ID: 1155947184

View in Genome Browser
Species Human (GRCh38)
Location 18:31868106-31868128
Sequence CAGTGGGAGAGAAGGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1247
Summary {0: 1, 1: 0, 2: 9, 3: 118, 4: 1119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155947184 Original CRISPR CAGTGGGAGAGAAGGGAAAA AGG Intronic
900088169 1:908550-908572 GCGGGGGAGAGGAGGGAAAAGGG + Intergenic
901160265 1:7172045-7172067 GAGTGAGAGAAAAGGAAAAATGG - Intronic
901169072 1:7242327-7242349 TAGTGGGAATGAATGGAAAATGG + Intronic
901216654 1:7559003-7559025 CTTTGGGAGAGGAGGGACAAAGG + Intronic
901428240 1:9197232-9197254 CATTGGGTGAAAAGTGAAAATGG + Intergenic
901519101 1:9769027-9769049 GAGAGGGAGAAAGGGGAAAAGGG + Intronic
901522791 1:9798116-9798138 GAGAGGGAGAGAGGGGAAGAGGG + Intronic
901917390 1:12510268-12510290 CAGATAGGGAGAAGGGAAAAGGG + Exonic
902038285 1:13473478-13473500 GAGTGGGAGAGTAGGAAAGAAGG + Intergenic
902515229 1:16986417-16986439 CAGCGGGAGAGAAGGGAGGTGGG - Intronic
902617659 1:17632605-17632627 CAGTGGCAGAGCAGGGCAAGAGG - Intronic
902733472 1:18384691-18384713 CAGAGGGAGAGAGGAGAAGAGGG + Intergenic
902784389 1:18723669-18723691 CACAGGGAGAGAAGAGAGAAAGG + Intronic
902790673 1:18765754-18765776 CAGGGGAAGAGCAGGGAAGAAGG + Intergenic
903039346 1:20516795-20516817 AAATGGAAGGGAAGGGAAAAGGG + Intergenic
903720673 1:25403188-25403210 GAGAGGGAGAGAAGGGACAGTGG - Intronic
903778081 1:25805918-25805940 GAGTGGGAGAGAGTGCAAAAGGG - Intronic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
904136668 1:28317856-28317878 AGGTGGGAGAGAAGTGAGAATGG - Intergenic
904369363 1:30038712-30038734 GAGTGGGAGAGAAGGGGACATGG - Intergenic
904563201 1:31412462-31412484 CAGATGGAGAGAAGGGAGGATGG + Intronic
904938871 1:34151147-34151169 CAGAGGGGGAGAGGGGAAGAAGG - Intronic
905215591 1:36405168-36405190 CAGTGTAAGACATGGGAAAATGG - Intergenic
905338572 1:37262336-37262358 CAGTGGGAGTCAGGGGAGAAGGG + Intergenic
905871442 1:41406686-41406708 CAGGGGGAGAAGAGGAAAAAGGG - Intergenic
905924920 1:41742743-41742765 CAGAGGGAGAGAAGCTAAAGTGG - Intronic
906087294 1:43147221-43147243 GGGCTGGAGAGAAGGGAAAAGGG + Intronic
906291357 1:44621575-44621597 CAGTGGGGGACAGGGGAGAAGGG - Intronic
906495228 1:46301006-46301028 CAGTGGTAGGGGAGGGAGAAGGG + Intronic
906505957 1:46379811-46379833 CAGAAGAACAGAAGGGAAAAGGG + Intergenic
906542521 1:46598470-46598492 CAATGCGGGGGAAGGGAAAATGG + Intronic
906721208 1:48006143-48006165 GAGAGGGAGAGAATGGAAGAAGG + Intergenic
906746924 1:48228577-48228599 AAGTGGGAAAAAAGGGAAAGTGG - Intronic
906806645 1:48785519-48785541 CAGTGGTTGCTAAGGGAAAATGG - Intronic
907611501 1:55875705-55875727 AAGTAGCAGAGAAGGGTAAATGG - Intergenic
907652366 1:56307558-56307580 GAGGGAGAGAGAAGGGAGAATGG - Intergenic
907844827 1:58195067-58195089 TAGTGGGAGAGATAAGAAAAGGG + Intronic
907943394 1:59110258-59110280 CAGTGGGAGCAAAGGGACAGAGG - Intergenic
907994765 1:59618952-59618974 CAGGGCGGGAGAAGGGAACAGGG - Intronic
908262420 1:62349442-62349464 GAAAGGGAGAGAAGGGGAAAGGG + Intergenic
908632241 1:66122018-66122040 CAGTGAGGGAGAAAGGAGAAAGG - Intronic
908686652 1:66727870-66727892 CAGTGGGAGAGATTACAAAAAGG + Intronic
908961210 1:69698971-69698993 AAGTCAGAGAGAAGGCAAAAGGG - Intronic
909189101 1:72529886-72529908 CAGGGAGAGAGATAGGAAAAAGG - Intergenic
909493279 1:76248757-76248779 AAATGGGAGAGAAAGAAAAAGGG - Intronic
909749893 1:79145943-79145965 GAATGGGACAAAAGGGAAAAAGG - Intergenic
910017224 1:82540791-82540813 CAGAAGAAGAAAAGGGAAAAGGG + Intergenic
910437101 1:87216526-87216548 CACAGAGAGAGAAGGTAAAAAGG - Intergenic
910936607 1:92487959-92487981 GAGTAGGAGAGAAGGGAATAAGG - Intergenic
911383529 1:97145970-97145992 CTGGGAGAGAAAAGGGAAAAAGG + Intronic
911601723 1:99854809-99854831 GAGTGGTAGAGAAGGGACATTGG + Intronic
911967916 1:104390594-104390616 CAATGTAAGAGAAGAGAAAAAGG + Intergenic
912879599 1:113396855-113396877 CACTGGCAGAAAAGTGAAAAAGG - Intronic
912891456 1:113536869-113536891 CAGTGGTAGTGAAGGAGAAAAGG - Intronic
913435169 1:118840171-118840193 CAGTGGGAGATAATTGAACATGG - Intergenic
913443481 1:118924852-118924874 CAGAGGCAGAGAAGGGACAGAGG + Intronic
913542881 1:119838747-119838769 CAGAGAGAGAGAAGTGAAAGAGG - Intergenic
913676637 1:121146979-121147001 GAGAGGGAGGGAAGGGAGAATGG - Intergenic
914028533 1:143934929-143934951 GAGAGGGAGGGAAGGGAGAATGG - Intergenic
914261117 1:146000061-146000083 AAGAGAGAGAGAAAGGAAAATGG - Intergenic
914444834 1:147741010-147741032 ATGTGGGAGAGAAGGGAATATGG - Intergenic
914825208 1:151134519-151134541 CAGAAGGAGAGAAGGACAAAAGG + Intronic
915029237 1:152861941-152861963 CAGTGGGAGACAAAGAAATAGGG + Intergenic
915046913 1:153025272-153025294 CTGAGGGAGAGAAAGAAAAAGGG - Intergenic
915459425 1:156061011-156061033 CAGCGGGGGGGAAGCGAAAAAGG - Intergenic
915520556 1:156439970-156439992 CAGCGGGAGGGAGGGGGAAATGG - Intergenic
915625455 1:157111606-157111628 CAGAGGGAGGGGAGGGAACAGGG + Intergenic
915737602 1:158094755-158094777 GAGTGGGAGAGACGGGATGAGGG - Exonic
915935164 1:160086149-160086171 CAGTGGGAGAGAAGAGAAAGAGG - Intronic
916044281 1:160987372-160987394 CATTGGGATACAGGGGAAAAGGG - Intergenic
916304279 1:163311617-163311639 GAGGGAGAGAGATGGGAAAATGG + Intronic
916688674 1:167170765-167170787 AAGCGGGAGAGAAGAGATAAAGG + Intergenic
917172260 1:172190155-172190177 CGGTGGGGGTGCAGGGAAAAGGG - Intronic
917304090 1:173608967-173608989 AAGGGGAAGGGAAGGGAAAAGGG + Intergenic
917400388 1:174642751-174642773 GAGAGGGAGAGAGGGGAAGAAGG - Intronic
917537236 1:175883306-175883328 CAGAGGGAAAGAAGAGAAGAGGG - Intergenic
917621107 1:176796881-176796903 GAGTGGGAGGGAAGGAAGAAAGG - Intronic
917648637 1:177053776-177053798 TATTGGCAGGGAAGGGAAAAGGG - Intronic
917746301 1:178011247-178011269 CAGTGGGAAATGAGGGGAAAGGG + Intergenic
918015886 1:180632175-180632197 GAGTGGGAGTGAGGGGGAAACGG + Exonic
918104011 1:181400890-181400912 CCGTGGGAGAGCAGGGGAAGAGG - Intergenic
918493243 1:185105666-185105688 CAGAAGGAGAGGAGGGAAAGGGG + Intergenic
919061612 1:192641349-192641371 AAGAGAGAGAGAGGGGAAAAGGG + Intronic
919145488 1:193629345-193629367 CAGTGTGAGAAAAGAGAAACAGG + Intergenic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919273709 1:195384981-195385003 CAGAGGGCTAGAAGGGAAAATGG + Intergenic
919306438 1:195845270-195845292 CATAGGGACAGAAGGTAAAACGG - Intergenic
919535416 1:198781103-198781125 GAGAGGGAGAGAAAGAAAAAAGG + Intergenic
919666006 1:200293183-200293205 CAGTGGGGCAGAAGGAAAATGGG + Intergenic
920029960 1:203031072-203031094 TAGGGAGAGAGAGGGGAAAAGGG - Intronic
920084225 1:203403261-203403283 CAATTTGAGAGAAGGGAAATTGG - Intergenic
920116351 1:203624464-203624486 AAGAGGGAGGGAAGGGAAGAGGG + Intergenic
920157076 1:203962010-203962032 CATTGGGAGAGCAAGGCAAAAGG + Intergenic
920320641 1:205119552-205119574 GTGTGGGAGACAAGGGCAAAAGG - Intronic
920464000 1:206165820-206165842 GAGAGGGAGGGAAGGGAGAATGG - Intergenic
920662763 1:207931562-207931584 GAGGGAGAGAGAAGGGAGAATGG + Intergenic
920710128 1:208287115-208287137 CAGTGGGAAACCAGGGAAAATGG - Intergenic
920843510 1:209574802-209574824 GAAGGGGAGAGAAGGGAAAGAGG - Intergenic
921294727 1:213691107-213691129 CAGAGGAAGGGAAGGGAAGATGG - Intergenic
921803476 1:219428772-219428794 CAGGTGGAGAGAAAGAAAAAAGG - Intergenic
922523760 1:226281260-226281282 CAGAGGCTGGGAAGGGAAAAGGG + Intronic
923166334 1:231367001-231367023 AAGTGGAAGAGAAGGGGAACTGG + Intronic
923242448 1:232098907-232098929 AAGAAGGAGAGATGGGAAAAGGG + Intergenic
923273849 1:232380019-232380041 TGCTGGGAGAGAGGGGAAAAGGG - Intergenic
923342807 1:233022043-233022065 GAGTGGGAGAGAAGGGAGGAGGG - Intronic
923367104 1:233273497-233273519 CAGTTGGATAGAAGGAAAGAAGG - Intronic
923419934 1:233802819-233802841 CAGTGGGAGAGGAGGAGAAGGGG + Intergenic
923482355 1:234397258-234397280 GAGAGGGAGGGAAGGGAGAAGGG + Intronic
923773748 1:236960196-236960218 CAGTGAGAGATAATGGATAATGG + Intergenic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924146213 1:241077522-241077544 CAGTGGAAGGGGAGGAAAAAGGG + Intronic
924645890 1:245877059-245877081 CAGTAGCAGAGAAGAGAAAGAGG + Intronic
924703165 1:246474797-246474819 AAGTGGGAGGGAAGGAGAAAGGG - Intronic
1062822403 10:544532-544554 TAGTGGGAGGGGAAGGAAAATGG - Intronic
1062893915 10:1088492-1088514 CAGAGGGAGAGATGAGAGAAAGG + Intronic
1063049437 10:2430841-2430863 AAGAGGGAGGGAAGGAAAAACGG + Intergenic
1063091846 10:2872619-2872641 CATAGGGAGTGAAGGGCAAAGGG + Intergenic
1063188448 10:3670956-3670978 CATTGGGACAGCAGGGAGAAGGG - Intergenic
1063894765 10:10668275-10668297 CAGTGGGAGGGAAGATTAAAAGG - Intergenic
1064213658 10:13381778-13381800 GGCTGGCAGAGAAGGGAAAATGG + Intergenic
1064242835 10:13646578-13646600 CGTTGGGAGAGAACGGGAAAGGG - Exonic
1064348398 10:14554175-14554197 CAGTGGGAGGGTAGAGGAAAAGG - Intronic
1064405683 10:15060050-15060072 CAGAAGGAGAGAAGAGAAGAGGG - Intronic
1064445976 10:15393240-15393262 GAGGAGGAGAGAAGGGGAAAGGG + Intergenic
1064513705 10:16123435-16123457 TAGTAGGAGAAAAGTGAAAATGG - Intergenic
1064526395 10:16260691-16260713 TAGAGGGAGAGAAGGAAAAAAGG + Intergenic
1064934456 10:20664351-20664373 GAGTGAGAGAGAAGGGAAGGAGG - Intergenic
1065130251 10:22613080-22613102 CAATGGGAGTGAAGGGAAAAGGG + Intronic
1065475517 10:26133403-26133425 CAGAGGGAGAGAAGAGCAACAGG - Intronic
1065638272 10:27753126-27753148 AAGAGGGAGAGAAGGAGAAAGGG - Intergenic
1065852798 10:29804846-29804868 CAGTGGGAGATAATTGAATATGG + Intergenic
1066088394 10:31993760-31993782 CATGGGCAGAGAAGGGAAGATGG - Intergenic
1066584896 10:36922000-36922022 CAGGGAGAAAGAAGGGAAGATGG - Intergenic
1066951392 10:42121670-42121692 AAGAGGGAGAGAAGGAAAGAAGG - Intergenic
1067322264 10:45232312-45232334 CATGGGGAGTTAAGGGAAAATGG + Intergenic
1067349872 10:45466045-45466067 CAGTTGGAGAAAAAGGACAATGG - Intronic
1067452112 10:46388190-46388212 CAGTGGGTGAGAAGGAATTAAGG + Intronic
1067528119 10:47050470-47050492 GAGAGGGAGAGGAGGGAAAGAGG + Intergenic
1067585125 10:47471565-47471587 CAGTGGGTGAGAAGGAATTAAGG - Intronic
1067763677 10:49069561-49069583 CAGTGGGAGAGAAAGGACCAGGG + Intronic
1067807890 10:49405841-49405863 GAGTGGGAGGGAAGGGAAAGAGG - Intergenic
1067844604 10:49709846-49709868 TGCTGGGAGAGAAGGGAGAAGGG - Exonic
1068081382 10:52322232-52322254 GAGGGAGAGAGATGGGAAAATGG - Intergenic
1068573815 10:58660774-58660796 CAGGAGGAGAGGAGAGAAAAGGG + Intronic
1068806930 10:61206731-61206753 GAGAGAGAGAGAAGGCAAAAGGG + Intergenic
1068929002 10:62569421-62569443 AAGTGGAAGAGAACAGAAAACGG + Intronic
1068959390 10:62851389-62851411 CAGAGGGAGAGAAGGAAGAAGGG - Intronic
1069000712 10:63261004-63261026 AAGTAGGGGGGAAGGGAAAAGGG - Intronic
1069112157 10:64461326-64461348 CATAGGGAAAGAAGGGGAAAGGG + Intergenic
1069274012 10:66567010-66567032 AAGTGGGAGAAAAGGGACAAAGG + Intronic
1069303428 10:66937689-66937711 CAGTGGTAGAGCATGGGAAAGGG - Intronic
