ID: 1155947448

View in Genome Browser
Species Human (GRCh38)
Location 18:31871754-31871776
Sequence GGTTTTGTATATTCACATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155947448_1155947450 0 Left 1155947448 18:31871754-31871776 CCATTATGTGAATATACAAAACC 0: 1
1: 0
2: 1
3: 24
4: 316
Right 1155947450 18:31871777-31871799 ATATCAATTAATCCTCTATTAGG 0: 1
1: 0
2: 0
3: 16
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155947448 Original CRISPR GGTTTTGTATATTCACATAA TGG (reversed) Intronic
901074650 1:6546128-6546150 GGAGTTGTTTTTTCACATAAGGG - Intronic
902104271 1:14020565-14020587 TGTTTTGTATAATTACACAATGG + Intergenic
902713858 1:18259077-18259099 TGTTTTATTTATTCACCTAAAGG - Intronic
902891902 1:19450433-19450455 GGTTTTAAATTTTCACATTAGGG + Intronic
904734564 1:32621086-32621108 GATTTTCTATATGCACATCAAGG - Exonic
906751667 1:48268059-48268081 GGGTTTTTATAGTCACAGAATGG + Intergenic
907565391 1:55429380-55429402 GGCTTTGTGCATTCCCATAAAGG + Intergenic
908976114 1:69900753-69900775 GGTTTTGGATTTTCACACTAGGG + Intronic
910988867 1:93034411-93034433 TTTTTAGTATATTCACATATAGG + Intergenic
912327611 1:108783524-108783546 ATTGTTGTATATTTACATAATGG - Intronic
913033757 1:114939426-114939448 AATTTGGTATATTCATATAATGG + Intronic
913107882 1:115631438-115631460 GTTTTTATATATGCATATAAAGG - Intergenic
914321244 1:146562692-146562714 GATTTTGTATATACACAAACAGG + Intergenic
914695107 1:150070143-150070165 GGTGTTGTAAATGCATATAAGGG - Intronic
915823577 1:159051855-159051877 GGTTTTTAATATTGACCTAAAGG + Exonic
916417259 1:164603494-164603516 GGATCTGTATTTTCACATAATGG - Intronic
917455856 1:175185054-175185076 GGTTTTGGATTTTCAGATTAGGG - Intronic
917862193 1:179157189-179157211 GATTTTGGATATTCAAATTAGGG + Intronic
919587794 1:199460709-199460731 TTATTTGTATATTCACAAAAAGG - Intergenic
920050261 1:203160430-203160452 GCTTTTGGATTTTCACATTAGGG + Intronic
921003231 1:211066562-211066584 AGTTTTGGATTTTCACATTAGGG + Intronic
921113037 1:212057118-212057140 GGATTTATATATCCACATACAGG + Intronic
921134456 1:212247681-212247703 GGGTTTGTATATGCATATTATGG + Intergenic
921401859 1:214733270-214733292 GTTGTCGTATATTCACACAATGG - Intergenic
923002763 1:230021224-230021246 GGTTTTGTTTTTTTAAATAAAGG - Intergenic
923475457 1:234327256-234327278 GTTTTAGTATATTCACAGAATGG - Intergenic
1063292079 10:4760117-4760139 GGTTTGGTATATTCAGATGGAGG + Intergenic
1063999624 10:11652887-11652909 GGTTTTGAATATTTAAATACAGG + Intergenic
1064939514 10:20717625-20717647 GGTATTGTATATACACAATAAGG + Intergenic
1065515207 10:26517742-26517764 GTTTTGGTATAGTCACACAATGG - Intronic
1066204557 10:33175225-33175247 GGAATTGGATATTCACATATTGG + Intergenic
1066804722 10:39235275-39235297 GTTTTTGTCCATTCACAGAATGG + Intergenic
1066808147 10:39285158-39285180 GTTTTTGTCCATTCACAGAATGG - Intergenic
1066812565 10:39359357-39359379 GTTTTTGTATAGTCTCCTAAGGG - Intergenic
1068296430 10:55077923-55077945 ACTTTTGTATATTCTCATGATGG + Intronic
1068338231 10:55666299-55666321 TGATTTTTATATTCATATAAAGG - Intergenic
1068816273 10:61317985-61318007 GGTGTGGTATATTCATAAAATGG + Intergenic
