ID: 1155949436

View in Genome Browser
Species Human (GRCh38)
Location 18:31893898-31893920
Sequence ACTAAACTGCAAAACCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155949434_1155949436 -10 Left 1155949434 18:31893885-31893907 CCTATGAAGCTTCACTAAACTGC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1155949436 18:31893898-31893920 ACTAAACTGCAAAACCTGGATGG 0: 1
1: 0
2: 3
3: 11
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155949436 Original CRISPR ACTAAACTGCAAAACCTGGA TGG Intronic
902519397 1:17007456-17007478 ACTAAGCTGGAAAAGCTGGGCGG + Intronic
905324705 1:37142909-37142931 ACTGAACTGGAAAAGCTAGAAGG - Intergenic
905337803 1:37257472-37257494 ACAAAACTGGAAAAGCTGGATGG + Intergenic
907616598 1:55932999-55933021 ACTAGACTGTAAACTCTGGAGGG + Intergenic
908232640 1:62121235-62121257 ACTGGCCTGCAAAACCTGGTTGG + Exonic
909151320 1:72009656-72009678 ACAAAACTGTAAATCCTGAATGG - Intronic
912276893 1:108268390-108268412 ACAAAACTATAAAAACTGGAGGG + Intergenic
912291336 1:108425965-108425987 ACAAAACTATAAAAACTGGAGGG - Intronic
912577538 1:110686987-110687009 ACAAAATGGCAAAATCTGGAAGG + Intergenic
912600498 1:110927700-110927722 ACTACTGTGGAAAACCTGGAAGG - Intergenic
913491287 1:119382580-119382602 ACTACACTGCAGCACTTGGATGG - Intronic
915541320 1:156568511-156568533 AACAAACAGAAAAACCTGGATGG - Intronic
919456400 1:197825262-197825284 ACAAGACTGCAAATCCAGGATGG + Intergenic
921165264 1:212502432-212502454 ACTTAACTCCAAAGCCTGGGAGG + Intergenic
924691811 1:246359193-246359215 CCTAAACTAGAAAACCTAGAGGG + Intronic
1062873474 10:927165-927187 ACTGAACTGCAAATCCTTTATGG + Intronic
1063771050 10:9201363-9201385 AGTAAACTGCACACCCTGAAAGG + Intergenic
1063937592 10:11094853-11094875 ACTCTAGTGCAAAACCTTGAAGG + Intronic
1066066128 10:31762181-31762203 ACAAAACTGCAGGACCTTGAGGG + Intergenic
1066076346 10:31881662-31881684 ACTAAGATTCAAAACCAGGAAGG + Intronic
1066273998 10:33850595-33850617 AATAAACTAGAAAACCTAGAAGG - Intergenic
1068708015 10:60098925-60098947 AATAGACTGCTAAAACTGGAGGG - Intronic
1073149389 10:101301648-101301670 ACTGAACTGCTAATGCTGGATGG - Intergenic
1073730791 10:106285231-106285253 ACTAGACTGCATAAGGTGGACGG + Intergenic
1075905845 10:126081347-126081369 TTTAAACTGAAAAATCTGGATGG - Intronic
1078188675 11:9073998-9074020 TCAAAAATGCAAAACATGGAAGG + Intronic
1078616295 11:12869205-12869227 GCTATCCTGCAAAACCTGGCTGG - Intronic
1078885389 11:15494845-15494867 TCTAAACTACAAAGTCTGGAAGG + Intergenic
1082073078 11:47955076-47955098 ACTAAAAAGGAAAACCTGCAGGG - Intergenic
1082567387 11:54697068-54697090 AATAAACTACAAAATCTAGAAGG - Intergenic
1082644299 11:55702294-55702316 ACTAGACAGTAGAACCTGGATGG + Intergenic
1083067953 11:59945322-59945344 ACAAAAATGCCAAACCTGAAAGG + Intergenic
1085543377 11:77294126-77294148 ACGAAACAGCAAAACATGAATGG + Intronic
1087763286 11:102124447-102124469 ACTGTACTGCAAAATCTTGAGGG - Intronic
1089927738 11:122276725-122276747 ACTAAACTCCAAATACTTGAGGG + Intergenic
1090740969 11:129659794-129659816 AATAAACTGGAAAATCTAGAAGG + Intergenic
1093667053 12:21826913-21826935 ACTAGATTGCAAATCTTGGAAGG + Intronic
1096521748 12:52188412-52188434 CCTAAACTGGAACTCCTGGAGGG + Intronic
1097327210 12:58290244-58290266 AGTAAACGCTAAAACCTGGAAGG - Intergenic
1097380901 12:58894788-58894810 AATAAACTGTAAATACTGGAAGG + Intronic
1102275791 12:111580974-111580996 ACTAAAATACAAAACCTAGCCGG + Intronic
