ID: 1155923565

View in Genome Browser
Species Human (GRCh38)
Location 18:31630013-31630035
Sequence GTGGAGAAGGAGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2406
Summary {0: 1, 1: 0, 2: 20, 3: 285, 4: 2100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155923557_1155923565 14 Left 1155923557 18:31629976-31629998 CCAGCAAAAAAAAAGGAAGGAGG 0: 1
1: 0
2: 5
3: 99
4: 890
Right 1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG 0: 1
1: 0
2: 20
3: 285
4: 2100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155923565 Original CRISPR GTGGAGAAGGAGAAGCAGGA AGG Intronic
Too many off-targets to display for this crispr