1069093069 10:64225222-64225244 AGTTTTGTATATTTTCATGATGG - Intergenic
1069389418 10:67917488-67917510 GGCTTTGCATATTCACATTTTGG - Exonic
1070089003 10:73265506-73265528 ACTATAGTATATTCACATAATGG - Intronic
1071314165 10:84376561-84376583 GTTGTAGTATATTCACACAAAGG - Intronic
1071812011 10:89192636-89192658 GTTTGTGTATATATACATAAAGG + Intergenic
1071927294 10:90424793-90424815 GGCTATGTGTATTCAGATAACGG - Intergenic
1071982672 10:91019442-91019464 CATTGTGTATATTCACAAAATGG + Intergenic
1072759990 10:98048750-98048772 TGTTTTGTGTATTTAGATAAAGG - Intergenic
1073354850 10:102845690-102845712 GGTTTTGTTTGTTTACAAAAAGG + Intergenic
1073587807 10:104727508-104727530 AGTTTTGTATATTCTTAGAAGGG + Intronic
1074489873 10:113930047-113930069 GGATTTGTATCTCAACATAAAGG - Intergenic
1074670198 10:115781460-115781482 ATTTTAGTATAGTCACATAATGG + Intronic
1075868079 10:125744691-125744713 GCTTTTGGATCTTCACAAAATGG + Intronic
1076104458 10:127809686-127809708 GATTTTTTATTTTTACATAAGGG - Intergenic
1077546902 11:3175869-3175891 AGTTTGGTATGTTCACATAGTGG + Intergenic
1078454741 11:11466283-11466305 GGATTTCAATATTCACGTAAAGG - Intronic
1078931611 11:15916440-15916462 ATTGTGGTATATTCACATAATGG - Intergenic
1079937602 11:26637131-26637153 GGGTTTGTCCATTCACATAATGG - Intronic
1081279171 11:41187260-41187282 GGATTTGTACAGACACATAATGG - Intronic
1081341310 11:41931224-41931246 GGTTCAGTATATTCACTTATGGG - Intergenic
1082035384 11:47641614-47641636 GGTATTTTATATTCACATGCAGG - Intronic
1082266421 11:50123548-50123570 CCTTTTATTTATTCACATAATGG - Intergenic
1082289668 11:50355020-50355042 CCTTTTATTTATTCACATAATGG + Intergenic
1082584836 11:54923931-54923953 GTTTTTGTCCATTCACAGAATGG - Intergenic
1082871276 11:57945443-57945465 GGTTTTGTTTAAAGACATAAAGG + Intergenic
1084160035 11:67343162-67343184 ATTTTAGTATATTCACACAATGG + Intronic
1084854060 11:71969274-71969296 GTTGTGATATATTCACATAATGG + Intronic
1085576421 11:77608313-77608335 TGTTTTGAAAATTCACATATTGG - Intronic
1086313505 11:85563681-85563703 GTTTTGGTATATCCATATAAAGG - Intronic
1086348648 11:85923140-85923162 GATTTTGGATTTTCACATTAGGG - Intergenic
1087246415 11:95843351-95843373 GGTTTTGTAACATCACATATTGG - Intronic
1087288342 11:96291688-96291710 GATATTGTATATGCACACAAAGG + Intronic
1087369550 11:97265264-97265286 GATATGGTATATCCACATAAGGG - Intergenic
1087658780 11:100960652-100960674 GCTTTTTTATATTCAAATAATGG + Intronic
1088862035 11:113809607-113809629 GATTTTGGATATTCACATGTGGG + Intronic
1089998554 11:122932111-122932133 GGCTTTGTATATTAACTTCAGGG + Intronic
1090119553 11:124010819-124010841 ATTGTTGTATATTCACACAATGG + Intergenic
1092595006 12:9992968-9992990 GCTTCTGTATATTCAAAGAAGGG + Intronic
1092599670 12:10045785-10045807 GGTTCTGGATATTCAAAGAAGGG - Intronic
1092627389 12:10341573-10341595 ATTGTTGTATATTCATATAATGG - Intergenic
1094035344 12:26064334-26064356 GGTTTGGTATCTTCAAGTAAAGG + Intronic
1094250594 12:28355636-28355658 GGGTTTGTAAATTAACATATAGG + Intronic
1094571856 12:31648153-31648175 AGTACTGAATATTCACATAATGG + Intronic