1069792486 10:71031889-71031911 CAGAGGAAGAGAAGGCAAAAGGG - Intergenic
1069893560 10:71666697-71666719 CTATGGGAGGGAAGGAAAAAGGG + Intronic
1070182370 10:74026588-74026610 CAATGGCAGAGAAGGAAAAAGGG + Intronic
1070605781 10:77897699-77897721 GAAAGGGAGAGAAGGGGAAAGGG + Intronic
1071270632 10:84003682-84003704 AAGTGGGAGAGAAAGTACAAAGG - Intergenic
1071468430 10:85961579-85961601 AGGAGGGAGAGAAGGTAAAAAGG - Intronic
1071481953 10:86071227-86071249 CACTGGGACAGCAGGGAAATGGG + Intronic
1071519519 10:86320488-86320510 CAGAAGGAGAGAAAGGAGAATGG + Intronic
1071736235 10:88303772-88303794 AAGTGGGAGTGAAGGGGAAGGGG - Intronic
1072448765 10:95522027-95522049 GAGTGGTAGAAAAGTGAAAATGG + Intronic
1072757164 10:98029334-98029356 AAGTGGAAAAGAAGGGAAGAGGG - Intronic
1072770269 10:98132093-98132115 AGGTGGGAGAGAAGGGGAAAGGG + Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1072801406 10:98394763-98394785 CAGTGAGAGAGAAGGGAGAATGG + Intronic
1073030799 10:100524140-100524162 CTGTGAGAGAGAAGGAGAAAGGG + Intronic
1073096424 10:100983084-100983106 CATGGAGAGAGAATGGAAAAGGG + Intronic
1073605756 10:104894238-104894260 TAGTGTTAGAGGAGGGAAAAAGG + Intronic
1073615362 10:104989766-104989788 CAGTGGAAGAGGAGGCACAATGG + Intronic
1073678384 10:105675648-105675670 CAGAGGGAGAGAAGAGGAAAGGG - Intergenic
1073943223 10:108721417-108721439 CAGCAGGAGAGAGGGCAAAAGGG + Intergenic
1074325938 10:112450833-112450855 CTGTGGGAAAGTAAGGAAAAGGG + Intronic
1074437194 10:113444254-113444276 CAGTGGGAAAGAAGGACAGAGGG - Intergenic
1074595557 10:114862352-114862374 GAGAGGGAGAGGGGGGAAAAAGG - Exonic
1074936809 10:118190132-118190154 CAGTGCCAGAGAAGGATAAAGGG + Intergenic
1075115944 10:119627331-119627353 CAGATGAAGAGAAGGGAGAATGG + Intergenic
1075118054 10:119643689-119643711 CACTGGGAGAGAAGGGCTACAGG - Intergenic
1075189282 10:120291596-120291618 TAGTGGGAGAAACAGGAAAATGG + Intergenic
1075293950 10:121255948-121255970 CAGGGGAGGAGAAGGGAAATGGG + Intergenic
1075356239 10:121779475-121779497 CAGTGGGAGTGAAGATAAAACGG - Intronic
1075364322 10:121870634-121870656 AGGTGAGAGAGAAGGGAGAAAGG - Intronic
1075452549 10:122562133-122562155 GAGAGGGAGAGAAAGAAAAAGGG - Intronic
1075993038 10:126854107-126854129 CAGAGGAAGAGAAGAGAGAAAGG + Intergenic
1076067426 10:127459827-127459849 CTGTGGGTGAGAGGGGAGAAAGG + Intergenic
1076103456 10:127801468-127801490 CAGTGGGAGAGGACGCATAAAGG - Intergenic
1076150582 10:128159230-128159252 GTGTGGGAGAGCAGGGCAAAGGG + Intergenic
1076405944 10:130212666-130212688 CAGTGGGAGGGGAGGGGAAGGGG - Intergenic
1076550606 10:131275582-131275604 GAGAGGGAGAGAGGGGGAAAAGG + Intronic
1077180305 11:1209282-1209304 AAGGGGGACAAAAGGGAAAAGGG - Intergenic
1077294818 11:1821321-1821343 AGGAGGGAGAGAAGGCAAAATGG + Intergenic
1077354347 11:2108268-2108290 CAGAGGGAGTGAAGGGAGAGAGG + Intergenic
1077374936 11:2201241-2201263 GAGAGGGAGAGATGGGTAAAGGG + Intergenic
1077392798 11:2307783-2307805 CAGTGAGAGAGAGGGGACAGTGG + Intronic
1077484245 11:2831652-2831674 CAGTGGTGGGGAAGGGGAAAGGG - Intronic
1077560964 11:3260722-3260744 CTGTGGGAGAGGAGGGTAATTGG + Intergenic
1077566861 11:3306552-3306574 CTGTGGGAGAGGAGGGTAATTGG + Intergenic
1078107470 11:8367578-8367600 GAGTAGTAGAGAAGGGAAAGGGG + Intergenic
1080880819 11:36318805-36318827 AGGTGAGAGAGAAGGGAAATGGG + Intronic
1080908069 11:36566751-36566773 CACTGGGAGAGAGGAGAAACTGG - Intronic
1081634954 11:44714849-44714871 GAGAGGGAAAGAAGGGAAGATGG + Intergenic
1081662493 11:44896618-44896640 CAGAGGTAGAGATGGGAAGATGG - Intronic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1082122912 11:48398911-48398933 CAGAGGGAGAGAAAAGAAAGAGG + Intergenic
1082556613 11:54570188-54570210 CAGAGGGAGAGAAAAGAAAGAGG + Intergenic
1082933981 11:58637853-58637875 AGGTGGGAGAGAAGAGAGAATGG - Intergenic
1083148048 11:60773208-60773230 CAGGGGAGGAGAAGAGAAAAGGG + Intronic
1083250574 11:61464108-61464130 GAAGGGGAGGGAAGGGAAAAGGG - Intronic
1083433157 11:62625379-62625401 TGGTGGGAGGGAAGGGGAAAAGG + Exonic
1083906156 11:65672299-65672321 AAGCTGGAGAGAAGGGGAAATGG + Intergenic
1084368211 11:68717528-68717550 CAGATGGAAAGAAGGGAAAGGGG + Intronic
1084985723 11:72869373-72869395 CAGGGCAAGAGAAGGGGAAAGGG + Intronic
1085122981 11:73979221-73979243 CATTGGGAGAGAAGGAAGAGTGG + Intronic
1085152354 11:74262391-74262413 CAGAGAGAAAGAAGGGAAAGAGG + Intronic
1085173292 11:74466702-74466724 CCATGGGACAGAAGGGGAAAGGG - Intronic
1085212495 11:74793846-74793868 CAGTGGGAAGAAAGGTAAAAAGG - Intronic
1085534033 11:77207486-77207508 CTGGGGGAGAGAGGGGAAGAGGG + Intronic
1087088741 11:94246218-94246240 CAGTAGGAGAAAAGAAAAAATGG + Intergenic
1087309410 11:96522211-96522233 CAGTTGTAGAGAAGGTAAAATGG - Intergenic
1087315227 11:96594531-96594553 CAGTTTGAGAGAAAGGCAAATGG - Intergenic
1087621443 11:100547378-100547400 CAGAGGGAAAGAAGGAAAATTGG + Intergenic
1088257406 11:107914232-107914254 CAGTGCTGGAGAAGGCAAAAAGG + Intronic
1088351264 11:108890963-108890985 CAGAGGGAGAGCAGGGAGAAAGG - Intronic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1088807442 11:113365376-113365398 GAGTGGGAGGGAGGGGAAGAAGG - Intronic
1088814070 11:113409782-113409804 CAGTGGAAGGGAAGGGAAACAGG + Exonic
1088835934 11:113577996-113578018 CTGGGGCTGAGAAGGGAAAAGGG + Intergenic
1089361199 11:117887818-117887840 CACTGGGAGAGCAGGAGAAATGG - Intergenic
1089481733 11:118811242-118811264 CAATGGGAGAAAAAGGTAAAGGG + Intergenic
1089766703 11:120772812-120772834 CCCTGGGACAGAAGGGAAAGTGG + Intronic
1090062708 11:123477651-123477673 AAGGGAGAGAGAAGGGAAAGGGG - Intergenic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1091372594 11:135073300-135073322 CAGAGGGTGAGAAGCGAGAAGGG + Intergenic
1091649890 12:2302217-2302239 CAGTGGGAGAGAATGGCGAATGG - Intronic
1091699099 12:2648363-2648385 CAGTGGCAGAAGAGGGCAAAAGG - Intronic
1091823448 12:3492548-3492570 CAGCTGGAGAGTAGAGAAAAAGG - Intronic
1091908051 12:4205347-4205369 CAGTGGGAGAGCAAGGACAAAGG + Intergenic
1092223011 12:6728142-6728164 AAGTGGGAGGGAAGGGAAGGAGG + Intronic
1092576039 12:9783380-9783402 CAGGCAGAGAGAAAGGAAAAGGG - Intergenic
1092798210 12:12135354-12135376 AAGTGGGAGAGAAGAGAAAAAGG + Intronic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1093928727 12:24934006-24934028 GGCTGGCAGAGAAGGGAAAATGG + Intronic
1093980735 12:25472479-25472501 CAATGGGAGCAAATGGAAAAAGG + Intronic
1094687040 12:32728105-32728127 CAGTGGGGGAGATGGGGGAAAGG - Intronic
1095560347 12:43557349-43557371 CAGGGGGAAAGAGGGGGAAATGG - Intergenic
1095599956 12:44002738-44002760 CACTGGTAGAGAAGGAAGAAGGG - Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1096071886 12:48780066-48780088 CAGTGGGGGAGAAGGGAAGGGGG + Intronic
1096081680 12:48837486-48837508 GTGTGGGAGAGAAGTGAAGATGG + Intronic
1096188480 12:49599383-49599405 CAGTGGGAGAGAAGGAACACAGG - Intronic
1096309225 12:50505379-50505401 GGGTGGGAGAGGAGGGAAAACGG - Intronic
1096453982 12:51770275-51770297 CAGTGAGAGGGAGGAGAAAAGGG - Intronic
1096866298 12:54565665-54565687 AAATGGGACAGAAGGGAAAGTGG - Intronic
1097295286 12:57956443-57956465 CAGTGGGAAAGATGAGAAAATGG + Intronic
1098080848 12:66784061-66784083 CAGAGGGACAGCAGGGAAAATGG + Intronic
1098092858 12:66922728-66922750 CAGAGGGAGAAAAGGGGGAAGGG - Intergenic
1098120947 12:67237410-67237432 CAGCGGGAGAGAAAGCAAGAGGG - Intergenic
1098138544 12:67428309-67428331 CAGTGGGAGAGAAAAGCCAAGGG + Intergenic
1098246978 12:68530014-68530036 CAGTGGGGGAGAGAGGAAGAGGG + Intergenic
1098551752 12:71770219-71770241 CACTGGGAGAGACAGGGAAATGG - Intronic
1098601759 12:72339886-72339908 CCCTGGGAGAGAAGGGGTAAGGG + Intronic
1099610273 12:84858558-84858580 CACTGGCAAAGAAGAGAAAATGG + Intergenic
1099713293 12:86257242-86257264 CAGTGGGAGAGGAGGATAATGGG + Intronic
1099899062 12:88684609-88684631 CACTGGGAGAGAGGATAAAAGGG - Intergenic
1100637951 12:96453622-96453644 AAGGGGGAGGGAAGGGGAAATGG + Intergenic
1100671541 12:96818653-96818675 GAGTGGGGCAGAAGGGAAATGGG - Intronic
1100711405 12:97260916-97260938 CAGTGGGAGAAAAATGACAATGG + Intergenic
1100722033 12:97369341-97369363 CAGGGGGAAAGGATGGAAAAGGG + Intergenic
1100911506 12:99368694-99368716 CAGTGGTTGAGAAAAGAAAACGG + Intronic
1101054960 12:100903015-100903037 AAGTGGCAGAAGAGGGAAAAGGG - Intronic
1101116214 12:101533958-101533980 CTGTGGGAGAGAGGAGAAATGGG - Intergenic
1101276347 12:103205976-103205998 CAGCGGCTGAGAAGGGAACATGG - Intergenic
1101479831 12:105085554-105085576 CAGTGAGAAATAAGAGAAAATGG - Intergenic
1101720212 12:107344363-107344385 AAGAGGGAGAGAAGGGAAATTGG + Intronic
1101731719 12:107432281-107432303 AATTGGGAGAGAAGGAAAGAGGG + Intronic
1101843234 12:108342390-108342412 GAGTGGGAGAGAAGAGAAGGAGG + Intergenic
1102517505 12:113459784-113459806 AAGAGGAAGAGAAGGGAGAAAGG - Intergenic
1102587175 12:113931614-113931636 TGACGGGAGAGAAGGGAAAAGGG - Intronic
1102809342 12:115810564-115810586 GGGTGGGAGAGAAGGGAAATGGG + Intergenic
1103225238 12:119281853-119281875 GAGGGGGAGAGTAGTGAAAAGGG - Intergenic
1103351613 12:120287567-120287589 CAGGTGGAGAGAAGGGAGAAGGG - Intergenic
1103352293 12:120292609-120292631 CAGTGCGAGAGAAAGAAAACAGG + Intergenic
1103522587 12:121546336-121546358 AGATGGGAGAGAAGTGAAAAGGG - Intronic
1103566117 12:121816674-121816696 CATGGGAAGAGAAGAGAAAATGG + Intronic
1103773987 12:123351762-123351784 CAGAGAGAAAGAAGGGGAAATGG + Intronic
1103940723 12:124499911-124499933 CAGCGACAGAGAAGGGGAAATGG + Intronic
1104337678 12:127915340-127915362 GTGTGGGAGGGAAGGGGAAAAGG - Intergenic
1105514515 13:21077579-21077601 GAGAGGGAGAGAAAAGAAAAAGG - Intergenic
1105719365 13:23099129-23099151 TACTGGGAGAGAAGGAAAAATGG + Intergenic
1105881356 13:24609037-24609059 CTTTGGGAGAGAAGGGAAGCTGG - Intergenic
1106075488 13:26457352-26457374 AAGTGGGAGAGGAGGGGACAAGG - Intergenic
1106099222 13:26680107-26680129 GAGTGGGAGAGAAGGAAAATGGG + Intronic
1106575585 13:30971441-30971463 CAGAGAGAGAGAAAGGGAAAAGG + Intronic
1106953319 13:34908550-34908572 GAGAGGGAGGGAAGGAAAAAGGG - Intergenic
1107351989 13:39524503-39524525 CACTGAAAGAGAAGGGAACAAGG + Intronic
1107364261 13:39653483-39653505 GGGTGGTAGAGAGGGGAAAATGG + Intergenic
1107484185 13:40810724-40810746 CTTTGGGAGAGAAGGGAAGCTGG - Intergenic
1107571639 13:41666361-41666383 CAATGAGAGAAAAGGGAGAAAGG - Intronic
1108200609 13:48039298-48039320 CAGAGGTAGAGCAAGGAAAAAGG - Intronic
1108953772 13:56124279-56124301 TAGCGGGAGAGAAAGGAGAATGG - Intergenic
1109411052 13:61969993-61970015 AAATGGGACAGAAGTGAAAATGG + Intergenic
1109747657 13:66647666-66647688 AGGTGGGAGAGAAGAGTAAAGGG + Intronic
1110176712 13:72565413-72565435 AGGTGGGAGAGAAGGGAGAGAGG - Intergenic
1110528717 13:76571538-76571560 AGGTGGGGGAAAAGGGAAAAGGG - Intergenic
1110920306 13:81076009-81076031 CAGTGGAAGAGTAGGGAAAGGGG + Intergenic
1111331406 13:86764419-86764441 CAGAGAGGGAGAAGGGAACATGG + Intergenic
1111858087 13:93665682-93665704 GAGTGGGACAGAAGAGATAATGG + Intronic