1106909412 13:34447328-34447350 ACTAAATTGAATAATCTGGAAGG + Intergenic
1110151626 13:72261578-72261600 AATAAACTGCAAAACTAGAATGG - Intergenic
1112535191 13:100247068-100247090 ACTAAACTATAAAACTTGGTCGG - Intronic
1116366587 14:44074495-44074517 ACTAAATCTCAAAAACTGGAGGG + Intergenic
1117424068 14:55577847-55577869 ACTACACTTTAAAACCTAGAGGG + Intronic
1119315323 14:73689494-73689516 CCCAAACTGAAAAAGCTGGATGG + Exonic
1120231020 14:81841528-81841550 ACTATACTGCAAAGCCCAGAAGG - Intergenic
1122091013 14:99340572-99340594 CCTAAACTACAAAACCTGGATGG + Intergenic
1123153396 14:106203493-106203515 AGAAAACTCCAAAAACTGGAAGG - Intergenic
1125716173 15:41821191-41821213 CCTGAACTGCAAAGCCAGGATGG + Intronic
1126098480 15:45105814-45105836 ACTAAACAGCAGCACCTGGGTGG + Exonic
1126309264 15:47297511-47297533 CCTAAAATGGAAAACCTTGAAGG + Intronic
1128307711 15:66610968-66610990 CTTAAACTGAAAAACCTGGCCGG - Intronic
1130758194 15:86789007-86789029 ATCACACTGCAAAATCTGGAAGG + Intronic
1131213535 15:90518189-90518211 ACTAAAAAGCAAAACCTAGCTGG + Intergenic
1132121595 15:99180637-99180659 ACTCAACTTCAAACCCTGGAAGG + Intronic
1141992123 16:87616544-87616566 ACAAAAATACAAAACCTGGCTGG - Intronic
1143092448 17:4457093-4457115 ACAAAACTCCAACACCTGGCTGG + Intronic
1146818807 17:35967894-35967916 ACTAACTTACAAATCCTGGAGGG + Intergenic
1146859926 17:36288011-36288033 ACAAAACTAAAAAAGCTGGAAGG - Intronic
1147090252 17:38092104-38092126 ACAAAACTAAAAAAGCTGGAAGG - Intergenic
1147106961 17:38228422-38228444 ACAAAACTAAAAAAGCTGGAAGG + Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148422562 17:47560124-47560146 ACAAAACTAAAAAAGCTGGAAGG - Intronic
1150376642 17:64686978-64687000 AGAAAACTACCAAACCTGGAAGG + Intergenic
1152058217 17:78049429-78049451 ACTGGACTGCAAATACTGGAAGG - Exonic
1153862721 18:9230243-9230265 AACAAACTGAAAAACCTAGAGGG - Intronic
1155394404 18:25371591-25371613 AATCACCTGCAAAACTTGGACGG - Intergenic
1155949436 18:31893898-31893920 ACTAAACTGCAAAACCTGGATGG + Intronic
1156971641 18:43163829-43163851 ACTTTAATGTAAAACCTGGAAGG - Intergenic
1157140251 18:45098640-45098662 ACTTAACTGGACAACCTGGGTGG - Intergenic
1157582246 18:48780476-48780498 TCAAAACTGCAAAGGCTGGAGGG + Intronic
1157772135 18:50358554-50358576 ACTGAAATGCAACACCAGGAGGG - Intergenic
1157993170 18:52521720-52521742 ACTAAACTGGAAAAGGTGAATGG + Intronic
1158738850 18:60115728-60115750 ACAAAGCTGGCAAACCTGGAGGG - Intergenic
1161095243 19:2386560-2386582 ACTAAAATTCAAATCCTGGCTGG - Intergenic
1163928290 19:20365477-20365499 AGAAAACTGCAAAAACTGGAGGG + Intergenic
1164219784 19:23183317-23183339 AGAAAACTCCAAAAACTGGAAGG - Intergenic
1165104519 19:33461229-33461251 ACTAAACACAAAAACCTGGTGGG + Intronic
1165659001 19:37558315-37558337 AGAAAACTCCAAAAACTGGAGGG - Intronic
1166480087 19:43164224-43164246 ACTAAAATGCAAAAACTAGCTGG + Intronic
1168264727 19:55216510-55216532 AGCAAGCTGGAAAACCTGGATGG - Intergenic
925989612 2:9243807-9243829 ACTAAACTGTGAGTCCTGGAAGG - Intronic
926251751 2:11158920-11158942 AGTAGACGGCAAAACCTGCAGGG + Intronic
926253924 2:11173597-11173619 ACTAAACTGCAAGCCCCTGAAGG - Intronic
927593624 2:24378104-24378126 AAGGAACTGCAAGACCTGGAAGG - Intergenic
928714944 2:34049528-34049550 AATAAAGTGAAAAACCTGGGGGG - Intergenic
929681916 2:44000205-44000227 ACTAAAATACAAAAATTGGAAGG - Intergenic