1094866190 12:34533457-34533479 GTTTTTGTATATTCTGAAAATGG - Intergenic
1095536139 12:43250182-43250204 GGTTTTGTCTATTCATTCAATGG + Intergenic
1095778403 12:46033733-46033755 GGTTTTGTGAGTTTACATAATGG - Intergenic
1097292357 12:57928689-57928711 ATTATGGTATATTCACATAATGG + Intergenic
1097354463 12:58586037-58586059 GGTTTTGAATTTTCAGATTAGGG + Intronic
1098117082 12:67190547-67190569 GGTTTTTTATCTTCACAAACAGG - Intergenic
1099622580 12:85023446-85023468 TGTTTTGTATGCTCAAATAATGG + Intronic
1100136907 12:91564314-91564336 GGTTGTGTAAGTTAACATAAGGG + Intergenic
1101463682 12:104924813-104924835 GGTACAGTATATTCATATAATGG + Intronic
1102103758 12:110302308-110302330 TCTTTTGAATATTCAAATAAAGG - Intronic
1102798699 12:115712563-115712585 GGTTTTGGATTTTCAAATTAGGG - Intergenic
1104517170 12:129438398-129438420 TGTGTTGTATATTCATATAATGG + Intronic
1106022490 13:25928833-25928855 GATTTCGTATTTTCACATTAGGG - Intronic
1106022824 13:25931071-25931093 GATTTTGGATTTTCACATTAGGG - Intronic
1106688544 13:32088844-32088866 GGTTTTGTATTCTCAAAAAAAGG - Intronic
1107504724 13:41022194-41022216 GGTATAGTATATCCATATAATGG + Intronic
1109271691 13:60262737-60262759 AATGTTGTATATACACATAATGG - Intergenic
1109815365 13:67575359-67575381 GGTTTTGAATATTTAGATGAAGG + Intergenic
1109997433 13:70147259-70147281 GGTTTTATAAATTCACATCATGG - Intergenic
1110237122 13:73228437-73228459 GGTTCTGGTTATTCACATACAGG - Intergenic
1110253200 13:73403592-73403614 ATTATGGTATATTCACATAATGG + Intergenic
1113181501 13:107633154-107633176 GCTTTTATATTTTCATATAAAGG + Intronic
1114444113 14:22774924-22774946 GATTTTGGATATTCAGATTAGGG + Intronic
1115746626 14:36444463-36444485 GGTTTTGGATTTTCAGATTAAGG + Intergenic
1119475908 14:74928205-74928227 GGTTTTGGATTTTCAGATTAGGG + Intergenic
1121474340 14:94182633-94182655 ATTGTGGTATATTCACATAATGG - Intronic
1121913506 14:97814817-97814839 GGATTTTTATATTAATATAATGG - Intergenic
1122728556 14:103777645-103777667 GGTGTTACCTATTCACATAATGG - Intronic
1123840395 15:24241910-24241932 AGTTTTGGATATTCACCCAATGG - Intergenic
1126025208 15:44439634-44439656 GGTTTTGTATTTTCAAATTAGGG + Intronic
1127952948 15:63827767-63827789 AATGTAGTATATTCACATAACGG + Intronic
1128041277 15:64575668-64575690 GTATTTGTATATTTACAAAAAGG + Intronic
1128930450 15:71699705-71699727 GGTTTTCTATATTAATATGACGG + Intronic
1130265419 15:82397516-82397538 GGTATGGTATATTCAAACAATGG - Intergenic
1131040396 15:89259850-89259872 AATGTTGTATATCCACATAATGG - Intronic
1131219723 15:90572380-90572402 CGTGTTGGATATTTACATAAGGG + Intronic
1131676183 15:94673079-94673101 GGTTTTGTTTATTCTCATGTTGG + Intergenic
1131957560 15:97752670-97752692 TATTTTGTAAATACACATAATGG - Intergenic
1132009313 15:98261363-98261385 GGTATTGTATATTTCCATTAGGG - Intergenic
1132074150 15:98805756-98805778 GCTTTTGTAAACGCACATAAAGG + Intronic
1132100217 15:99017707-99017729 GGTTTTGTATGTAAACAGAAGGG - Intergenic
1134318555 16:13141849-13141871 GGATTTGTCTACTAACATAATGG + Intronic
1134346688 16:13398140-13398162 GGGTTTTTATATTCACAGGATGG + Intergenic