1111919707 13:94397210-94397232 CAGTGAGAGAAATGGGAAATGGG + Intronic
1111956225 13:94761451-94761473 GAGTGTAAGAGAAGGGAACAGGG - Intergenic
1112514418 13:100039743-100039765 CAGAGCCAGAGAAGAGAAAATGG + Intergenic
1112517669 13:100069103-100069125 CAATGGGTGAGATGGGAATAGGG + Intergenic
1112662134 13:101522003-101522025 CAGTGGGAGAGAAAGAGAGAGGG + Intronic
1113312588 13:109146446-109146468 CAGTGCCAGAGGAGGGAAATGGG - Intronic
1113339918 13:109412432-109412454 CAGTGTGAGGGAGGGGAAGAGGG - Intergenic
1113556959 13:111244550-111244572 CTCTGGGAGAGAAAGGAGAATGG + Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114210400 14:20609309-20609331 AACTGGGAGAGAAAGAAAAAAGG + Intronic
1114254198 14:20987956-20987978 GAGAAGGAGAGAAGGGAGAAAGG - Intergenic
1114261435 14:21039392-21039414 CAGTGGGAGAGAAGACAGAAGGG - Intronic
1114450066 14:22819610-22819632 AGGTGGGAGAGGAGGGACAATGG - Intronic
1114517398 14:23308793-23308815 CTGTGGGAGAGAAGGGAAGCAGG - Intronic
1114866135 14:26597728-26597750 CAGGGGGAGAGAGTGGAGAAGGG + Exonic
1115030008 14:28784050-28784072 CAGTTGGAGAATAGGGAAAAGGG + Intronic
1115406839 14:33026880-33026902 CAGGGGGAAAAAAGGGAAAGGGG - Intronic
1115434061 14:33353806-33353828 CAGTGGGCAAGAAGGGACAGAGG + Intronic
1115984041 14:39085086-39085108 CAGAAGGAGAGAGGGGATAATGG + Intronic
1116411617 14:44631116-44631138 AAGAAGGAAAGAAGGGAAAAGGG + Intergenic
1116630163 14:47320533-47320555 AAGTGGTAGAGAGAGGAAAATGG - Intronic
1116749385 14:48863900-48863922 CAGAGGGAAAGAAGGGGACAAGG + Intergenic
1117404027 14:55384428-55384450 CAGTTGGAGAGAGGTGAATAAGG - Intronic
1117434837 14:55706005-55706027 AAGTAGGAGAGAAAGTAAAATGG - Intergenic
1117483937 14:56174863-56174885 TAGTGGGAAAGGAGGGTAAAAGG - Intronic
1117525582 14:56599235-56599257 CAGAGGGACAGGAGGGCAAAAGG - Intronic
1117764491 14:59066819-59066841 GAGGGTGAGAGATGGGAAAATGG + Intergenic
1117834917 14:59794004-59794026 CAGTGGGAGAGGAGTGTAATGGG - Intronic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1118112473 14:62736873-62736895 CAGTGGGATATAAGGTCAAAAGG - Intronic
1118411137 14:65479607-65479629 AAGAGGGAGAGCAGGGGAAAGGG - Intronic
1118760692 14:68878902-68878924 CAGACAGAGAGAAGAGAAAAAGG + Intronic
1118978491 14:70697722-70697744 CACAAGGAGAGAAGAGAAAAAGG + Intergenic
1119477376 14:74938962-74938984 CTGTGTGAAAGAAGAGAAAAGGG - Intergenic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1119554365 14:75542028-75542050 CAGTGTGAGAGAAGGAACACAGG + Intronic
1119678394 14:76573460-76573482 CAGAGGGAGAAAAAGGAAAGGGG + Intergenic
1119946747 14:78703323-78703345 CTGAGGGAGAGAAGGGAAGTGGG + Intronic
1120189762 14:81429967-81429989 AAGTGGGAGAGAAGGGAAGTCGG - Intronic
1120307146 14:82785202-82785224 CAGTGGGAGGGAGAGGAGAAAGG + Intergenic
1120313832 14:82866260-82866282 GAGTGGGAGAGAGGGGAGATGGG + Intergenic
1120486211 14:85116669-85116691 CAGTGGGAAATAAGTGAGAAAGG - Intergenic
1120700258 14:87691422-87691444 GAGGGGGAGGGAAGGGAAAATGG - Intergenic
1120860061 14:89246987-89247009 AAGAGGGAGAGAAGGGAGGAAGG - Intronic
1121178271 14:91907230-91907252 AAGGAGGAGAGAAGGGACAAGGG - Intronic
1121374318 14:93393101-93393123 CAGTGAGACAGAGAGGAAAATGG + Intronic
1121445614 14:93977017-93977039 GAGTGAAAGAGAAGGGAAGAAGG + Intergenic
1121629518 14:95412238-95412260 CAGTGGGAGAGCTCGGAACAGGG - Intronic
1121638186 14:95467741-95467763 CAGTGGGCAAGGAGGGTAAATGG + Intronic
1121640770 14:95483418-95483440 CAGTGGGAAAGAGAGGATAAGGG - Intergenic
1122253879 14:100462872-100462894 GAGGGAAAGAGAAGGGAAAAAGG - Intronic
1122253893 14:100462921-100462943 GAGAAGGGGAGAAGGGAAAAAGG - Intronic
1122253909 14:100462976-100462998 GAGAAGGGGAGAAGGGAAAAAGG - Intronic
1122253925 14:100463031-100463053 AAGAAGAAGAGAAGGGAAAAAGG - Intronic
1122392488 14:101399798-101399820 GAGAGGGAGGGAAGGAAAAAAGG + Intergenic
1124013601 15:25859161-25859183 GAGGGGAAGAGAAGGGCAAAGGG - Intronic
1124115094 15:26833943-26833965 GAGTGGGAGAGAGGGGAATTTGG - Intronic
1124406391 15:29396255-29396277 CTGGGGGAGAGAGGGGAAAGGGG - Intronic
1124441969 15:29691975-29691997 TAGTGGGGGAGCATGGAAAATGG + Intergenic
1124468456 15:29961715-29961737 CAGGTGAAGAGAAGGGAAATGGG - Intronic
1124919657 15:34013734-34013756 CAATGGGGGAGAAGGGGGAATGG + Intronic
1125278915 15:38024114-38024136 CAGCTGGAGAGAAGGGACAATGG + Intergenic
1125315897 15:38430720-38430742 CAGAGAGAGAGAAAGGGAAAAGG - Intergenic
1125617803 15:41031404-41031426 AAGTGAAAGAGAAGGGAAGAGGG + Intronic
1125886203 15:43231478-43231500 CAGTGGGATAGAAGGGCATGTGG - Intergenic
1126785394 15:52174450-52174472 CTGTGGGAGGAAGGGGAAAATGG + Intronic
1126951314 15:53884813-53884835 CAGTAGGAGTAAAGGGAAAGAGG - Intergenic
1127013279 15:54653876-54653898 TAATGGGAAAGAAGGGAAGAAGG - Intergenic
1127217919 15:56844411-56844433 GAGTGGGGGAGAGGGGGAAAGGG - Intronic
1127267502 15:57374028-57374050 AAGGGGAAGGGAAGGGAAAAGGG - Intergenic
1127293324 15:57589701-57589723 AAGTGGGAAAGAAGGAAAATGGG - Intergenic
1127322754 15:57863563-57863585 GAGTGGGTGAGAAGGGAAATGGG - Intergenic
1127546423 15:59997475-59997497 GAGGGGGAGAGAAGGAGAAAGGG + Intergenic
1127586403 15:60382108-60382130 AAGAGGGAGAGAAGGAAGAAAGG + Intronic
1128562567 15:68678322-68678344 CAGTGTGAGGGAGGGGAGAAAGG - Intronic
1128626143 15:69206498-69206520 AAATGGAAGAGAAGGGACAAAGG - Intronic
1128705012 15:69832266-69832288 GAGTGAGAGGGAAGGGAGAAGGG + Intergenic
1129192018 15:73942821-73942843 CAGTGGGAGAGAAGGGGGGAGGG - Intronic
1129793685 15:78360344-78360366 CAGAGAAAGAGAAGGGAAGAGGG + Intergenic
1129918764 15:79299926-79299948 AAGTGGAAGAGAAGGGAAAGAGG + Intergenic
1130009203 15:80135050-80135072 CAGAGGTGGAGAAGGTAAAAGGG - Intronic
1130379265 15:83357703-83357725 GAGAGGGAGAGAAGGAAGAAAGG + Intergenic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130636608 15:85627487-85627509 CAATGGGAGAGTAGGGAGGAAGG - Intronic
1130751009 15:86713147-86713169 CAGTGGAAGAAAAGGAGAAAGGG - Intronic
1130781967 15:87049346-87049368 GAGGGAGAGAGAAGGGGAAATGG + Intergenic
1130923957 15:88371371-88371393 CAGAGGCTGAGAATGGAAAAAGG - Intergenic
1130962735 15:88674145-88674167 CAGTGGGGGAGATGGGTGAATGG + Intergenic
1131545665 15:93313674-93313696 AAGAGGGAGAGAAGGGAAGCGGG - Intergenic
1131662877 15:94537632-94537654 GAGAGGGAGAGAAAGGAAGAGGG + Intergenic
1132082343 15:98877456-98877478 CATTGGGAAAGAAAGAAAAATGG + Intronic
1132358241 15:101189573-101189595 AAGTGAGAGAGAAAGGGAAAGGG + Intronic
1133368322 16:5228610-5228632 GAGGGGGAGGGGAGGGAAAAAGG + Intergenic
1133842778 16:9425099-9425121 AAGAGGGAGAGAGGGGGAAAAGG + Intergenic
1133853182 16:9525159-9525181 GAGTGGGAGAGACTGGGAAATGG - Intergenic
1134167333 16:11941303-11941325 CAGGGGGAGGGAAGGGGACAGGG + Intronic
1134229555 16:12418406-12418428 GAGTGGGTGAGAAGGAGAAAGGG + Intronic
1134233879 16:12450585-12450607 CGGTGTGAGAGAAGGGAAGACGG + Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135087642 16:19487895-19487917 CAGAGGGAGTGAGGGGAAACGGG + Intronic
1135293580 16:21260764-21260786 AAGTGGGAGAGTAGGGAAGGAGG + Intronic
1135574354 16:23573820-23573842 CAGGGGCAGAGAAGGGAAAGGGG + Exonic
1135826168 16:25730656-25730678 CAGAGGGAGAGAAGGAAGAGAGG - Intronic
1136242745 16:28954535-28954557 CAGAGGAAGAGAAGGTAGAAGGG - Intronic
1136246539 16:28979378-28979400 GGGAGGGAGAGAGGGGAAAAAGG - Intronic
1136281378 16:29213427-29213449 CAGTGGGAGAGGAAGCCAAAGGG - Intergenic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1136566658 16:31074524-31074546 AGGTGGGAGGGAAGGGAAAGAGG - Exonic
1137718594 16:50613807-50613829 CCCCGGGAGAGAAGGGGAAAGGG - Intronic
1137770256 16:51010668-51010690 CAGGGGAAGAGGTGGGAAAAAGG - Intergenic
1137800876 16:51260919-51260941 CTGAGGGAGAGAAGGAAGAAGGG - Intergenic
1138421342 16:56901242-56901264 TAAATGGAGAGAAGGGAAAAGGG - Intronic
1138489173 16:57366244-57366266 CAGTGGGATAGAGGGGATCATGG - Intergenic
1138505354 16:57475751-57475773 GAGAGGGAGAGAGGGGAGAAAGG - Intronic
1138589705 16:57993171-57993193 GAGGGGCAGGGAAGGGAAAATGG + Intergenic
1138699503 16:58847048-58847070 CAGAGGGAGAGGAGGGAGAGGGG + Intergenic
1139175591 16:64683403-64683425 CAGTGGGAGATAACTGAACATGG - Intergenic
1139290160 16:65850662-65850684 AGGAGGGAGAGAGGGGAAAAAGG + Intergenic
1139445472 16:66995606-66995628 CCTGGGAAGAGAAGGGAAAAGGG - Exonic
1139511859 16:67432241-67432263 CAGAGGGAGGGAAGGGGAAGGGG + Intronic
1139811390 16:69621403-69621425 AAGTGAGAGAGAAGGGATATGGG - Intronic
1139959460 16:70709456-70709478 CAGCGGGAGAGTGGGGTAAAAGG - Intronic
1140186612 16:72778707-72778729 CAGGGGAAGTGAAGGGAGAAGGG + Intergenic
1140333074 16:74076533-74076555 CAGTGGGAGGGAGGGAAAGAAGG - Intergenic
1140638437 16:76943857-76943879 CAGAGGGGGAGAAGGAAGAAAGG - Intergenic
1140766274 16:78161402-78161424 GAGAGAGAGAGAAAGGAAAAAGG - Intronic
1140804006 16:78515995-78516017 GAAGGGGAGAGAAGAGAAAAGGG - Intronic
1140905734 16:79407465-79407487 CAGAGGGAGAGAGGGAAAGAGGG - Intergenic
1141394693 16:83694331-83694353 CAGTGGGAGAGAATGGGAGTGGG + Intronic
1141603943 16:85142525-85142547 CTGTGGGGGAGAGGGGAATAAGG - Intergenic
1141642502 16:85349469-85349491 GGGAGGGAGAGAAGGGAACATGG - Intergenic
1141713995 16:85716552-85716574 CAGAGGGAGGGAAGGGGAGAGGG + Intronic
1141732700 16:85833596-85833618 GAGTGGGAGTGAGGGGAAAGCGG - Intergenic
1141845028 16:86602603-86602625 GTGTGGAAGAGAATGGAAAAGGG - Intergenic
1141931385 16:87206476-87206498 GAGTGAGAGAGAAGACAAAAGGG + Intronic
1142085748 16:88179355-88179377 CAGTGGGAGAGGAAGCCAAAGGG - Intergenic
1142320148 16:89376831-89376853 CACTGGGATAGAAGGCAAGAAGG + Intronic
1142789665 17:2254237-2254259 AAGTGAGAGAGAAGAGGAAATGG + Intronic
1143030900 17:3966573-3966595 CAGTGGGGGAGAAAGGAATAGGG - Intergenic
1143052409 17:4137060-4137082 CACTGGGAGACAAGGGTAGAAGG + Intronic
1143071188 17:4294954-4294976 GAGAGGGAGAGAAGGGGAAAAGG + Intronic
1143165884 17:4897122-4897144 GAGAGGGAAAGAAGGGAAGAAGG - Intronic
1143266647 17:5642977-5642999 GAGGGGAAGGGAAGGGAAAAAGG - Intergenic
1143539097 17:7558940-7558962 CAGTGGTGCAGAAGGGAAGAAGG - Exonic
1143637722 17:8176039-8176061 CACAGGAAGAGAAGTGAAAAAGG + Intronic
1143870789 17:9956192-9956214 CTGCAGCAGAGAAGGGAAAATGG + Intronic
1143909660 17:10237258-10237280 CAGAGGGAGAGAAGGAGAGAGGG + Intergenic
1144057359 17:11554921-11554943 AAGTGGGAGAAAAGGTGAAAGGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144100887 17:11941328-11941350 CAGAGGGAGAGAGGGGAAGGAGG - Intronic
1144848253 17:18231181-18231203 CAGTGGCAGTCAGGGGAAAAAGG - Intronic
1145405295 17:22585062-22585084 TATTGGGAAAAAAGGGAAAAAGG + Intergenic
1146896808 17:36547974-36547996 TGTTGGGAGAGAAGGGGAAAAGG + Intronic
1147219969 17:38922775-38922797 CAGTGGTAGAGAGGGGAATCTGG + Intergenic
1147917738 17:43898659-43898681 GAGGTGGAGAGAAGGGAGAAAGG + Intronic
1148239068 17:45988162-45988184 CAATGGGAGAGGAGGGACACAGG - Intronic
