ID: 1155942277

View in Genome Browser
Species Human (GRCh38)
Location 18:31811314-31811336
Sequence CGGTGCCGGCGCGGGTCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155942269_1155942277 26 Left 1155942269 18:31811265-31811287 CCGAGATGGTAGAGATAATGATC No data
Right 1155942277 18:31811314-31811336 CGGTGCCGGCGCGGGTCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155942277 Original CRISPR CGGTGCCGGCGCGGGTCCTC CGG Intergenic
No off target data available for this crispr