1135832676 16:25790065-25790087 TGTTGAGTATATTCACATAGTGG + Intronic
1137225151 16:46497053-46497075 TGATTGGTATATTCACACAATGG + Intergenic
1137908238 16:52348558-52348580 GGTATGTTATATTCATATAATGG + Intergenic
1138033860 16:53582791-53582813 GTTGTGGTATATTCATATAATGG + Intergenic
1138757722 16:59509065-59509087 TGTTTTAAAAATTCACATAAGGG + Intergenic
1140012383 16:71148454-71148476 GATTTTGTATATACACAAACAGG - Intronic
1143414134 17:6733756-6733778 GGTTTTGTGAGTTTACATAATGG + Intergenic
1144993741 17:19252110-19252132 GATTTTGGATTTTCACATTAGGG + Intronic
1145110867 17:20159964-20159986 GCCTTTTTATATTCACACAAAGG + Intronic
1148263099 17:46201420-46201442 GGTTTTGAATTTTCAGATTAGGG - Intronic
1153434137 18:5050354-5050376 TGATTTGTTAATTCACATAATGG - Intergenic
1155156958 18:23165712-23165734 AGTTTTGCATATACAGATAATGG - Intronic
1155424912 18:25696823-25696845 GCTATTGTACATTCACATAATGG - Intergenic
1155947448 18:31871754-31871776 GGTTTTGTATATTCACATAATGG - Intronic
1156040851 18:32820985-32821007 GGTCTAGTATATTCACACAATGG + Intergenic
1156834335 18:41534364-41534386 GGTTTTATGTATAAACATAATGG + Intergenic
1157409285 18:47450116-47450138 GGATGTGTGCATTCACATAAAGG - Intergenic
1157417601 18:47518857-47518879 AATTTAGTATATGCACATAAAGG + Intergenic
1159373070 18:67554331-67554353 AATTTTGTATATTCATATAATGG - Intergenic
1159583114 18:70255541-70255563 ATATTTATATATTCACATAAAGG - Intergenic
1159935579 18:74364411-74364433 GTTTTGGCATATTCACATATTGG - Intergenic
1159992349 18:74923980-74924002 AAAGTTGTATATTCACATAATGG + Intronic
1160129445 18:76211513-76211535 GGTTTTGTAATTGCAGATAAGGG - Intergenic
1162257144 19:9499714-9499736 GATATTGTATATTCACACATAGG - Intergenic
1162735540 19:12745175-12745197 GGTTTTGTATGGTTGCATAAAGG - Intronic
1167790057 19:51670200-51670222 AGTGTGGTATATCCACATAATGG - Intergenic
926430726 2:12783314-12783336 TGTTATGTATATTAAAATAAAGG - Intergenic
927017791 2:18984628-18984650 TGTTCAGTATATTCACATTATGG + Intergenic
928814573 2:35276128-35276150 TTTTTTGTATATCTACATAAAGG + Intergenic
929145493 2:38703841-38703863 GTTTTTGTATTTTCACAGAGAGG - Intronic
929836985 2:45411357-45411379 GCTGTGGTATATTCACACAATGG + Intronic
932726055 2:74180508-74180530 AATGTGGTATATTCACATAATGG - Intergenic
933418207 2:82014321-82014343 AATATTGTATATTCAAATAATGG - Intergenic
936240618 2:110785639-110785661 GCTGTGGTATATTCACACAAAGG - Intronic
936629428 2:114185715-114185737 GGTTATGTATATTCCCATCTGGG + Intergenic
936851972 2:116910839-116910861 GGCTTTATATATTTACATAGAGG - Intergenic
937549446 2:123068914-123068936 GGTTTTGTATTTTCAAACAAAGG - Intergenic
939090513 2:137775256-137775278 GGTTTTGTATGTACATAAAATGG + Intergenic
939224827 2:139351914-139351936 GGTTTTGGATAGTCACATTGTGG + Intergenic
940557155 2:155243835-155243857 TGTATTTCATATTCACATAATGG + Intergenic
941117905 2:161492970-161492992 GAGTTTGTATAATAACATAATGG - Intronic
941376147 2:164733282-164733304 GGTTAAGAATATTAACATAATGG + Intronic
941567219 2:167124463-167124485 TGAATTTTATATTCACATAAAGG - Intronic
942361553 2:175177942-175177964 GCTTTTGTTTATTCATATAAAGG - Exonic