1148261433 17:46187104-46187126 CAGAGGGTGTGAAGGGAAAGAGG - Intronic
1148676557 17:49448886-49448908 GGCTGGGAGAGAAGGGAGAAGGG + Intronic
1149591103 17:57830637-57830659 CTATGTGAGAGAAGAGAAAAGGG - Intergenic
1150071763 17:62156989-62157011 CAGTGACAGAGAAAGGAAGAAGG - Intergenic
1150182910 17:63145303-63145325 GAGTGGGAAAGAAGGGTAGAAGG - Intronic
1150183315 17:63151168-63151190 CAGGGAAAGAGAAGGAAAAAGGG - Intronic
1150198070 17:63321912-63321934 CTGTGGAAGAGAAGGGTGAAGGG - Intronic
1150279157 17:63918869-63918891 CAGTGGGAGAGAAGGGGCCAGGG - Intergenic
1150530605 17:65977552-65977574 ATGTGGCAGAGAAGGGAAGATGG + Intronic
1150784080 17:68148968-68148990 TAAAGGGAGTGAAGGGAAAATGG + Intergenic
1150885862 17:69084888-69084910 CAGTGGCAGAGCAGGGATGAGGG - Intronic
1150905826 17:69336123-69336145 CCATGGGAAAAAAGGGAAAATGG - Intergenic
1150997050 17:70330768-70330790 CAGTAAAAGAGAAGGCAAAAAGG + Intergenic
1151226111 17:72649391-72649413 CAGTAGGAGAGGAAGGAGAAAGG + Intronic
1151419174 17:73986125-73986147 CAGTGAGAGAGCCTGGAAAATGG - Intergenic
1151495510 17:74455778-74455800 CAGGGGGAGAGATGAGGAAAGGG - Intergenic
1151760963 17:76103094-76103116 CAGAAGGAGAGAAGGAAGAATGG + Intronic
1151788154 17:76286487-76286509 CTGAGGGACAGAAGGGAACAGGG + Intronic
1151876887 17:76871955-76871977 CAGGGGGACAGCAGGGAACAAGG - Intronic
1152098218 17:78285253-78285275 CTGGGGGAGGGAAGGGGAAATGG + Intergenic
1152165504 17:78702285-78702307 CAGTTGAAAAGAAGGGGAAAGGG + Intronic
1153210040 18:2752455-2752477 GAGTAGGAGAGAAGGGGAGAGGG - Intronic
1153302485 18:3603337-3603359 GAGGGAGAGAGAAAGGAAAAGGG + Intronic
1154158572 18:11962793-11962815 CAGTGCAAGAGGAGGGATAAAGG - Intergenic
1154319738 18:13338074-13338096 AAGGGAAAGAGAAGGGAAAAGGG - Intronic
1154384261 18:13879484-13879506 CAGTGACGGAGAAGGGACAATGG + Intergenic
1155122622 18:22838584-22838606 AAGTGGGGAAGAAGGGGAAATGG - Intronic
1155137616 18:23011845-23011867 GAGGAGGAGAGATGGGAAAATGG - Intronic
1155384415 18:25261606-25261628 AAGGGAGAGAGAAGGAAAAAGGG - Intronic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1155859508 18:30879324-30879346 CATTGTGAGAGAAGGGGCAATGG + Intergenic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1156187179 18:34676840-34676862 GAGAGGGAGAGAATGGAGAAAGG + Intronic
1156292035 18:35755771-35755793 CAGGTGGAGAGGAGGCAAAAGGG - Intergenic
1156429356 18:37054666-37054688 GAGTGGAAGAGTGGGGAAAAGGG + Intronic
1156573749 18:38288507-38288529 GATAGAGAGAGAAGGGAAAAAGG + Intergenic
1156696311 18:39772580-39772602 CAATGGGAAAGAAAGGGAAAGGG - Intergenic
1157015637 18:43709382-43709404 CAGTAGAAGAGGGGGGAAAATGG + Intergenic
1157490246 18:48118376-48118398 CAGTGGCACAAAAGGGGAAAAGG - Intronic
1157490535 18:48120703-48120725 CACTGGGGGAGGAGGGAAAGTGG + Intronic
1157708871 18:49834266-49834288 CAGAGGGAGAGTCAGGAAAAAGG - Intronic
1157788567 18:50509033-50509055 AAATGGGGGAGGAGGGAAAAAGG - Intergenic
1157870886 18:51229254-51229276 CAGAGGAAGAGAAGAGAAGATGG - Intergenic
1158793682 18:60814470-60814492 CAGTGGTAGAAAATGTAAAATGG - Intergenic
1158905051 18:62003663-62003685 GAGTGGGAGAGAAAGAAATAAGG + Intergenic
1159783045 18:72681516-72681538 GAGTGGGAGAGAAGTGGAGAGGG - Intergenic
1160107704 18:75993991-75994013 CAGAAAGAGAGGAGGGAAAAGGG - Intergenic
1160377550 18:78424772-78424794 AGGTAGGAGAGAAGGGCAAAAGG - Intergenic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1160659533 19:291591-291613 GAGGGGGAGGGAAGGGAAGAAGG + Intergenic
1161137522 19:2628707-2628729 CAGAGAGACAGAAGGGAGAATGG - Intronic
1161217356 19:3101095-3101117 CAGTTTGACAGAAGAGAAAACGG - Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161267389 19:3370604-3370626 GAGAGGGAGAGAAGGGAGACGGG - Intronic
1161403749 19:4080816-4080838 TATGGGGAGAGAAGGGGAAAGGG + Intergenic
1161497191 19:4593049-4593071 GAGTGGGAGAGAAGGAAGACTGG + Intergenic
1161551725 19:4916706-4916728 CGGAGGGAGAGAAGGGAGGAAGG - Intronic
1161803497 19:6429341-6429363 AAGAGGGAGAGGAGGGAGAAAGG + Intronic
1161821643 19:6533801-6533823 CAGGGGGAGGGAAGGGGGAAGGG - Intronic
1162843751 19:13375309-13375331 AAGCGGGAGAGATGGGGAAATGG - Intronic
1163196130 19:15721805-15721827 GAGTTTCAGAGAAGGGAAAAGGG - Intergenic
1163388648 19:17015914-17015936 CACAGGGAGAGAAGGCAAGAAGG + Intronic
1163402624 19:17103387-17103409 CTGAGGGAGAGAGGGAAAAAGGG + Intronic
1163448160 19:17359904-17359926 CAGAGGGAGAGAAGGGGGAGTGG - Intronic
1163675133 19:18651931-18651953 CAGTGGGAGGGAATGGGAAAGGG + Intronic
1164544094 19:29144790-29144812 CAGAGCCAGAGAAGGGAAAATGG - Intergenic
1164901202 19:31926002-31926024 AAGGGAGAGAGAAGGGGAAATGG + Intergenic
1165158174 19:33800560-33800582 CACTGGGGAAGAAGGGAAAGAGG - Intronic
1165432043 19:35778432-35778454 CAGAGGGACAGAAGGGAGCAGGG - Intronic
1165894997 19:39136212-39136234 CAGTGGGGGAGAAGGGAGCAGGG - Intronic
1166138216 19:40790286-40790308 GAGTGGCTGAGAAGGGAATAGGG + Intronic
1166211155 19:41307410-41307432 CAGTGGGTGAGAGGGAAGAAGGG + Intronic
1166316552 19:41992949-41992971 CTAGGGGAGAGAAGGGAGAAAGG - Intronic
1166607629 19:44159280-44159302 CAGAGGGAGAGATGGGCAGATGG - Exonic
1167437763 19:49489827-49489849 CTGTGGGAGACAAGGGCAAAAGG - Intronic
1167699527 19:51034368-51034390 GAGAGGGACAGAAGGGAAGAGGG + Intronic
1167881285 19:52460253-52460275 CAGTTGGTGAGAATGTAAAATGG - Intronic
1168401342 19:56087688-56087710 CTGAGGAAGAGCAGGGAAAATGG + Exonic
1168435216 19:56311295-56311317 CAGTGGGAAAGATGTGATAAAGG - Intronic
925410006 2:3634580-3634602 CAGGGAGAGAGAAGGGCAACTGG - Intronic
926240517 2:11081237-11081259 GAGGGGGAGAGAGGGGGAAATGG - Intergenic
926832835 2:16982254-16982276 CTGGGACAGAGAAGGGAAAATGG - Intergenic
927095895 2:19747382-19747404 CAGAGACAGAGAAGGGAGAAGGG + Intergenic
927186723 2:20487405-20487427 CACTGGCAGTGCAGGGAAAAGGG + Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927951680 2:27174466-27174488 CAGTGGGAGAGGAGGGGTAAGGG - Intergenic
927997393 2:27495361-27495383 CTGGGAGAGAGAAGGGATAAGGG - Intergenic
928570976 2:32608387-32608409 CAGAGGGAGAGGAGAGGAAAAGG - Intronic
928826898 2:35433506-35433528 CACAGGGAGGGAAGGGAGAATGG + Intergenic
929391888 2:41478590-41478612 CTGTAGGATAGAAGGGAAGATGG - Intergenic
929481997 2:42317896-42317918 CAGTGGCAGAGAAGTGATATAGG - Intronic
929993688 2:46811794-46811816 CAAGGGGAAGGAAGGGAAAAGGG - Intergenic
930596658 2:53397991-53398013 AAGTGGGAGAGTAGAAAAAAAGG - Intergenic
930752211 2:54945085-54945107 GAGTGGGAGAGGAGGGAGAGAGG - Intronic
931237557 2:60424263-60424285 GAGAGGGAGAGAGAGGAAAAGGG - Intergenic
931280078 2:60783063-60783085 CAGTGAGAGGGAGGGAAAAAAGG + Intronic
931487907 2:62712072-62712094 GATTGGTAGAGAAGGAAAAATGG + Intronic
931555603 2:63500195-63500217 CAGTGGGAGATAAAGGTACAAGG + Intronic
931581924 2:63785271-63785293 CAGAGGGGGAGAAGGGAGGAAGG - Intronic
932196554 2:69788857-69788879 AAGAGGGAAAGAAGGGAAGAAGG + Intronic
932525513 2:72462575-72462597 ACGTGGCAGAGAAGGCAAAAAGG - Intronic
932589849 2:73058845-73058867 CTGGGAGAGAGAGGGGAAAATGG - Intronic
932746560 2:74338419-74338441 CAGTGAGAGAGGAGGGCAATGGG + Intronic
932767890 2:74482728-74482750 CAGTGGGAGAGAAGTCGAACGGG - Exonic
932856361 2:75237616-75237638 CAAGGAGAGAGAAAGGAAAATGG - Intergenic
932886712 2:75555340-75555362 CAGAGGGAAAGAAGGGGAGATGG - Intronic
933761496 2:85675350-85675372 CAGAGGGAGGGAAGGAAGAAAGG + Intergenic
934039018 2:88112237-88112259 CAATGACAAAGAAGGGAAAAAGG - Exonic
934054851 2:88242998-88243020 GAATGAGAGAGAAGGGAAAGTGG - Intergenic
934733308 2:96672956-96672978 GAGAGGGAGAGAAGGGAAGATGG + Intergenic
935110008 2:100083835-100083857 GAGAGGGAGAGAAGGGAGTACGG + Intronic
935258080 2:101330409-101330431 CAGTCAGAGGGAAGGGAAATTGG - Intergenic
935402986 2:102679887-102679909 AAGAGGGAGAGAAGGGAATGGGG + Intronic
935513033 2:104000005-104000027 CAGTGAGAGAGAGCGGACAAGGG + Intergenic
935812049 2:106808180-106808202 CACTGGGAGAGAAGAGAGAAAGG + Intronic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
936124972 2:109781373-109781395 GAGAGGGAGAGAAGGGAGTACGG - Intergenic
936219721 2:110590095-110590117 GAGAGGGAGAGAAGGGAGTACGG + Intergenic
936233558 2:110724896-110724918 CAGAGGGAGGGAAGGAAAGAAGG + Intergenic
936257403 2:110928856-110928878 CAATGGGAGACAAGTGAAAGGGG - Intronic
936465442 2:112744636-112744658 CTGTGGGAGAGAAGAGAGCAGGG - Intronic
936573030 2:113632240-113632262 CAGAGGGAGAGAAAAGAAATGGG + Intronic
937134534 2:119541562-119541584 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
937419555 2:121742301-121742323 CAGTAGGAGAACAGAGAAAAGGG - Intronic
937736248 2:125294361-125294383 AGCTGGGAGGGAAGGGAAAATGG - Intergenic
938234959 2:129698655-129698677 AAGTGGTACAGAAGGGAACATGG - Intergenic
938541258 2:132285941-132285963 GAGAGAGAGAAAAGGGAAAATGG + Intergenic
938750024 2:134319558-134319580 CAGTGGGAGTGATGGGACAATGG + Intronic
939166435 2:138645944-138645966 TAGTGGGAGAAAAGGGAGACTGG + Intergenic
939254358 2:139723266-139723288 AAGTGGGCTAGAAGGGAAAGAGG - Intergenic
939945827 2:148409421-148409443 GAGAGAGAGAGAAAGGAAAAGGG + Intronic
940166596 2:150780473-150780495 CTGTGGCAAAGCAGGGAAAAAGG - Intergenic
941625584 2:167827097-167827119 CAGTGGGACAGAATGTACAAAGG + Intergenic
942135991 2:172925971-172925993 CAGAGGGAGGGAAGGGAGGAAGG + Intronic
942336632 2:174894512-174894534 CAGTTGGTGAGACTGGAAAACGG + Intronic
942468895 2:176239091-176239113 AGGTGGGAGCAAAGGGAAAATGG - Intergenic
942741966 2:179191431-179191453 GGGAGGGAGAGAAGGGGAAAAGG + Intronic
942774097 2:179559920-179559942 CTGTGGGAGAGAGGGGAATATGG - Intronic
942795396 2:179812646-179812668 CAGAGGGAGAGAAGGGGGAAAGG + Intronic
943002835 2:182350767-182350789 CAGTGCCAGAGAAGGGACCAAGG + Intronic
943218293 2:185068561-185068583 AGGTGAGAGTGAAGGGAAAATGG + Intergenic
943326772 2:186508614-186508636 GAGAGGGAGGGAACGGAAAATGG + Exonic
943512070 2:188838630-188838652 AAGTGAGAAAGAAAGGAAAAAGG + Intergenic
944036120 2:195296639-195296661 CAGAGAGGGAGAAAGGAAAAGGG + Intergenic
944051418 2:195474363-195474385 GAGTGGGAGGGAAGGAAGAAGGG + Intergenic
944338100 2:198562062-198562084 CAGTGAGAGAGATGGGGAAATGG - Intronic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
944902110 2:204226062-204226084 GAGAGGGAGAGAGGGGAAGAGGG + Intergenic
945405380 2:209441475-209441497 CTTTGGAAAAGAAGGGAAAAAGG + Intronic
945505710 2:210637856-210637878 CAGTGGGGGATGGGGGAAAAGGG - Intronic
946038720 2:216765857-216765879 GAGTGAGAGAGAAGGGAGGAGGG - Intergenic
946110715 2:217412875-217412897 AAGTGGGAGAGAAAGTACAAAGG + Intronic
946435568 2:219650286-219650308 CAGGGGGAGAGAACGGAAGTGGG + Intergenic
946483254 2:220076500-220076522 CGGTTGGAGAAAAGAGAAAAAGG - Intergenic
946878041 2:224149986-224150008 AAGTAGAAGAGAAGAGAAAATGG - Intergenic
946924038 2:224608486-224608508 CAGTGAGAGAGGGAGGAAAAAGG + Intergenic
947103256 2:226644149-226644171 CTGTGGGAGAGAAAGGGAGAGGG - Intergenic
