ID: 1155938026

View in Genome Browser
Species Human (GRCh38)
Location 18:31774594-31774616
Sequence ACGAAGACCTTCAGCCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155938026_1155938028 -7 Left 1155938026 18:31774594-31774616 CCACAGTGGCTGAAGGTCTTCGT No data
Right 1155938028 18:31774610-31774632 TCTTCGTGACATGGAACTAGAGG No data
1155938026_1155938029 -3 Left 1155938026 18:31774594-31774616 CCACAGTGGCTGAAGGTCTTCGT No data
Right 1155938029 18:31774614-31774636 CGTGACATGGAACTAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155938026 Original CRISPR ACGAAGACCTTCAGCCACTG TGG (reversed) Intergenic
No off target data available for this crispr