943400931 2:187410147-187410169 GGTTTTGTAAAGTCAGAAAATGG + Intronic
943958959 2:194234301-194234323 AGTTTTGAATGTTCCCATAAAGG + Intergenic
944125206 2:196284534-196284556 GCTTTGCTTTATTCACATAAAGG + Intronic
945013828 2:205493447-205493469 ATTTTTGTATACTCACAAAAGGG - Intronic
945278252 2:208010323-208010345 GGTTTTCCAATTTCACATAAAGG - Intronic
945585019 2:211650574-211650596 GATATTGCATATTCACAGAAGGG - Intronic
945665670 2:212738643-212738665 GGTTTTGTATACACACAGATTGG - Intergenic
945712734 2:213319567-213319589 GATTTTGTATATTCATCTAATGG + Intronic
946624314 2:221594479-221594501 GGTTTTGTATTATCTCACAAAGG + Intergenic
947676937 2:231990842-231990864 AGTTTAGTATATTCACATCTTGG - Intronic
948512656 2:238480511-238480533 AATATAGTATATTCACATAATGG - Intergenic
1169829237 20:9805503-9805525 GATGTGGTATATTCACACAATGG + Intronic
1171521564 20:25779346-25779368 GATTTTCTATATGCACATCAAGG + Intronic
1172049389 20:32105115-32105137 CTTGTGGTATATTCACATAATGG + Intergenic
1172740775 20:37165016-37165038 GGTATTGTATATCCACATGATGG - Intronic
1172987903 20:39007720-39007742 GGTTTGGAACATTCACAGAAGGG + Intronic
1173722863 20:45274798-45274820 GATTGTGGATATTCATATAATGG - Intergenic
1177328421 21:19624659-19624681 GTTTCTATATATTCACATAAAGG + Intergenic
1177479303 21:21666012-21666034 GCATATCTATATTCACATAAGGG + Intergenic
1177972959 21:27812832-27812854 TGTTTGGTATATTCAAGTAATGG + Intergenic
1178718404 21:34987489-34987511 GGCTTTGTAAAATCACTTAAAGG + Intronic
1183137112 22:35899464-35899486 GTTTTTGTATGTTTTCATAAAGG - Intronic
949130459 3:493999-494021 GATCTTGAATATTCACATTACGG + Intergenic
951075553 3:18386996-18387018 GGCTTTGTATCTTTACATATTGG - Intronic
953227579 3:41034517-41034539 GTGTTTGTTTATTTACATAATGG - Intergenic
955136899 3:56227902-56227924 GTTGTGGTATATTCACATAATGG + Intronic
955144063 3:56298791-56298813 GTTTTAGTATATTCACAAAGTGG - Intronic
955430052 3:58833842-58833864 GTTTTTGTTTATCCACATAATGG + Intronic
955822018 3:62906555-62906577 GGTTTTGTTTGTTCATAAAATGG - Intergenic
957274308 3:78070618-78070640 ATTATTGTATATTCACACAATGG + Intergenic
957517588 3:81275706-81275728 GGTATTGTATATTCTAGTAAGGG - Intergenic
957853379 3:85841222-85841244 GTTTTTAAATATTCACCTAAAGG - Intronic
959007877 3:101040916-101040938 GGTTTTGGATTTTCAGATTAAGG + Intergenic
959981355 3:112521469-112521491 GGTGGTGTATATACACAAAATGG - Intergenic
962472065 3:135718334-135718356 TGTGGTGTATATACACATAATGG + Intergenic
964191685 3:154010061-154010083 GTTACTGTATATTCATATAAAGG + Intergenic
964795117 3:160488563-160488585 GTTTTTGTATATACCCAGAAAGG + Intergenic
965381846 3:167999241-167999263 CGTTTTGTATAATTACAAAACGG - Intergenic
965593798 3:170387547-170387569 AATGTGGTATATTCACATAATGG - Intronic
965883034 3:173410223-173410245 TATTTTGTTTATTCCCATAACGG - Intronic
966571461 3:181448688-181448710 ATTTTTGTGTATGCACATAATGG + Intergenic
966997817 3:185300820-185300842 AATTTGGTATATTCACACAATGG - Intronic
967676956 3:192311503-192311525 AGTTTGGTATATTCATACAATGG - Intronic