947139624 2:227009041-227009063 CAGAGGGAGAGAAGGAGAGAAGG + Intronic
947164792 2:227250833-227250855 AAATGAGAGAGAAAGGAAAAGGG + Intronic
947274911 2:228379670-228379692 CAGTGGGAGTGAAGTCAGAATGG + Intergenic
947443540 2:230144230-230144252 GAGTGGGAGACCTGGGAAAATGG - Intergenic
947454972 2:230245678-230245700 GAGAGGGAGAGAGGGGAAAGGGG + Intronic
947628710 2:231637662-231637684 AAGTGGGGGAGGAGGGGAAAAGG + Intergenic
947866341 2:233400411-233400433 CACTGGGTGTGAAGGGCAAAGGG - Intronic
948249832 2:236517985-236518007 CAGTGTGAGAAAAAAGAAAAAGG + Intergenic
948615728 2:239197521-239197543 CAGAAGGAGAGAATGGGAAAGGG - Intronic
1169323675 20:4656970-4656992 AAGGTGCAGAGAAGGGAAAAAGG + Intergenic
1169325263 20:4670597-4670619 CAGTGGGAGACAAGGGAACCAGG + Intergenic
1169576535 20:6968550-6968572 CAATGGAAGAGAATGGAAATTGG - Intergenic
1169894649 20:10489762-10489784 CAGTGAGAGGGAAAGGGAAATGG + Intronic
1170010737 20:11719990-11720012 CAGTGGAAGAAAATGGACAATGG + Intergenic
1170593789 20:17790749-17790771 CAGTGGCAGAGAGGGGAGCATGG - Intergenic
1170633928 20:18088561-18088583 GAGAGAGAGAGAAAGGAAAAAGG - Intergenic
1170996489 20:21364876-21364898 CATTAGGAGAGAAGGGTACAAGG + Intronic
1172215573 20:33233355-33233377 CCCAGGGAGAGAAGGGTAAAGGG + Intergenic
1172452594 20:35038058-35038080 CAGTTGGGGAGAAGGGGTAATGG + Intronic
1172462023 20:35126379-35126401 CAGTGGGGGAGATGGGATAATGG + Intronic
1172501867 20:35433434-35433456 GAGTGGGAGAGAAGAGGAGAGGG - Exonic
1172752034 20:37257924-37257946 GAGTTGGAGAGAGGGGAGAAGGG + Intronic
1173074853 20:39808025-39808047 CTGTAGGAAAGAGGGGAAAATGG - Intergenic
1173201299 20:40957197-40957219 AAGCGGGAGAGAAGGGAGAAAGG + Intergenic
1173295779 20:41755296-41755318 GAGTGAGAGAGAAGGAAAGAAGG - Intergenic
1173457209 20:43212949-43212971 GAGAGGGAGAGAAGGAAGAAAGG + Intergenic
1173465960 20:43281630-43281652 CAGTAGGAGAGAGGGGAAGTGGG - Intergenic
1173508976 20:43611214-43611236 CAGAGTGAGAGAAGGGAGAAGGG - Intronic
1173695804 20:45010958-45010980 CAGTTGGAGAGAAGGGATTAAGG + Intronic
1173716514 20:45211573-45211595 GAGTGGGAGGGAAGGGAGGAGGG + Intergenic
1174031306 20:47630203-47630225 CAGGGGGAGACTAGGGAAAAGGG - Intronic
1174401455 20:50278151-50278173 CCGAGGGAGAGAAGGGAAGAGGG - Intergenic
1174997751 20:55589866-55589888 CAGTAGGATAGATGGGAAACTGG + Intergenic
1175134326 20:56811468-56811490 CAGTGGGAGGGAATTGAAAGGGG + Intergenic
1175169247 20:57068407-57068429 CAATGGGAGAATAAGGAAAAGGG + Intergenic
1175359624 20:58398549-58398571 TATTGGGAGACGAGGGAAAATGG + Intronic
1175390778 20:58626022-58626044 GAGTGGGAGAGAAGGAACACAGG - Intergenic
1175487350 20:59355628-59355650 CAGAGGGAGAGAGGGGAGAGGGG - Intergenic
1175648710 20:60698024-60698046 CAGTGGTAAAGAAGGGTAAGTGG - Intergenic
1175921385 20:62451979-62452001 AAGAGGGAGAGGAGGGAGAAGGG + Intergenic
1176636603 21:9249657-9249679 CTGGGGGTGAGAAGAGAAAATGG - Intergenic
1177047716 21:16191163-16191185 CAGTAGGAGAGAGAGGAAGATGG - Intergenic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1178547756 21:33507402-33507424 TAGTGGGAGAGACGGGGAGAGGG + Intronic
1180051297 21:45332100-45332122 CAGTGGGAGGGCAGGGGGAAGGG + Intergenic
1180156138 21:45978092-45978114 GAGGGGGAGAGAGGGGAAAAGGG + Intergenic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180790279 22:18572074-18572096 CAGTAGAGGAGATGGGAAAAGGG - Intergenic
1181231459 22:21423241-21423263 CAGTAGAGGAGATGGGAAAAGGG + Intronic
1181247192 22:21511627-21511649 CAGTAGAGGAGATGGGAAAAGGG - Intergenic
1181630664 22:24149499-24149521 CAGTGGGGGAGAAGGTGAGATGG + Intronic
1181712407 22:24698751-24698773 AAGAGGGAGGGAGGGGAAAAAGG - Intergenic
1181787658 22:25238456-25238478 CAGCGGGAGGGAGGGGGAAAAGG + Intergenic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1181819394 22:25463494-25463516 CAGCGGGAGGGAGGGGGAAAAGG + Intergenic
1182110453 22:27719411-27719433 CAGTGGGAGAGAAAGGAGGGAGG - Intergenic
1182261420 22:29074518-29074540 AAGTGGAAGAGAAGGCAAGAGGG + Intronic
1182744341 22:32594130-32594152 CAGTGGGAGACAAGGGAATTGGG + Intronic
1182754295 22:32666414-32666436 CAGAGTGAGAGAGGGGACAAAGG - Intronic
1183017037 22:34997277-34997299 CAGTAGGAAAGAAGGGGTAAGGG - Intergenic
1183114961 22:35684792-35684814 CTCTAGGAGAGAAGGAAAAATGG - Intergenic
1183207020 22:36426557-36426579 GAGTGGGAGAGAAGGGGACTGGG + Intergenic
1183469321 22:37997228-37997250 AAGTGGAAAAGAAGGGAGAAAGG - Intronic
1183641584 22:39096116-39096138 CTGTGGGGGAGAAGGGACACAGG + Intergenic
1183645124 22:39121380-39121402 AAGTGGGAGAGAAGAAACAAGGG + Intronic
1183796877 22:40126385-40126407 GAGAGGGAGGGAAGGGAACAAGG - Intronic
1184811433 22:46835633-46835655 CAGAGGGAGAAAAGAGAGAAAGG + Intronic
1184819656 22:46900057-46900079 CAGAGGGAGAGAAAGAGAAAGGG - Intronic
1185209477 22:49561634-49561656 AAGTGGGAGAGACAGGAACAGGG + Intronic
1185427158 22:50778634-50778656 CAGAGGGAGAGAAAAGAAATGGG - Intronic
949634771 3:5970618-5970640 GAGTGGGGGAGAAGGGAAGAAGG - Intergenic
949634786 3:5970656-5970678 CAGAGGTAGAGAAGAGATAAGGG - Intergenic
949903280 3:8837646-8837668 CAGAGGGAGTGAGAGGAAAATGG + Intronic
950120301 3:10477548-10477570 CAGTGGATGGGAAAGGAAAAGGG - Intronic
950153196 3:10704045-10704067 CAGAGGGAGTGAGGGGAAGATGG - Intronic
950206669 3:11086107-11086129 CAGTTTGAGGGAAGGGTAAAGGG - Intergenic
950404788 3:12797495-12797517 GAGGGGGAAAGAAGGAAAAAGGG - Intronic
950582054 3:13868870-13868892 CAGAGGGAGAGAAGGAAGGAGGG + Intronic
951080665 3:18446065-18446087 CATTGGGAGAGAAGGGGCCAAGG + Intergenic
951412258 3:22379471-22379493 GAGAGGGAGAGAAGGACAAAAGG + Intergenic
951477818 3:23127002-23127024 CAGAAGGAGAGAAGAGAGAATGG - Intergenic
951637417 3:24794902-24794924 CAGAGGGAGAGAAGGGCCGAGGG - Intergenic
951702874 3:25513509-25513531 AAGTGGGAGAGGAGGCAGAATGG - Intronic
952879247 3:37972959-37972981 CAGAGGAAGAGAAGGGAGTATGG - Intronic
952988666 3:38811814-38811836 CAGTATGAGAGGAGGAAAAAGGG - Intergenic
953025721 3:39143823-39143845 CAGTGGGAAAGTAGGGACCAGGG + Exonic
953057238 3:39397857-39397879 CTGTGGCTGAGAATGGAAAATGG - Intergenic
953108265 3:39907152-39907174 CAGATGGAGAGGAGGGAACATGG - Intronic
953135887 3:40181370-40181392 CACTGGGACAGAAGGGAGTAGGG + Intronic
953511763 3:43548437-43548459 GAGTGGGAGGGAAAAGAAAATGG - Intronic
953965291 3:47300129-47300151 GAGGGGGAGAGAAGGGAAAAGGG - Intronic
953983358 3:47423904-47423926 CAGTGGGAGAGTTGGGCAGAGGG - Intronic
954104533 3:48402831-48402853 AAATGGGAAAGAAGGGACAATGG + Intergenic
955064405 3:55522214-55522236 TGGTAGGGGAGAAGGGAAAAGGG + Intronic
955705087 3:61719543-61719565 CAGTGGCAGAGAAAGGGAACAGG + Intronic
956644622 3:71443892-71443914 TATTGGGAGAGAAGGGTAAAAGG - Intronic
956763120 3:72461080-72461102 CAGGGGCAGAGAGGAGAAAAAGG + Intergenic
956770293 3:72520228-72520250 CACTGGGAGGGAATGGCAAATGG - Intergenic
956783423 3:72622846-72622868 CAGTGAAAGAGAAAGGAAAGGGG - Intergenic
956857156 3:73286544-73286566 CAGTAGGAGAGAAGGAAAGAGGG + Intergenic
958433352 3:94068029-94068051 CACAGAGGGAGAAGGGAAAAAGG - Intronic
958457239 3:94347334-94347356 CAGTGGGAAAGAACAGAAATTGG - Intergenic
958894403 3:99813930-99813952 GGCTGGCAGAGAAGGGAAAACGG + Intergenic
958925246 3:100150068-100150090 CAGTGGGAGAGAGAGGATGAAGG - Intronic
958937363 3:100271432-100271454 AAATAGGAGAGAAGGGATAATGG + Intronic
959060038 3:101608318-101608340 CAGAGGGAGGGGAGAGAAAAAGG - Intergenic
959208350 3:103342517-103342539 AAGAGAGAGAGAAGGAAAAAGGG - Intergenic
959357481 3:105351113-105351135 CAGTGGAAGAAATGGGAAAAGGG + Intergenic
959496741 3:107060570-107060592 CAGTGGGTGAGAAGGGGTACAGG + Intergenic
960170374 3:114454100-114454122 GAGAGGGAGAGAGGGGAAGAGGG + Intronic
960487755 3:118273930-118273952 CAGTGGGAGACAAAGGAGACAGG + Intergenic
960493640 3:118349691-118349713 CAGTGGGGGAAAATGGAACAAGG - Intergenic
960529100 3:118743298-118743320 CAGTGGGGGTGAAGGGATAGTGG - Intergenic
960637343 3:119796513-119796535 GGTTGGGAGGGAAGGGAAAAGGG - Intronic
960738012 3:120801649-120801671 GGGTTGGAGAGAAGTGAAAAAGG + Intergenic
960794655 3:121472848-121472870 TAGTGGGAGGGAAGAGAGAAGGG - Intronic
961460275 3:127045603-127045625 AAGAGGGAGGGAAGGGGAAAGGG + Intergenic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
961852621 3:129836945-129836967 CACAGGGAGATAAGGGAAATAGG - Intronic
962180066 3:133197373-133197395 CAGTGGTAGAGTGAGGAAAAAGG + Intronic
962493020 3:135911753-135911775 CAGAAGGAGAGAAGAGAAAAGGG + Intergenic
962760565 3:138509342-138509364 CAGTGGCAAAGAACAGAAAATGG + Intronic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
962942076 3:140134232-140134254 TAGGGGGAGAGGAGGGATAAAGG - Intronic
963720039 3:148851664-148851686 GAGTGGCAGAGAAAGGAATAGGG + Intronic
963723492 3:148892110-148892132 CAGTGGGAGAGTAGAAAAAAAGG - Intronic
963814871 3:149818434-149818456 CACTGGGAGGAAGGGGAAAAGGG - Intronic
964382966 3:156116291-156116313 CATTGGGAGTCAAGGGAAGAAGG - Intronic
964442808 3:156729411-156729433 GAGGGGGAGAGAAGGGAGTAAGG - Intergenic
964503343 3:157372169-157372191 CACTGGAAGAGCAGGAAAAATGG + Intronic
964553480 3:157910672-157910694 CAGGGGTAGAGAAGAGGAAATGG + Intergenic
964610604 3:158611296-158611318 CAGTAGGGAAGATGGGAAAATGG - Intergenic
964886763 3:161492438-161492460 CAGTGGGACAGGGAGGAAAAGGG - Intergenic
964939798 3:162143901-162143923 AAGTGGGAGAGGAAGGCAAATGG - Intergenic
965462982 3:168991834-168991856 CACAGGTAGAGAAGGAAAAAAGG + Intergenic
965484892 3:169266875-169266897 GAGAGAGAGAGAAGGAAAAAAGG + Intronic
966054062 3:175660661-175660683 CAGAGGCTGGGAAGGGAAAAGGG - Intronic
966155000 3:176906659-176906681 TAATGGGAGAAAAGGCAAAAAGG + Intergenic
966266391 3:178049638-178049660 CAGTGTGTGAGAAGTGAAAATGG - Intergenic
966396152 3:179505419-179505441 CAGAGTCAGAGAAGGGAAGAAGG + Intergenic
966746150 3:183279516-183279538 CAGGGTGAAGGAAGGGAAAAAGG - Intronic
966882944 3:184360212-184360234 GAGTGGGAGAGAAAGACAAAGGG + Intronic
967061943 3:185880375-185880397 GAGAGGGTGAGAAGAGAAAACGG + Intergenic
967098469 3:186196437-186196459 CAGATGCAGAGAAGAGAAAAAGG - Intronic
967226008 3:187291812-187291834 CAGAGGGAGAGAGGGGGAGAGGG - Exonic
967478621 3:189949313-189949335 AAGGGGAAGAGAAGGGAAGAGGG - Intergenic
967819240 3:193825943-193825965 AAATGAGAGAGAAGGGACAAAGG - Intergenic
967936313 3:194730659-194730681 GACTGGCAGAGAAGGGAAGAGGG + Intergenic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
1202750292 3_GL000221v1_random:155362-155384 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
969240781 4:5895823-5895845 CACTGGGAGATAAGAGATAAAGG + Intergenic
969334981 4:6502493-6502515 GAGAGGGAGAGAGGGAAAAAGGG - Intronic
969450113 4:7268212-7268234 AAGTGGGAGTGAAGGGATGAAGG + Intronic
969525305 4:7701203-7701225 AAGAGGGAGAGAAGGGGGAAGGG + Intronic
969984775 4:11196987-11197009 CAGTGTGGGAGAAGAGAAAGAGG + Intergenic
970012393 4:11473473-11473495 CAGTGCAAGAGAACGGAAGAAGG - Intergenic
