - Intronic
1051405392 9:16732153-16732175 TCTTTTTCTTTTTTTTTTGCAGG - Intronic
1051543114 9:18243544-18243566 TCTGCTTGCTTTGTTTTTGCTGG + Intergenic
1051562017 9:18452824-18452846 CCTCATTCCTTTGACTTTGCTGG + Intergenic
1051696746 9:19775889-19775911 CCTTCTTCCTTTCTTTCAGCAGG - Intronic
1051958500 9:22728439-22728461 CATTTTTCCTTTTTTTTTTCTGG - Intergenic
1052643494 9:31200663-31200685 CTTCCTTACTTTTGTTTTGGGGG - Intergenic
1053108727 9:35438294-35438316 CCTGCTTCCTGTTCTTATGCTGG - Intergenic
1053184684 9:36005568-36005590 CCTCCTTCCTTTCTTCCTGTTGG + Intergenic
1055590240 9:77805081-77805103 ACTTCTTCATTTGTTTTTGCAGG - Intronic
1055597303 9:77878637-77878659 CCTCTTCTCTTTTTTTTTTCAGG - Intronic
1056292972 9:85162339-85162361 CCTCATTGCTTTTTTTTGTCAGG + Intergenic
1056622005 9:88222223-88222245 CCTCTTTTTTTTTTTTTTGACGG - Intergenic
1056636460 9:88335317-88335339 CTTCCTTCCTTTTTTTGAGATGG + Intergenic
1056847343 9:90052153-90052175 ACTTCTTACTTATTTTTTGCTGG + Intergenic
1056990417 9:91405572-91405594 ACTCCTTCCTTTTCTCATGCAGG + Intergenic
1057081660 9:92178363-92178385 CCTTCTTTCCTTTTTTTTGAAGG - Intergenic
1057435508 9:95036695-95036717 TCTTCTTCTTTTTTTTTTGTGGG + Intronic
1057537792 9:95931791-95931813 CTTCGTTCATTTTTTTGTGCTGG + Intronic
1057661791 9:97010048-97010070 CCTCCTTTTTTTTTTTTTTTTGG + Intronic
1057688423 9:97259929-97259951 CCTCCCTTCTTTTCCTTTGCTGG + Intergenic
1057691436 9:97290162-97290184 CTTCCTTCTTTTTTTTTGACAGG - Intergenic
1057729433 9:97596065-97596087 TCTTCTTCTTTTTTTTTTGATGG - Intronic
1057752781 9:97805450-97805472 GCTCCTTCCAGTCTTTTTGCAGG + Intergenic
1058130510 9:101247419-101247441 CCCCCTTCCTTTTTCTATGGTGG - Intronic
1058529015 9:105887739-105887761 CCTCCTTTCTTCTTTTCTGCAGG - Intergenic
1058643309 9:107107850-107107872 CCTCCCTCCTTTGCTTTTGAAGG - Intergenic
1058705496 9:107634501-107634523 CTTGCTCCCTTTTTTTTTGGGGG - Intergenic
1058728106 9:107823122-107823144 CCTGGTTCCTTTTATTTTCCTGG + Intergenic
1059227858 9:112689660-112689682 CATCCTTACTTTTTTTTGGATGG + Intronic
1059314825 9:113415139-113415161 TCTATTTCCTTTTTTTTTGGTGG + Intronic
1059735869 9:117099106-117099128 CCTCCTTTTTTTTTTTTTTTTGG - Intronic
1060123444 9:121018567-121018589 CTTCCTTCCTTTCTTTTTGGTGG - Intronic
1060418122 9:123447291-123447313 CATCCTTCTTTTTTTGTTGTTGG + Intronic
1060861715 9:126960237-126960259 CTTCCTTTTTTTTTTTTTGATGG + Intronic
1061264396 9:129496992-129497014 CCTCCTTCCTTTCTTCTTCCTGG - Intergenic
1061557799 9:131382634-131382656 CCCCATTCCTTTTTTTTTTTTGG + Intergenic
1062086363 9:134651047-134651069 GCTCCCTCCTGTTTGTTTGCTGG + Intronic
1062434302 9:136539898-136539920 CCTCCTTCCTCTTCTTTTAAGGG + Intronic
1062638349 9:137503380-137503402 CCTCCTTCCTTCTTCTTTTTTGG - Intronic
1185431186 X:13007-13029 CTCCCTCCCTTTTTTTTTTCAGG + Intergenic
1185431988 X:16687-16709 CTCCCTCCCTTTTTTTTTTCAGG + Intergenic
1185440453 X:225404-225426 CTCCCTCCCTTTTTTTTTTCAGG + Intergenic
1185884451 X:3769955-3769977 CTTTCTTTCTTTTTTTTTGATGG + Intergenic
1185920611 X:4087923-4087945 CTTCCTTTTTTTTTTTTTCCAGG + Intergenic
1186991140 X:15069433-15069455 CCTTCTTTTTTTTTTTTAGCCGG - Intergenic
1187127111 X:16464012-16464034 CTTCCTTCCTTTTTTTTTCAGGG - Intergenic
1187225377 X:17371253-17371275 CCTCTTTCCTTTAGTTTTGCTGG - Intergenic