969923961 4:10568163-10568185 AGTGTTGTATAGTCACACAATGG + Intronic
970936753 4:21580580-21580602 ATTTTTGGATAATCACATAAAGG - Intronic
971130652 4:23805843-23805865 GGCTGTGTTTATTCCCATAATGG - Intronic
971652023 4:29289718-29289740 AGTTTAATATATTCATATAATGG - Intergenic
972114976 4:35620175-35620197 GCTTTTCTCTATTCACAAAATGG - Intergenic
972247589 4:37261697-37261719 GATTTTGTATATTTACATTATGG - Intronic
973234616 4:47886070-47886092 AATTTAGTATATTCACACAATGG + Intronic
974154519 4:58054188-58054210 AGTGTTATATATTCACATTATGG - Intergenic
974583803 4:63843073-63843095 TGTTTTGATTATTCACATCAAGG - Intergenic
974927845 4:68323081-68323103 TGTTTTGTGTATTTATATAAAGG + Intronic
978069473 4:104449133-104449155 GGTTTTGAATATTGAATTAATGG + Intergenic
978508186 4:109483514-109483536 GATTTTGGATTTTCACATTAGGG + Intronic
978891768 4:113837401-113837423 TCTTTTGTATGTTCATATAATGG - Intergenic
979070339 4:116195706-116195728 GTTTATGCATATACACATAATGG + Intergenic
981818334 4:148856937-148856959 TGTTTTGTAATTTCTCATAAAGG - Intergenic
982347411 4:154375858-154375880 ATTATTGTATATTCACATAAAGG + Intronic
982609519 4:157556008-157556030 GGTTTTGTTTATTCAGATGTGGG + Intergenic
983309385 4:166038291-166038313 CCTTTTGTATTTTCACAAAAGGG + Intronic
983779046 4:171644970-171644992 AGTTTTGTTTTTTCACCTAAGGG - Intergenic
984687216 4:182683427-182683449 GATTTTGTATTTTCAGATTAGGG + Intronic
984791235 4:183616877-183616899 GGTTTTGAATATATAGATAAGGG - Intergenic
985534278 5:454615-454637 GGTTTTGTCACTTCACTTAAGGG + Intronic
986154505 5:5160884-5160906 TGTTTTTTGTATACACATAAAGG - Intronic
987048978 5:14133684-14133706 AATTTTGTATATTCATATAATGG - Intergenic
987232020 5:15904322-15904344 TGTATTGTGTATTCACATGACGG - Intronic
987850362 5:23344821-23344843 AATATGGTATATTCACATAAAGG + Intergenic
989808797 5:45647249-45647271 GGTTTTATATCTTCTCACAATGG + Intronic
990915412 5:60897817-60897839 GATTTTGAATATTCAGATTAGGG - Intronic
992069178 5:73134290-73134312 AGTGTGGTATATTCACACAATGG - Intergenic
992795362 5:80251038-80251060 GGCTTTGTTAATTAACATAACGG + Intronic
993124966 5:83822658-83822680 GGGTTTGTTAATTCATATAATGG - Intergenic
994151107 5:96448702-96448724 GGTTTACCATATTCACATAAGGG + Intergenic
995078016 5:108010834-108010856 GGTTTTGCATCATCCCATAAAGG - Intronic
996311058 5:122105922-122105944 GATTTTGGATTTTCAAATAAGGG + Intergenic
996538123 5:124600179-124600201 GGTTTTGTATATATTTATAAAGG + Intergenic
996878320 5:128264124-128264146 GGTTTTGTAGATTCTCACAAAGG - Intronic
997123656 5:131202712-131202734 AGTTTTCTGTATTCACACAAGGG + Exonic
999545110 5:152620112-152620134 GTTGTGGTATATTCATATAATGG + Intergenic
1000396395 5:160779127-160779149 GTTTTTATATAATCACAAAAAGG + Intronic
1001222309 5:169911736-169911758 GGTTTTGCACAATCAGATAAAGG - Intronic
1001461994 5:171924411-171924433 GGTTTTTAATAGTCACAGAATGG - Intronic
1002083587 5:176753543-176753565 AGTATGGTATATTCACATAATGG + Intergenic
1002451981 5:179324227-179324249 GCTTTAGTATGTTCACAGAATGG - Intronic
1003821754 6:9905940-9905962 GTTTTTGTAAATCCACTTAAAGG - Intronic
1006708156 6:36040101-36040123 GGTTTTGGATTTTCAGATTAGGG + Intronic