970066673 4:12102809-12102831 GAGTGTGAGAAAAGGGAAAATGG - Intergenic
970194058 4:13539253-13539275 GAGTGGGAGAGAAAGGGAAGGGG + Intergenic
970423745 4:15928184-15928206 CAGAGGGAGGGAAGAGAAAAAGG + Intergenic
970577758 4:17444408-17444430 CAGTGGCCTAGAAGGGAAAATGG - Intergenic
971994858 4:33953018-33953040 GAGAGGGAGAGAAGGGGATAAGG - Intergenic
972088058 4:35244400-35244422 CAGAGGCAGAGAATGGGAAATGG - Intergenic
972102215 4:35435085-35435107 TAGTGGGAAAGAAGGTAATATGG - Intergenic
972147330 4:36043860-36043882 GAGGGGAAGGGAAGGGAAAAAGG + Intronic
972189351 4:36571169-36571191 GAGGGGGAGAGATGGGAGAATGG + Intergenic
972403110 4:38723458-38723480 CAGTGGCTGAGAGAGGAAAAAGG - Intergenic
972536735 4:40006245-40006267 GGCTGGCAGAGAAGGGAAAATGG + Intergenic
972652028 4:41027448-41027470 CTGTTGGAGGGAATGGAAAATGG - Intronic
972714762 4:41634493-41634515 CAGTGGGAGAGAAGGCAGAGTGG + Intronic
972874693 4:43343825-43343847 GAGAGAGAGAGAAGGAAAAAAGG - Intergenic
973223098 4:47751447-47751469 AAATGGGAGAGAAGGGAAAATGG - Intronic
973835626 4:54806452-54806474 GAGAGGGAGGGAGGGGAAAAAGG + Intergenic
973930377 4:55787389-55787411 GAGTGGGAGAGATGGAGAAAGGG + Intergenic
974018610 4:56673292-56673314 GAGTGGGAGAGCAGGAGAAATGG + Intronic
974168907 4:58240813-58240835 GATTGGCAGAGAAGGAAAAAAGG - Intergenic
974374804 4:61062227-61062249 AAGGGGAAGGGAAGGGAAAAGGG + Intergenic
974652791 4:64776944-64776966 TTCTGGGAGAGAAGAGAAAAAGG - Intergenic
974659927 4:64873702-64873724 CAGAGGAAGAAAAGTGAAAAGGG - Intergenic
974961425 4:68705846-68705868 GAGAGGGAGAGAGGGGATAAAGG - Intergenic
975536607 4:75458103-75458125 AAGTGGGAGAGAAGGGAGCCAGG + Intergenic
975536939 4:75460760-75460782 GGGAGGGAGAGAAGGGAAAAAGG + Intergenic
975575159 4:75855224-75855246 CAGGGGGATAGATGGGAAAAGGG + Intergenic
975964993 4:79962310-79962332 CAGTGGGATAGTAGTAAAAATGG + Intronic
976030163 4:80742058-80742080 CTGTGGGAGAGATGGGGGAAGGG + Intronic
976058544 4:81098658-81098680 TAGAGGGAGAGATGGGAAAATGG + Intronic
976117824 4:81746774-81746796 CTTTCAGAGAGAAGGGAAAAAGG - Intronic
976121816 4:81791598-81791620 CAGTGGGAGAGATGGGTCATGGG - Intronic
976415327 4:84767323-84767345 GAGTGAGAGAGATGGGTAAATGG - Intronic
976507394 4:85864101-85864123 GACTGGCAGAGAAGGGAAGATGG + Intronic
976706858 4:88027838-88027860 CAGTAGGAGAGAGAGGGAAAAGG - Intronic
976708956 4:88048586-88048608 CAGTGGCAGAGTAGTGAAGAGGG - Intronic
976721513 4:88173265-88173287 CTGTGGGAAAGAGGGAAAAAAGG - Intronic
976864455 4:89707263-89707285 CAATGGCAGATAATGGAAAAAGG - Intergenic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
977011460 4:91639806-91639828 CACTGGATGAGAAGGGAAATAGG + Intergenic
977231274 4:94453037-94453059 TAGTGGGTGAGAGGGGAGAAAGG - Intronic
977436969 4:97010650-97010672 CAGAGGAAGAGATGGGGAAATGG + Intergenic
977530515 4:98195271-98195293 CACTTGGAGGGAGGGGAAAAGGG - Intergenic
977759378 4:100713066-100713088 TAGTGGGTGAGAAGGGGATAAGG + Intronic
978445093 4:108772712-108772734 AAGCGGGAGAGAAGGGTAATGGG - Intergenic
978459139 4:108930626-108930648 GTGTGGGAGAGAAGGGAAGCAGG + Intronic
978714152 4:111821793-111821815 GTGTGGGAGTGAAAGGAAAAGGG - Intergenic
978957861 4:114636836-114636858 CAGAGAGAGAGAAGGGAATAGGG - Intronic
979113062 4:116783091-116783113 CTGTGGGACAGAAAGGAAAGAGG - Intergenic
979390684 4:120123805-120123827 AGGAGGGAGAGAAGGGAGAAAGG - Intergenic
979514225 4:121588482-121588504 AAATGTGAGAGATGGGAAAAGGG - Intergenic
979691669 4:123565581-123565603 CAGTGTGGGAGATGGGTAAATGG - Intergenic
979975562 4:127191924-127191946 GAGAGGGAGAGAGGGGAACATGG - Intergenic
981086449 4:140689416-140689438 GAGGGGAAGGGAAGGGAAAAGGG - Intronic
981122848 4:141072456-141072478 CAGTGGGACAAAAGGAAAAAAGG + Intronic
981300754 4:143184255-143184277 AAGTGTGAGAGTAAGGAAAATGG - Intergenic
981358155 4:143815624-143815646 TAGTGAGAGAGAAGGGGGAAGGG - Intergenic
981365881 4:143902609-143902631 GAGAGGGAGAGAAAGGAAGAAGG - Intronic
981747192 4:148063250-148063272 CAGGAGGAGAAAAGGGGAAAGGG - Exonic
982094205 4:151906302-151906324 AAGAGGGAGAGAAGAGAAAAAGG + Intergenic
982286192 4:153738152-153738174 CAGAGGCTGAGATGGGAAAATGG - Intronic
982409172 4:155054460-155054482 CAGGGGGAAAGAATGGAAAGGGG + Intergenic
982619756 4:157689650-157689672 CAATGTGAGAAAATGGAAAAAGG - Intergenic
982689548 4:158532472-158532494 CAGAAGGGGAGAAGGGGAAAAGG - Intronic
983356627 4:166668543-166668565 GAGTAGGAGAGAAGAAAAAATGG + Intergenic
983539332 4:168891608-168891630 AAGTGGGAAAGAAAGGAAGAAGG + Intronic
983595114 4:169457654-169457676 CAGGGGGAGAGAAGGAAGGAAGG + Intronic
983709315 4:170694405-170694427 CAAAGGCAGAAAAGGGAAAAAGG + Intergenic
983806059 4:171993731-171993753 CAGTATGAAAGAAGGCAAAAAGG + Intronic
983837066 4:172401923-172401945 GAGAGGGAGAGAGGGGGAAAGGG + Intronic
983910432 4:173232895-173232917 CAGTGGCTGGGAAGGGGAAAGGG - Intronic
983976218 4:173937225-173937247 CAGGAGGTAAGAAGGGAAAAAGG - Intergenic
984538852 4:181011944-181011966 CAGAATGAGAGAAAGGAAAAAGG - Intergenic
984630089 4:182051993-182052015 CAGGCGGTGACAAGGGAAAATGG - Intergenic
984687652 4:182689628-182689650 TAGTGGGAGAGAAGGAAGATAGG - Intronic
984999322 4:185469216-185469238 CAGTAGGAGAGTAGAGAGAAGGG + Intronic
985026470 4:185744010-185744032 AAATGGGAGAGGAGGGAAAGGGG - Intronic
1202751491 4_GL000008v2_random:8096-8118 CTGGGGGTGAGAAGAGAAAATGG - Intergenic
985756654 5:1723490-1723512 GAGAGGGAGAGGAGGGGAAAGGG - Intergenic
985930387 5:3052394-3052416 AAGTGGGAGAGGAGAGACAAAGG + Intergenic
986766808 5:10935611-10935633 CAGCTGGAGAGAAGGCAGAAGGG + Intergenic
986784085 5:11095583-11095605 CAGTGGGACAGAAAGATAAATGG + Intronic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
987312824 5:16697380-16697402 CAGAAAGAAAGAAGGGAAAATGG + Intronic
987556426 5:19457130-19457152 CTGTTGGAGAAACGGGAAAATGG + Intergenic
987693677 5:21300874-21300896 CAGAGAGAGAGAAGTGAGAAGGG - Intergenic
987804821 5:22750635-22750657 CAGTGAGAGAGATGGAATAATGG + Intronic
988440385 5:31226644-31226666 CCCTGGGAGAGGAGGCAAAAAGG - Intronic
988541831 5:32117138-32117160 CAGAGAAAGAGAAGAGAAAAAGG + Intergenic
988717985 5:33846981-33847003 AAGTGGGAGAGAAGACAGAAAGG - Intronic
988974878 5:36505158-36505180 CAGTGGGGGTAAAGGGAACATGG + Intergenic
989017157 5:36951102-36951124 CACTGGGAGTAAAGGGGAAAGGG - Intronic
989438167 5:41438609-41438631 TATTGGGTGAAAAGGGAAAAAGG - Intronic
990602081 5:57369258-57369280 GAGTGGGAGAGAAGGGGGAGAGG + Intergenic
990631384 5:57674292-57674314 CAGAGGGAGAGAAGGAAGGAGGG - Intergenic
990738706 5:58890874-58890896 CAAAGGGAGAGAAGGGAAGCGGG - Intergenic
990887206 5:60608087-60608109 CAAGGGGAAAGCAGGGAAAAAGG + Intronic
991005073 5:61820904-61820926 CAGAAGGAGAGCAGAGAAAATGG + Intergenic
991613787 5:68475446-68475468 GAGTGGGAGAGAGTGGAGAAAGG - Intergenic
991746586 5:69748666-69748688 CAGAGAGAGAGAAGTGAGAAGGG + Intergenic
991751119 5:69806576-69806598 CAGAGAGAGAGAAGTGAGAAGGG - Intergenic
991798186 5:70328609-70328631 CAGAGAGAGAGAAGTGAGAAGGG + Intergenic
991825964 5:70623978-70624000 CAGAGAGAGAGAAGTGAGAAGGG + Intergenic
991830408 5:70681471-70681493 CAGAGAGAGAGAAGTGAGAAGGG - Intergenic
991890529 5:71327931-71327953 CAGAGAGAGAGAAGTGAGAAGGG + Intergenic
992149432 5:73888137-73888159 AAGTGGGAGAGCAGGGCCAATGG - Intronic
992158936 5:73981896-73981918 CAGTGGTAGGGAAGGGAAAAGGG - Intergenic
992215099 5:74518203-74518225 CAAAGGGAGAGAAGGGGGAAGGG - Intergenic
992392986 5:76346509-76346531 CCCAGGGAGAGAAGGGAGAAGGG + Intronic
992409616 5:76492542-76492564 CAGTGGGAGGGAAGGAAGAAAGG + Intronic
992689861 5:79231683-79231705 CTGTGGAAGAGAAGGGGAAGGGG - Intronic
993735069 5:91466515-91466537 AAGAGGGAAAGAAGGGAAAAAGG - Intergenic
993862438 5:93152542-93152564 CAGAGGGAGGGAGGGGAGAAGGG - Intergenic
994016466 5:94972364-94972386 CAGTGATAGTGAAGGGAAAGGGG - Intronic
994609183 5:102014497-102014519 GAATGGAAGGGAAGGGAAAAAGG + Intergenic
995047817 5:107670742-107670764 AAGTGGGCGAGAAAGGAAAGAGG + Exonic
995114047 5:108459191-108459213 AAGAGGGAGAGAAGGAAAGAGGG - Intergenic
995493804 5:112720909-112720931 CAGAGGGAGAGAAGAGTAAGGGG + Intronic
995702008 5:114946837-114946859 CAGTAGAGGAGAAAGGAAAATGG + Intergenic
995882749 5:116861068-116861090 AAGTGGGTGAGAATGGGAAAGGG + Intergenic
996155256 5:120091160-120091182 GAGGGAGAGAGAAGGGAACATGG + Intergenic
996352683 5:122563072-122563094 AAGTCTGACAGAAGGGAAAAGGG + Intergenic
996408530 5:123130206-123130228 GAGAGGAAGGGAAGGGAAAAGGG - Intronic
996440262 5:123482183-123482205 AAATGGGACAGAGGGGAAAAAGG + Intergenic
996506315 5:124271198-124271220 CAGGAGGAGGGAAGGGAAAATGG + Intergenic
996856913 5:128018727-128018749 CAGTGGCAGAGCAGGGAGAGGGG - Intergenic
997105484 5:131014301-131014323 CAGTGGGAAAGAGGGGGAAGGGG - Intergenic
997114634 5:131112775-131112797 CACTGGAACAGAAGGAAAAAGGG + Intergenic
997653945 5:135541859-135541881 CAGTGACAGAGCAAGGAAAATGG + Intergenic
998878141 5:146620721-146620743 CAGGGGGAGAGACGTGAGAAAGG - Intronic
998958872 5:147464299-147464321 CCCTGGGAGTGAAGGTAAAAGGG - Intronic
999090484 5:148931818-148931840 GAGGGAGAGAGAAGGGAAAGAGG - Intronic
999274303 5:150318822-150318844 CAGTGGGACTGCAGGGAGAAGGG + Intronic
999366075 5:151024374-151024396 CAGTGGGAGAGAGGGGATTGGGG - Intronic
999371725 5:151059582-151059604 AAGTGGGAAGGAAGGGAGAATGG + Intronic
999721515 5:154402232-154402254 CAGAGGGAGAAAGGGGAAGAGGG - Intronic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1000126017 5:158244940-158244962 CGATGGGAGAGAATGGAAAAAGG - Intergenic
1000141504 5:158408708-158408730 AAGTGGGAAAAAAGAGAAAAAGG - Intergenic
1000367608 5:160505796-160505818 CAGGGGAAGAGAAGGGACAGTGG + Intergenic
1000864730 5:166499744-166499766 CTGTGGGAGAGAAAGAAAAGAGG + Intergenic
1000919410 5:167120382-167120404 CTGTGGGAGAGGAGGGGAAGTGG + Intergenic
1001149689 5:169216356-169216378 AATGGTGAGAGAAGGGAAAAGGG - Intronic
1001445718 5:171781294-171781316 CAGACAGAGAGAAGGGAAGACGG - Intergenic
1001563105 5:172683089-172683111 AAGAGGGAGAGAAGGGGAAAGGG + Intronic
1001687262 5:173603157-173603179 GTGTGAGAGAGAAGGGGAAAGGG - Intergenic
1001782606 5:174382982-174383004 AAGTGGAAGAGAAGGGTCAAAGG + Intergenic
1001794705 5:174492412-174492434 CAGGGGGAGAAAAGGGTAAAGGG + Intergenic
1002076966 5:176714081-176714103 TAGTGAGACAGAAGGGAGAAAGG + Intergenic
1002483905 5:179522243-179522265 CAGGGTGAGAGGACGGAAAACGG + Intergenic
1002772747 6:303545-303567 CAGTGGGAGTGAAGGAAGATAGG + Intronic
1003004261 6:2366391-2366413 AAGTGGAAGAGAAGAGAGAAAGG + Intergenic
1003573428 6:7270966-7270988 CAGTGAGACAGAAGGGCCAAAGG + Intronic
1003762859 6:9200421-9200443 CAGAGAGAGAAAAGAGAAAAGGG + Intergenic
1003773612 6:9335621-9335643 CACTGGGAGAGAAGCGGAACAGG + Intergenic
1003858259 6:10297739-10297761 TAGAGGGAGAGAAGGGAAGTAGG + Intergenic
1003959244 6:11193693-11193715 CTGTGGGAGAGAAGGCACAGAGG + Intronic