1187424403 X:19164087-19164109 CCACCTTCCTTGTCTCTTGCAGG + Intergenic
1187708614 X:22031484-22031506 CCTACCTGCTTTTGTTTTGCTGG - Intergenic
1187994818 X:24914524-24914546 TTTCCTTTTTTTTTTTTTGCGGG - Intronic
1188473812 X:30568966-30568988 CCTTTTTTTTTTTTTTTTGCTGG - Intronic
1188915802 X:35908817-35908839 CCTTTTTCCTCTTTTTTTGGTGG - Intergenic
1188935110 X:36166197-36166219 CCTCTCTCCTTTTTTTATTCAGG + Intergenic
1189055035 X:37689965-37689987 CCTCATTTCTTTTTTATTACTGG + Intronic
1189118834 X:38371705-38371727 CCTCCTTCCTTCTCTTTAGGGGG - Intronic
1189997205 X:46650482-46650504 CCTTCTCCTTTTTTTTTTGGTGG + Intronic
1190296775 X:49032223-49032245 CTCTTTTCCTTTTTTTTTGCGGG + Intronic
1190422038 X:50294841-50294863 CAACCCACCTTTTTTTTTGCAGG + Exonic
1191267722 X:58417778-58417800 CCTCCTTCTATTTTTTATTCTGG + Intergenic
1191746315 X:64491955-64491977 AATCCTTTCTTTTTTGTTGCTGG - Intergenic
1192147524 X:68691739-68691761 CCTCCTCCTTTTTTGTTTCCTGG + Intronic
1192151667 X:68716616-68716638 CTTTCTTGCTTTTTTTTTTCTGG + Intronic
1192287762 X:69756291-69756313 CCTCCTTCCTGTTTTGTTCCAGG + Intronic
1192970981 X:76229674-76229696 CCTCATTTATTTTTTTTTTCAGG + Intergenic
1193168221 X:78305810-78305832 TTTCCTTCCTTTTTTGTGGCTGG + Intronic
1193489827 X:82135163-82135185 CCCCCTTGCTGTTTTTTTGATGG - Intergenic
1193519819 X:82514979-82515001 CGTCCTCCCTTATTTTTTGCAGG + Intergenic
1194672847 X:96755860-96755882 CTTTCTTCCTTTTTTTTTTTTGG + Intronic
1195025455 X:100872640-100872662 CCCCCTCTCTTATTTTTTGCTGG - Intronic
1195280839 X:103330955-103330977 GCCCCTTCCTTTTTGTTTGGAGG + Exonic
1195825165 X:108991646-108991668 CATTCTTTCTTTTTTTTTGACGG - Intergenic
1196155229 X:112420907-112420929 TACCCTTCCTTTTTTTCTGCCGG + Intergenic
1196235902 X:113279280-113279302 CTTCCTTCCTTTCTTTATTCTGG - Intergenic
1196932859 X:120698056-120698078 TCTCCTTCTTTTTTTTTTGACGG - Intergenic
1197508511 X:127340280-127340302 ACTCCTGCTTTTTTTTTTTCTGG + Intergenic
1197554652 X:127938368-127938390 CCTTTTTCTTTTTTTTTTGAGGG + Intergenic
1198056557 X:133001437-133001459 CCTGCTTGCTTTTTTTTGGGGGG - Intergenic
1198217709 X:134571133-134571155 CCTCTTTCCTTTTTTTGTTTTGG - Intronic
1199266421 X:145832705-145832727 CCTACTACCTTTTTTTTTTGGGG + Intergenic
1199464030 X:148116062-148116084 CTTCCTTCCTTTCTTTCTTCAGG - Intergenic
1199567745 X:149233518-149233540 CCTCATTGCTTTTTTTTGTCAGG - Intergenic
1199813256 X:151371484-151371506 CTTCCTTTCTTTTTTTTTCAGGG - Intergenic
1200247000 X:154531724-154531746 CCTCCTTCCTTCTGTTGGGCTGG + Exonic
1200708277 Y:6461635-6461657 CATCTTTCATTTTTTTTTGCTGG + Intergenic
1200761673 Y:7044629-7044651 CTTCTTTCCTTTTTTTGTGGGGG + Intronic
1200837494 Y:7747133-7747155 CCTGCTTGCTTTTTTTTTTAAGG - Intergenic
1200880114 Y:8203645-8203667 TCTCCTTCCTTTTTGTTTTTAGG + Intergenic
1200900420 Y:8425934-8425956 TTTCCTTTCTTTTTTTTTTCTGG - Intergenic
1200921413 Y:8616703-8616725 TCTGTTTCCATTTTTTTTGCAGG - Intergenic
1200964641 Y:9024991-9025013 CTTCATTTTTTTTTTTTTGCAGG + Intergenic
1201025835 Y:9703073-9703095 CATCTTTCATTTTTTTTTGCTGG - Intergenic
1201580569 Y:15507641-15507663 CCCCCTTGCTTTTTTTTGTCAGG - Intergenic
1201896336 Y:18996677-18996699 CCTCTTTCCTTTTCTCTTTCTGG - Intergenic
1202338423 Y:23834314-23834336 TCTTCTTCTTTTTTTTTTTCTGG - Intergenic