1007451539 6:41943473-41943495 CATTTTGTACATTCACCTAATGG - Intronic
1007509239 6:42362809-42362831 GGGATTGTGGATTCACATAATGG - Intronic
1008243497 6:49142600-49142622 GCTTTTCTCTTTTCACATAAAGG - Intergenic
1008703768 6:54132772-54132794 GGTTTTCTCAATTCACATATGGG - Intronic
1008845068 6:55952676-55952698 AGTTTGGAATGTTCACATAATGG - Intergenic
1009063603 6:58428113-58428135 GTTTTTGTCCATTCACAGAATGG - Intergenic
1009251264 6:61302699-61302721 GTTTTTGTCCATTCACAGAATGG - Intergenic
1009261683 6:61498200-61498222 GTTTTTGTCCATTCACAGAATGG - Intergenic
1009960685 6:70517192-70517214 GTTTGTATATATACACATAAAGG - Intronic
1011182809 6:84640351-84640373 TTTGTTGTATTTTCACATAATGG + Intergenic
1011930173 6:92701445-92701467 GGGTTTTTATATGCACAGAATGG + Intergenic
1012097551 6:94982689-94982711 TGTATTGTATGTACACATAAGGG - Intergenic
1012139721 6:95610131-95610153 GTTGTTGTATATTCACATAAAGG + Intergenic
1012739125 6:102991982-102992004 GCATTTATATACTCACATAAAGG - Intergenic
1014181781 6:118392469-118392491 GTTTTAGTATATTCACAAGATGG + Intergenic
1014975811 6:127881170-127881192 GGTTTTGTATATTATGATACTGG - Intronic
1017510335 6:155108929-155108951 GATTTATTATAATCACATAAGGG - Intronic
1021056740 7:16057934-16057956 GTTATAGTATATTCACACAAGGG + Intergenic
1021166278 7:17346307-17346329 TGTTTTTTATATCCAGATAAAGG - Intergenic
1022591708 7:31670226-31670248 GGTTTCGGATTTTCACATGAGGG - Intergenic
1023037468 7:36145419-36145441 AGTTTTGTATATTAACCTCATGG - Intergenic
1024745627 7:52402684-52402706 AATGTTGTATATTTACATAAGGG + Intergenic
1025242103 7:57285612-57285634 TGTTTTATATATATACATAATGG - Intergenic
1026270711 7:68834154-68834176 GGTTTTGAATTTTCAGATTAGGG - Intergenic
1027742728 7:82032351-82032373 TGTTTTGTAAATTTACAAAAAGG - Intronic
1028098260 7:86789032-86789054 TGTTTTGTTTATCCAAATAATGG - Intronic
1028244322 7:88458463-88458485 GCATTTGCATAATCACATAATGG + Intergenic
1028813646 7:95119233-95119255 TCTTTTATATATTCACAGAAAGG + Intronic
1029336600 7:99905490-99905512 GCTTTGGTATATTAATATAATGG + Intronic
1030447232 7:109662131-109662153 TGTTTTATACATTCATATAATGG - Intergenic
1032210843 7:129912681-129912703 GATTTTGGATTTTCAGATAAGGG + Intronic
1032438861 7:131926066-131926088 GAATTTGTACATTCACATCAGGG - Intergenic
1032534590 7:132651948-132651970 AGTCTGGTATCTTCACATAATGG + Intronic
1037568604 8:20139614-20139636 GGTGTAATATATTCATATAATGG + Intergenic
1041328763 8:56699358-56699380 GTTTTTGTATTTTCACTTACTGG - Intergenic
1041987186 8:63936223-63936245 GGTTGTGTATATTCTTATCATGG - Intergenic
1043093982 8:75941937-75941959 GAGTTTGTATATTAACATACAGG - Intergenic
1043225453 8:77722465-77722487 GGTTTTTGATACTGACATAATGG + Intergenic
1043964413 8:86456729-86456751 ATTGTTGTATATTCATATAATGG + Intronic
1044055277 8:87561865-87561887 GCTTTGGTATATTCATAAAATGG - Intronic
1044577890 8:93791432-93791454 GGTTTTGTATGCTAACATTAGGG - Intronic
1044891239 8:96838276-96838298 TCTTTTGCATGTTCACATAATGG + Intronic
1045292454 8:100845565-100845587 TGCATTGTATAGTCACATAAAGG + Intergenic