1004126770 6:12881838-12881860 GAGTGAGAAAGAAGGGCAAAAGG + Intronic
1004199077 6:13531294-13531316 CAGTGGGAGGGTGTGGAAAATGG - Intergenic
1004241159 6:13924293-13924315 CCGTAGGAGAGAGGGGAAAGGGG - Intergenic
1004457321 6:15803247-15803269 CAGTGGGAGAGACGAGGACAAGG + Intergenic
1004510942 6:16284356-16284378 GAGTTGGAGAGCAGGGAAATGGG - Intronic
1004522159 6:16372272-16372294 CAATAAGAAAGAAGGGAAAAGGG + Intronic
1004551668 6:16653895-16653917 CTGTGGGAGAGGAGGCAAAGAGG + Intronic
1005020459 6:21413054-21413076 GAGAGGGAAAGAAAGGAAAAGGG + Intergenic
1005064781 6:21807642-21807664 TAGTGGGCAAGAAGAGAAAAGGG - Intergenic
1005154926 6:22793442-22793464 GAGAGGGAGAGAAGGGGACATGG - Intergenic
1005357265 6:24996548-24996570 TGGTGGGAGGGAAGGGAAAGGGG - Intronic
1005557232 6:26999062-26999084 CAGAGAGAGAGAAGTGAGAAGGG + Intergenic
1005578000 6:27208124-27208146 TATTGGGTGAAAAGGGAAAAAGG + Intergenic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1005946768 6:30601445-30601467 CAGCTGGGGAAAAGGGAAAATGG + Exonic
1006026642 6:31151175-31151197 AAGTGGGAGTGAAGGGAACAAGG - Intronic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1006501458 6:34461775-34461797 CAGTGGGAAAGAAGGTACCATGG + Intergenic
1006590787 6:35155213-35155235 GAGTTGGAGAGGAGGGAAATGGG - Intergenic
1006993044 6:38231961-38231983 AAATAGGAGAGAAGGGAAAAGGG + Intronic
1007247179 6:40471069-40471091 CAGTGGCTGAGAAAGAAAAAGGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007865320 6:44962896-44962918 GAGAGGGAGAGAAAGAAAAAAGG - Intronic
1008074826 6:47134533-47134555 CAGAGGAAGAGAAAAGAAAAGGG + Intergenic
1008776551 6:55046521-55046543 CAGTTGGGGAGATGGGAGAATGG + Intergenic
1009874825 6:69492980-69493002 AAGTGGGCTGGAAGGGAAAAAGG - Intergenic
1010166969 6:72926386-72926408 CAGATAGAGAGAAGGGAAATGGG - Intronic
1010339465 6:74731362-74731384 GAGTGGGAGAAAAGGGAACCAGG - Intergenic
1010577014 6:77544262-77544284 CCATGGGAGAAAATGGAAAAGGG + Intergenic
1010600144 6:77814767-77814789 AAGTGGGATAGAGGGGGAAAAGG - Intronic
1010615817 6:78010933-78010955 GAGAGGGAGAGAGGGGAAGAGGG - Intergenic
1010722689 6:79301728-79301750 CAGTGGCAAAAATGGGAAAAAGG - Intergenic
1010922252 6:81697530-81697552 CATTTGTAGAGAAGGCAAAATGG - Intronic
1011081171 6:83491478-83491500 GAGAGGGAGAGGAAGGAAAATGG + Intergenic
1011434062 6:87318673-87318695 GAGTGGGAGAGCATGGATAAAGG + Intronic
1011711818 6:90062738-90062760 CAGTTGGAGAGAAGGGAAAGAGG - Intronic
1011878281 6:91990299-91990321 CAGTGTGATATAAGGGAAAGAGG + Intergenic
1011949217 6:92943251-92943273 CAGTGAGAGGGAAGAAAAAAAGG + Intergenic
1011959558 6:93070243-93070265 CAGTGGTGGGGAAGGGGAAAGGG + Intergenic
1012214099 6:96560444-96560466 CCTCGGGAGAGAAGGGTAAAGGG - Intergenic
1012263019 6:97110343-97110365 CAGAGTGAGAGAAATGAAAAAGG - Intronic
1012760801 6:103298078-103298100 CAGTGGAAGACAAGGGAGAAAGG - Intergenic
1013165298 6:107584684-107584706 CAGTGGAAGAGAAAGGAGAGGGG - Intronic
1013273781 6:108564313-108564335 TAGTGGAAGAAGAGGGAAAAGGG + Intronic
1013434688 6:110091310-110091332 CAATTGGAAAGGAGGGAAAAAGG - Intergenic
1013824556 6:114195730-114195752 CAGTTGGAGAGAGGAGAAAGAGG + Intronic
1013857364 6:114590428-114590450 CAGTGGTAGAGAAGATAGAAAGG + Intergenic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015103835 6:129512836-129512858 CAGTGGGAGAAAAGGCAGAGAGG + Intronic
1015105352 6:129530247-129530269 CAGAGGAAGAGAAGAGACAAGGG - Intergenic
1015262146 6:131250397-131250419 CCGGGGGAGAGAAAGGAGAAGGG - Intronic
1015513342 6:134060890-134060912 CAGTGGGAGGGAAGGCAGGATGG + Intergenic
1016213150 6:141565050-141565072 GAGAGAGAGAGAAAGGAAAAGGG + Intergenic
1016508199 6:144809181-144809203 CAGTGAGAGAGAAGTGGATAGGG + Intronic
1017503744 6:155048538-155048560 CAGAGCAAGAGAAGGGAGAATGG + Intronic
1017534359 6:155330593-155330615 CAGAGTGTGAGAAGGGAAAGTGG + Intergenic
1017894670 6:158668748-158668770 GAATGGGAGAGACAGGAAAAGGG + Intronic
1017900600 6:158715783-158715805 CTGTGGCAGAGACGGGAGAAGGG - Intronic
1018160560 6:161038082-161038104 CAGAGGGAGGAAAGGAAAAAAGG - Intronic
1018243637 6:161801851-161801873 CAGTGGGAGACAAGAAAAAGAGG - Intronic
1018275683 6:162128459-162128481 AAGTGAGAGAGATGGGAAAGAGG + Intronic
1018617976 6:165705888-165705910 AAGTGTAAGAGAAGGAAAAATGG + Intronic
1018641202 6:165906347-165906369 AAGTGGTAGAGAAGGGAGAAAGG - Intronic
1018954470 6:168399184-168399206 CACTAGGAGAGAACAGAAAATGG + Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1020147938 7:5659477-5659499 CAGTGGGGGAGAGTGGAGAATGG + Intronic
1020214789 7:6181705-6181727 CAGAAGGAGAGAATGGAAAGTGG - Intronic
1020441364 7:8220537-8220559 TACTGGGAGAGAAGGGAACGAGG + Intronic
1021119866 7:16786970-16786992 GAGAGGGAGAGAAGGGAACGGGG + Intergenic
1021275628 7:18647643-18647665 CAATGGCTGAGCAGGGAAAATGG - Intronic
1021682679 7:23150266-23150288 GAATGAGAGAGTAGGGAAAAGGG - Intronic
1022506097 7:30909494-30909516 GAGTGGCAGAGACAGGAAAACGG - Intergenic
1022717121 7:32908771-32908793 CTTTGGGCGAGAAGGTAAAATGG - Intergenic
1022828474 7:34040821-34040843 AAGAGGGAGAGAAGGAAAGAAGG + Intronic
1022950082 7:35330300-35330322 CACTGGGAGAGAGGGGGAAATGG - Intergenic
1023467544 7:40473955-40473977 GAGAGAGAGAGAAGGGGAAATGG - Intronic
1023510458 7:40947053-40947075 CAGAAGTAGAGAAGAGAAAAAGG - Intergenic
1024037846 7:45523877-45523899 CAGTGGGTGAGAAGAGAACCAGG - Intergenic
1024169772 7:46772769-46772791 CAGTGGGAGAGAAATGAGATTGG + Intergenic
1024432114 7:49301023-49301045 GACTGGCAGAGAAGGGAAGATGG + Intergenic
1024551574 7:50566668-50566690 CAGAGGGAGATAAGGGTGAAAGG + Intergenic
1024666223 7:51549907-51549929 GAGAGAGAGAGAAGAGAAAATGG + Intergenic
1024693098 7:51824295-51824317 CAGTGGGAGCAAAGAGAATATGG - Intergenic
1024805263 7:53132047-53132069 GAGGAGGAGAGAATGGAAAAAGG - Intergenic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1025996835 7:66532690-66532712 CAGAGATAGAGCAGGGAAAATGG - Intergenic
1026542790 7:71295403-71295425 AAGGGGAAGAGAAGGGAGAAAGG - Intronic
1026598447 7:71753473-71753495 CAGAGAGAGAGAAAGGAAAGGGG - Intergenic
1026601932 7:71784579-71784601 CCTTGGGAGAGAAGGGGAAATGG - Exonic
1026658868 7:72281160-72281182 AAGAGGCAGAGAAGGGAAAGGGG - Intronic
1027970649 7:85076239-85076261 CACTGGAAGAGAAAGAAAAAGGG + Intronic
1027987440 7:85311435-85311457 CTGTTGCAGAGAAGGGAACAAGG + Intergenic
1028001870 7:85508869-85508891 GGCTGGCAGAGAAGGGAAAATGG + Intergenic
1028033804 7:85953131-85953153 CAGTGGAAGGGAAGGAGAAAGGG - Intergenic
1028102810 7:86842434-86842456 CAGTGGGAGATAGGGGCAACAGG - Intronic
1028389109 7:90294884-90294906 GAGGGGAAGGGAAGGGAAAAAGG + Intronic
1028403162 7:90446535-90446557 GAAGGGAAGAGAAGGGAAAAGGG - Intronic
1028504979 7:91560816-91560838 TAGGGGGAGAGAGGAGAAAAGGG - Intergenic
1028582724 7:92423972-92423994 CAGGGAGAGAGAAGAGGAAATGG + Intergenic
1028660937 7:93274059-93274081 AAGAGGGAGAGAAGGGGGAATGG - Intronic
1028798499 7:94932604-94932626 GAGTGGTGGAGAAGGGAAAGGGG + Intronic
1028855545 7:95588498-95588520 CAGGTGGTGAGAAAGGAAAATGG - Intronic
1029045851 7:97627486-97627508 CAGTGGCAGAGCAGGGAGAAAGG + Intergenic
1029131694 7:98336148-98336170 GGGTGGGAGAGAGGGGAATAAGG + Intronic
1029236549 7:99124493-99124515 CAACGGCAGGGAAGGGAAAACGG + Intronic
1029424117 7:100485975-100485997 CAATGGGAGAGAAGAGGAGAAGG - Intronic
1030083475 7:105797706-105797728 GAGTGGGAGAGATGAGAAGAAGG - Intronic
1030230499 7:107203922-107203944 CAGTAGGGAAGCAGGGAAAAGGG - Intronic
1030556202 7:111027017-111027039 CAGTGGGAGAGAATGTGACAAGG - Intronic
1030862902 7:114658814-114658836 AGGTGGGGGAGAAGGGAGAAGGG - Intronic
1030951085 7:115791019-115791041 AAGCTGGAGAGAAAGGAAAAAGG - Intergenic
1031115846 7:117667571-117667593 CATGGGGAGAGGAGAGAAAAAGG - Exonic
1031165139 7:118218791-118218813 GAATGGGAGACAAGGGGAAAAGG + Intronic
1031394828 7:121260869-121260891 CAGGAGGAAAGAAAGGAAAAAGG + Intronic
1031623268 7:123961865-123961887 CAATGAGAGACAAGGGAAAGGGG + Intronic
1031649624 7:124271853-124271875 GAGTGAGAGAGGAAGGAAAAGGG - Intergenic
1032037489 7:128531245-128531267 CAGTGGGAGAGGAGGGGGAGGGG - Intergenic
1032139078 7:129310016-129310038 CTCTGGGACAGAAAGGAAAAAGG - Intronic
1032449986 7:132022417-132022439 GAAGGGGAGGGAAGGGAAAATGG - Intergenic
1032528635 7:132601433-132601455 CAATGGGATACAAGTGAAAATGG + Intronic
1032664342 7:134020422-134020444 CAGTAGGAGATAAGAGTAAAGGG - Intronic
1032695501 7:134332576-134332598 CTGTGAGAGAGATAGGAAAAGGG - Intergenic
1032799825 7:135309094-135309116 CAGGGAGAGAGAGGGAAAAAAGG + Intergenic
1032915934 7:136489926-136489948 TATTGGGAGAGAAGAGAAATGGG + Intergenic
1033751859 7:144366255-144366277 CAGGGGTCCAGAAGGGAAAATGG - Intronic
1033764573 7:144474257-144474279 GAGTGGGAGAGAGAGTAAAATGG - Intronic
1033803158 7:144924924-144924946 AAGTGATAGAGAAGGGAGAAAGG + Intergenic
1033898764 7:146110083-146110105 CAGTGGAATAAAAAGGAAAATGG - Intergenic
1033955360 7:146841334-146841356 CAGAGAGAGAGAGGGGAAGACGG + Intronic
1034017775 7:147605879-147605901 GAGAGAGAGAGAAGGGAAGAGGG - Intronic
1034278746 7:149837308-149837330 CAGAGGGGCAGAAGGGCAAAGGG + Intergenic
1034570011 7:151947943-151947965 CAGAGAGAGAGAAGGGAGAGAGG - Intergenic
1035237619 7:157509033-157509055 GAGAGGGAGAGAAGGGGAAAGGG + Intergenic
1035335447 7:158124988-158125010 CAGGGTGGGAGAAGGGAAGAGGG + Intronic
1035827740 8:2662316-2662338 CAGTGGGAGACAGAGGAAGAGGG - Intergenic
1036027939 8:4931007-4931029 CAATGGGAGACATGAGAAAAAGG + Intronic
1036389715 8:8314335-8314357 CAGTGGGAGAGAAGAAAAACTGG + Intergenic
1036734310 8:11296534-11296556 GAGCTGGAGAGAGGGGAAAATGG - Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037004504 8:13760272-13760294 CAGTGGCAGATCAGGGTAAAGGG - Intergenic
1037269242 8:17107992-17108014 CAGGGTAAGAGTAGGGAAAAGGG + Intronic
1037373390 8:18203921-18203943 GACTGGCAGAGAAGGGAAGATGG - Intronic
1037521085 8:19681353-19681375 CAGCGGGAGAGAGAGGCAAAGGG + Intronic
1037712051 8:21362551-21362573 AAGTGGGAGTGAAGAGCAAAGGG + Intergenic
1037767500 8:21781129-21781151 CAGTGGCAAGGAAGGAAAAATGG - Intronic
1037807905 8:22068718-22068740 GAGCGGGAGAGAGGAGAAAAGGG + Intronic
1038116917 8:24566980-24567002 GGGTGGGAAAGAAGAGAAAATGG - Intergenic
1038408572 8:27340979-27341001 CAGTGGGAGAGACGGATGAAGGG + Intronic
1038442608 8:27582514-27582536 CAGTAGAGGAGAAAGGAAAAGGG - Intergenic
1038605779 8:29002301-29002323 CAGTGGGAGAGAGGGAGAGAGGG + Intronic
1038691192 8:29765035-29765057 CAGTGGGTGTGAAGGGGAAAGGG - Intergenic
1039511131 8:38092787-38092809 GACTGGCAGAAAAGGGAAAATGG + Intergenic
1039772678 8:40703577-40703599 CAGTGGGGGAGCAGGGAGGAGGG + Intronic
1040452455 8:47561722-47561744 TAGTGGGAGAGATGGTACAAGGG - Intronic
1040738302 8:50538777-50538799 TAGAGGGAGAGAATGGAAAGCGG - Intronic
1041012688 8:53559611-53559633 CAGTGCTAGAGAAGGAACAAAGG + Intergenic
1041385386 8:57297006-57297028 CAGTGAGAAAGAAGGAAGAATGG + Intergenic
1041876688 8:62695850-62695872 CAATGTGAGAGAAGAGCAAATGG - Intronic
1042876382 8:73444063-73444085 CAGTGGAAGAGAAAATAAAATGG + Intronic
1044262594 8:90144757-90144779 CAGTAGGGGAAAAGTGAAAATGG - Intergenic
1044436533 8:92170902-92170924 CAGTGGGAGAGACGAGACAGTGG + Intergenic
1044512382 8:93097358-93097380 CAGTGGCAAAGGAGGGAGAAAGG + Intergenic
1045537710 8:103047874-103047896 CAGAGAGAGAGAAAGGAAAAAGG - Intronic
1046393540 8:113609363-113609385 GATTGGGAGAGAAGGTAGAATGG - Intronic
1046617643 8:116495080-116495102 CAGTGGGAGAAGAGGGTACAAGG - Intergenic
1047025826 8:120823499-120823521 GAGAGGGAGGCAAGGGAAAAGGG - Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047307691 8:123666296-123666318 CAGTAAGAGAGAAAGTAAAACGG + Intergenic
1047550998 8:125872093-125872115 CAGGGGTAGAAAAAGGAAAAAGG - Intergenic
1047750729 8:127878554-127878576 CAGTGGCAGGGAAGGGAAAGAGG - Intergenic
1047776357 8:128074009-128074031 GAGGGGAAGAGAAGAGAAAATGG - Intergenic
1047915159 8:129575148-129575170 CAGTTGGAAAGAAGGGAATAAGG + Intergenic
1048111535 8:131473433-131473455 CAGAGGCCTAGAAGGGAAAATGG + Intergenic
1048879763 8:138862533-138862555 CAGTGGGAGGGTAAGAAAAAAGG - Intronic
1048986017 8:139735443-139735465 CAGAGGTAGAGGAGGGAGAAGGG - Intronic
1049156213 8:141068285-141068307 TGGTGGAACAGAAGGGAAAAAGG + Intergenic
1049226994 8:141458854-141458876 CAGAGGGAAAGTAGTGAAAATGG + Intergenic
1049311771 8:141937360-141937382 AGGTGGGAGGGAAGGGAAGAGGG - Intergenic
1049370317 8:142261215-142261237 AGGAGGGAGAGAAGGGAAGAGGG + Intronic
1049920831 9:362602-362624 CAGCAGGAGAGAAGGAAAGAGGG - Intronic
1049925997 9:407648-407670 CATAGGGAGAGAAGGAAAGAAGG - Intronic
1049955468 9:688916-688938 CAGTGGGAAAGAAGGAAAGCAGG - Intronic
1049983777 9:929213-929235 CCCTGGGATAGAAGGCAAAATGG + Intronic
1050219697 9:3373204-3373226 CAGTGAGAGAGAATGGATGAGGG + Intronic
1050519160 9:6479115-6479137 CAGTGGGAGAAATGGGATCAAGG - Intronic
1050742617 9:8839766-8839788 CAGTGGGAGAAATGGGAAGAAGG + Intronic
1051075581 9:13230747-13230769 CAGAGGGAGAGGAGGGAAACGGG + Intronic
1051566318 9:18503199-18503221 CACTGGGAGAGAGGGGAATGGGG - Intronic
1051801877 9:20944006-20944028 CACTGGGTCAGAAGAGAAAATGG - Intronic
1052581883 9:30367518-30367540 AAGTGGGAGAGACAGTAAAATGG - Intergenic
1052836643 9:33255083-33255105 CAGTGTGAGAGTAGGAAAATTGG + Exonic
1053147799 9:35723774-35723796 CAGAGGCAGAGAAGAGACAATGG + Intronic
1053159958 9:35807025-35807047 CAGTGGCAGAGCAGTTAAAACGG + Exonic
1053588744 9:39488159-39488181 CAGTGGGTGAGTGGGGAAATTGG + Intergenic
1054577561 9:66877135-66877157 CAGTGGGTGAGTGGGGAAATTGG - Intronic
1054783991 9:69192900-69192922 AAGTGAGAGAGAAGGAAGAAAGG - Intronic
1054921728 9:70550084-70550106 CAGTAGCAGGAAAGGGAAAAAGG - Intronic
1055002149 9:71463627-71463649 CAGAAGGAGAGAAGAAAAAATGG - Intergenic
1055213451 9:73828884-73828906 CTGTGGGAGAGAATGTAAATTGG - Intergenic
1055602994 9:77939103-77939125 CAGTGGGAAAGAAGTGACACTGG - Intronic
1055761927 9:79618149-79618171 CAGTGTAAGAGAAGGGATACTGG + Intronic
1055885093 9:81052800-81052822 CAGGGGTAGAGAAGAGAAAATGG - Intergenic
1055976610 9:81961651-81961673 CAGTGGGAGTGAAGGAAGCAGGG - Intergenic
1056063539 9:82909716-82909738 CACTGACAGAGAAGAGAAAAGGG - Intergenic
1056090063 9:83196481-83196503 AAGTGGGAGACAGGGCAAAAAGG + Intergenic
1056579776 9:87882623-87882645 CAGGGGAAGAGAATAGAAAATGG + Intergenic
1056674112 9:88658716-88658738 CAGTGTGTGAGCAGGGAAAATGG + Intergenic
1056900749 9:90597211-90597233 CAGTGGGAGGAAAGGCAAAGGGG - Intergenic
1057059482 9:91990796-91990818 CAGTGGAAGAGAAGGGCCACAGG + Intergenic
1057786190 9:98089141-98089163 AAGTGGGAGACAGGAGAAAAAGG - Intronic
1057909427 9:99006095-99006117 AAGGAGGAGAGAAGGGAGAAAGG - Intronic
1057979781 9:99649646-99649668 CATTGAGAGAGAATGGAGAAAGG + Intergenic
1058234546 9:102473414-102473436 CTATGGGAGAAAAAGGAAAAGGG + Intergenic
1058478462 9:105365771-105365793 GAGTGGGAGACAAGGGAGAAGGG - Intronic
1058526139 9:105859695-105859717 AAGGGGGAGAGAAAGGGAAAGGG + Intergenic
1058710985 9:107679018-107679040 CAGAGGCTGAGAAGGGAGAATGG - Intergenic
1059053605 9:110955006-110955028 CAGTAAGAAAGAAAGGAAAAAGG + Intronic
1059074839 9:111181864-111181886 CTGTGGCAGAGAATGAAAAAAGG - Intergenic
1059153798 9:111972299-111972321 CAGTAGGAGGAAAGGGAAATAGG - Intergenic
1059206200 9:112468577-112468599 GAGAGGGAGAGAGGAGAAAAAGG - Intronic
1059299537 9:113300946-113300968 CAGTGGCAGAGGAGATAAAAGGG + Intronic
1059357339 9:113710267-113710289 CAGTGGTAGTGAGGGGACAAAGG - Intergenic
1059363385 9:113765871-113765893 GAGTAGAAGAGAAAGGAAAAGGG - Intergenic
1059415991 9:114162808-114162830 CAGGGGGAGACAAAGGAGAACGG + Intronic
1059465707 9:114467512-114467534 CGGCGGGGGGGAAGGGAAAATGG + Intronic
1059488004 9:114642226-114642248 CACAGGGAGAGAAAGTAAAATGG - Intronic
1059503508 9:114777204-114777226 GAGTGAGAGAGAAAGGAAGAAGG - Intergenic
1059723461 9:116984185-116984207 CAGTGGCAGAGAAGAGAGATGGG - Intronic
1060171074 9:121461554-121461576 TAGAGGAAGAGAAGGGAAAAGGG + Intergenic
1060180470 9:121530101-121530123 GACTGGGGGAGAAGGGAGAATGG + Intergenic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1060235890 9:121862464-121862486 TAGAGGAAGAAAAGGGAAAAGGG - Intronic
1060548095 9:124472311-124472333 CAGAGGGTGAGAAGGGCACAGGG - Intronic
1061082772 9:128382143-128382165 GAGTGGGAGGGAAGGCACAATGG + Intronic
1061631521 9:131875074-131875096 CAGTGGGGGAAACGGGAAATTGG + Intronic
1061725012 9:132577454-132577476 CAATGGGAAGGAAGGGAGAAAGG + Intergenic
1061994572 9:134177112-134177134 CAGGGGGAGAGGAGGGACATGGG - Intergenic
1062623163 9:137431628-137431650 CAGTGGGAGGGGAGGGGCAATGG - Intronic
1203718932 Un_KI270742v1:185455-185477 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
1203653166 Un_KI270751v1:149130-149152 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
1185474114 X:403463-403485 CTGTGGCAGAGAAGGGAAAATGG - Intergenic
1185516588 X:703597-703619 CAGAGAGAGAGAAAGGAAGAGGG + Intergenic
1185689395 X:2140706-2140728 CAGTGGGAGAGGCTGGAAAAAGG + Intergenic
1185843174 X:3412334-3412356 AAGTGGGCTTGAAGGGAAAAAGG - Intergenic
1185973398 X:4690672-4690694 CAGTGAGAGTGAAGAGGAAATGG + Intergenic
1186076618 X:5886680-5886702 CAGTGGAAGAGAAGGGGATTTGG - Intronic
1187219586 X:17310658-17310680 CAGAGGGATAGAAGAGATAAAGG - Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187740521 X:22350414-22350436 CATTTGGATAGAATGGAAAAAGG - Intergenic
1187761337 X:22589384-22589406 AAGTGGTAGAGAAGAGAAAAGGG + Intergenic
1187977707 X:24719870-24719892 CAGTGGGCAAGAAGGGATCAGGG - Intronic
1187989878 X:24858811-24858833 GTGTGTGAGAGCAGGGAAAATGG - Intronic
1188180409 X:27048507-27048529 CAGTGGTAGTGAAGGAGAAAAGG - Intergenic
1188267132 X:28091100-28091122 AAGTGGGAGAGGAGGCAAAAAGG - Intergenic
1188567938 X:31547898-31547920 CAAAGGGAGAGATGGGAAGAGGG - Intronic
1188675795 X:32937421-32937443 CAGTGGTAAAGAATGAAAAATGG + Intronic
1188893780 X:35642367-35642389 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
1189042084 X:37553559-37553581 TATTGGGTGAAAAGGGAAAAAGG + Intronic
1190046713 X:47117231-47117253 GAGAGAGAGAGAAAGGAAAAAGG + Intergenic
1190444017 X:50504933-50504955 GAGTGGAGGAGGAGGGAAAAGGG - Intergenic
1190467810 X:50744199-50744221 CAGAAGGGGAGAAGAGAAAAAGG - Intronic
1190680440 X:52822500-52822522 CACTCGGAGAAAATGGAAAAAGG - Intergenic
1190930939 X:54949240-54949262 GAGGAGGAGAGAAGGGGAAAAGG + Intronic
1191687923 X:63911635-63911657 CAGTGGCTGCCAAGGGAAAAAGG + Intergenic
1191722958 X:64249833-64249855 CAGAAGAAGAGAAAGGAAAAGGG - Intergenic
1191844016 X:65533176-65533198 ATGAGGGAGAGAAGGGGAAAAGG + Intronic
1191849931 X:65578643-65578665 CAGAGGGAGAGAGAGGGAAAAGG + Intergenic
1191960767 X:66699342-66699364 CAGTGGGAAAGGATGGAAATGGG - Intergenic
1193039143 X:76986557-76986579 AAGAGGAAGAGGAGGGAAAATGG - Intergenic
1193096653 X:77556279-77556301 GAGAGGGAGAGAGGGGAAGAGGG + Intronic
1193096658 X:77556295-77556317 AAGAGGGAGAGAGGGGAAGAGGG + Intronic
1193096665 X:77556317-77556339 GAGAGGGAGAGAGGGGAAGAGGG + Intronic
1193096672 X:77556339-77556361 GAGAGGGAGAGAGGGGAAGAGGG + Intronic
1193096679 X:77556361-77556383 GAGAGGGAGAGAGGGGAAGAGGG + Intronic
1193198746 X:78663218-78663240 CAGATGGAGAGAAGGAGAAAGGG + Intergenic
1193261067 X:79406830-79406852 AAGAGTGAGAGAAGGAAAAATGG - Intergenic
1194035653 X:88868150-88868172 GGGAGGGAGAAAAGGGAAAATGG + Intergenic
1194589746 X:95785197-95785219 TAGTGGGAGTGCAGGGAAAGTGG + Intergenic
1194765436 X:97842775-97842797 CAGTAAGAGAAAAGGGAACATGG - Intergenic
1194769061 X:97878031-97878053 CAGATGGAGAGAAGAGAAAAAGG + Intergenic
1194792446 X:98167739-98167761 CAGTGGGAGAGGATGGTGAAAGG + Intergenic
1195133263 X:101876142-101876164 CAGTGGCTGAGAAGGGTAATGGG + Intergenic
1195274071 X:103262227-103262249 CAGGGGTAGAGATGGGAAGATGG - Intergenic
1195514964 X:105763637-105763659 CAGAGGTAGAGAGGGGGAAATGG + Intronic
1195574737 X:106437233-106437255 CAGTTGAAGAAAAGGGAAAAAGG - Intergenic
1195658796 X:107358702-107358724 CAGAGGGAGAGAAGGAAGGAGGG + Intergenic
1195661425 X:107383001-107383023 GTGGGGGAGAGAAGGCAAAAGGG - Intergenic
1195787186 X:108539784-108539806 CAGTGGCATAAAAGGGGAAAAGG + Exonic
1195861586 X:109388940-109388962 CATTTGGGGAGAAGAGAAAAGGG + Intronic
1195917582 X:109951041-109951063 CAGAGGTTGAGAAGGGAAGAGGG + Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196504247 X:116422622-116422644 GAGAGGGAGACAAGGGAGAAAGG + Intergenic
1197188220 X:123612513-123612535 CAGGGGCTGAGAAGGGGAAATGG + Intronic
1197690196 X:129491497-129491519 ATTTGGGAGAGAAGGCAAAAAGG - Intronic
1198097364 X:133393110-133393132 AAGTGGGAGAGGAGGGAGAATGG + Intronic
1198266332 X:135012426-135012448 TACTGTGAGGGAAGGGAAAAAGG + Intergenic
1198534450 X:137573511-137573533 CAGGCGGGGAGAAGGGAGAAGGG - Intronic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1198752529 X:139949973-139949995 GAGTGGGAGAGAAGGAAGTAAGG + Intergenic
1199348961 X:146776927-146776949 CATAGGGAGAGAATGGTAAATGG + Intergenic
1199431405 X:147764491-147764513 CTGTAGCAGAAAAGGGAAAAAGG - Intergenic
1199950985 X:152706146-152706168 CTGAGGGAGAGAAGGGGGAAGGG + Intergenic
1199953282 X:152722760-152722782 CTGAGGGAGAGAAGGGGGAAGGG + Intergenic
1199956400 X:152745690-152745712 CTGAGGGAGAGAAGGGGGAAGGG - Intergenic
1199958697 X:152762315-152762337 CTGAGGGAGAGAAGGGGGAAGGG - Intergenic
1200418706 Y:2939290-2939312 CAGGCAGAGAGCAGGGAAAAGGG - Intronic
1200524624 Y:4257225-4257247 CATTGGGAGACAATGAAAAATGG + Intergenic
1201173088 Y:11290297-11290319 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
1201232021 Y:11874245-11874267 AAGTGGGTTTGAAGGGAAAAAGG + Intergenic
1201235448 Y:11905908-11905930 ATGTGTGAGACAAGGGAAAAGGG - Intergenic
1201328980 Y:12798057-12798079 AAGGGGGAGGGAAGGGAAAGGGG - Intronic
1201518643 Y:14847312-14847334 CAGTGGAAGAGAAGGGGATTTGG + Intergenic