1045685866 8:104711586-104711608 TATTGTGTATATTCATATAATGG + Intronic
1047476901 8:125241184-125241206 GATTTTGTATTTTCAGATTAAGG + Intronic
1050886118 9:10768016-10768038 GTTTTTGTATGTTAACATTAGGG + Intergenic
1050924867 9:11251390-11251412 AGTTTTGTACATTTACATATAGG - Intergenic
1051550645 9:18325230-18325252 ACTTTTGTATATTTACCTAAGGG + Intergenic
1051871282 9:21740506-21740528 GGTTTTGAGTGATCACATAAAGG - Intergenic
1052334397 9:27304961-27304983 GCTTATGTATATGCACATGAGGG - Intergenic
1052786594 9:32833815-32833837 GGTTCTTTAGATTTACATAATGG - Intergenic
1053333397 9:37237586-37237608 TATTTTGTATTTTCACACAATGG + Intronic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055360412 9:75483711-75483733 GTTTTAGTTTATTAACATAAAGG + Intergenic
1056062660 9:82900025-82900047 AGTTTCGTAAATTCACATAGTGG + Intergenic
1059832117 9:118108224-118108246 AGTGATGCATATTCACATAAGGG - Intergenic
1060449034 9:123719908-123719930 GATTTTGAATTTTCAGATAAGGG + Intronic
1060862937 9:126970432-126970454 GATTTTGACTATTCAAATAATGG + Intronic
1186853056 X:13599554-13599576 TGACTTGTATATTCACACAATGG - Intronic
1187723507 X:22176870-22176892 ATTGTGGTATATTCACATAATGG - Intronic
1187803375 X:23090413-23090435 ATTTTTGTATATTGACAAAATGG - Intergenic
1187921794 X:24210461-24210483 GGCTTTGTTTACTCACAAAATGG + Exonic
1188181853 X:27066111-27066133 GTTTTTTTCTATTCACCTAAAGG + Intergenic
1190765025 X:53468927-53468949 GATTTTGAATTTTCAGATAAGGG - Intergenic
1191263791 X:58360773-58360795 GTTTTTGTTTATCCACAAAATGG + Intergenic
1191264074 X:58364884-58364906 GTTTTTGTCCATTCACAGAATGG + Intergenic
1192109179 X:68346941-68346963 TGTGTTGTATATACACATGAAGG - Intronic
1192328823 X:70157552-70157574 ATTTTGGTATATTCACACAATGG + Intronic
1192342398 X:70274977-70274999 TTTGTGGTATATTCACATAATGG - Intronic
1193901772 X:87188409-87188431 ATTATTCTATATTCACATAATGG + Intergenic
1195038390 X:100991268-100991290 GATTTTGGATTTTCACATTAGGG + Intergenic
1195134342 X:101889181-101889203 GGTTTCATATCTTCACAGAAAGG - Intronic
1195511455 X:105720562-105720584 ATTTTTGTATAATCACGTAATGG - Intronic
1195797313 X:108665229-108665251 GTTATGGTATATTCATATAATGG + Intronic
1196562803 X:117171219-117171241 TGTTTTATATATTCCCAAAATGG - Intergenic
1196591753 X:117493562-117493584 GGTCTTGTTTATTCAGACAATGG + Intergenic
1196711260 X:118765522-118765544 AGTATGGTATATTCACACAATGG - Intronic
1196924395 X:120619213-120619235 GGTATTGAATATTCAAATTAGGG - Intronic
1197781402 X:130164227-130164249 GGTTTTGTGTATTGAAATGATGG - Intronic
1198138536 X:133779653-133779675 GGTGTTATATATTAACACAATGG - Intronic
1198786528 X:140294908-140294930 GGTTTGGTATAATGACAGAAGGG - Intergenic
1199242704 X:145566605-145566627 GGCTTTGTATGTGCAGATAAAGG - Intergenic
1199380017 X:147159849-147159871 AGTGTGGTATATACACATAACGG - Intergenic
1199579951 X:149351125-149351147 GGCTCTGTATATTCACCCAAGGG - Intergenic
1200306831 X:155034395-155034417 ACTGTGGTATATTCACATAATGG - Intronic
1200421923 Y:2979078-2979100 GGCTTTGTTTACTCACAAAATGG + Exonic
1201713848 Y:17021612-17021634 GTTTTTGAATATTTACATAGAGG + Intergenic