931734139 2:65178551-65178573 ACTAAAATGCAAAAACTAGCTGG + Intergenic
936857588 2:116979319-116979341 ACTAAAGTGCAACTCCTGCATGG + Intergenic
937597445 2:123687984-123688006 AGAAAACTCCAAAAACTGGAGGG + Intergenic
937604740 2:123785378-123785400 ACTTAAATGCAAGACCTGAAAGG - Intergenic
943221247 2:185109207-185109229 AGTAAATTGAAAAACATGGATGG + Intergenic
945122368 2:206470088-206470110 CCTAAAATGTAAACCCTGGAAGG + Intronic
1169779929 20:9298045-9298067 AGAAAACTGCAGAAGCTGGAAGG + Intronic
1171268267 20:23791833-23791855 AATAAACTAGAAAATCTGGAAGG + Intergenic
1172388568 20:34550514-34550536 ACTAAAGTGCAAGCCCTTGAAGG - Intronic
1172544517 20:35749112-35749134 AATAAACTGGAAACCCTTGAAGG - Intergenic
1172892511 20:38277015-38277037 ACTAAACTGCAAACACAGGCCGG + Intronic
1173393984 20:42661011-42661033 ACTAAAATGCAAAAATTAGACGG - Intronic
1175357895 20:58383393-58383415 AGAAATCTGCAAAACCTGGCTGG + Intergenic
1177068112 21:16465173-16465195 GCTTAACTGGGAAACCTGGAAGG + Intergenic
1177137567 21:17322344-17322366 AATAAATTGGAAAACCTAGAAGG + Intergenic
1179822914 21:43947177-43947199 TGTAAACTGCAAACCCTGGCAGG - Intronic
949244394 3:1908801-1908823 ACTCAACTTCAAAAGCTGGGCGG + Intergenic
949372359 3:3349217-3349239 ACTAAACTGCAGGCCATGGATGG + Intergenic
950120884 3:10481927-10481949 ACTAAACTGTAAATCCATGAGGG + Intronic
951130265 3:19034065-19034087 ACTAAATTGGAAAACCTAGAAGG + Intergenic
951501768 3:23395730-23395752 TCTGAACTGCAAAACTAGGAAGG + Intronic
951666759 3:25134368-25134390 AATAAACAGCAAAACCTAGATGG - Intergenic
952713070 3:36451383-36451405 ATTAATCTGCAAAAACAGGAAGG - Intronic
953207765 3:40847077-40847099 ATTAAAATGCAAAACCTGTGTGG + Intergenic
956274662 3:67485063-67485085 ATTAAACTGAAAAACTCGGAAGG + Intronic
956516648 3:70056445-70056467 ACAAAACTAGAAAACCTGAAAGG - Intergenic
957711517 3:83865872-83865894 ACAAAACTACAGAACCAGGAAGG + Intergenic
959398750 3:105873122-105873144 ATTTAGCTGCAAAATCTGGAAGG + Intergenic
960406180 3:117262614-117262636 ACTAATCTGGAAAATCTGGGAGG - Intergenic
963005014 3:140718808-140718830 AAAAAACAGCAAAACCTGGGAGG - Intergenic
964485974 3:157185689-157185711 ACTAGAATGCAAAACCTGTAAGG + Intergenic
965104190 3:164338291-164338313 AGAAAACTCCAAAAACTGGAGGG - Intergenic
965582539 3:170284920-170284942 ACTAAATGGCAAAAATTGGAAGG - Intronic
966854529 3:184185106-184185128 ACAAAATTGCAAGACCTGAAGGG - Intronic
968710158 4:2108831-2108853 ACTAATCCTCAAAACCTTGATGG + Intronic
969470106 4:7382547-7382569 ACTGGACTGCAAATCCTGAAAGG + Intronic
970272478 4:14362074-14362096 ACTAAAATGCTAAGCCTTGAGGG - Intergenic
971095357 4:23395329-23395351 AATAAATTGGAAAACCTAGAAGG - Intergenic
971672970 4:29587939-29587961 ACAAAATTACAAAACATGGAAGG + Intergenic
974586005 4:63878421-63878443 AATAAATTGGAAAACCTAGAAGG + Intergenic
974744351 4:66051440-66051462 ACAAAATTGCAAAACCTCAAAGG + Intergenic
974763795 4:66313409-66313431 GCTAAACTGCATAGCATGGAAGG + Intergenic
981067590 4:140501401-140501423 ACTAAACTCCTAAACCTCCATGG + Intergenic
981535215 4:145792885-145792907 AATAAACTGCAAAATATGGCAGG + Intronic
983319083 4:166172421-166172443 ACAAAAATGCAGAAACTGGAAGG - Intergenic
985053253 4:186013780-186013802 GTTAAACAGCAAAACCTGGATGG - Intergenic
986011091 5:3715925-3715947 ACTCAAGTGCAATTCCTGGAAGG + Intergenic
988716780 5:33836413-33836435 GATCAGCTGCAAAACCTGGAAGG + Intronic
988908835 5:35819135-35819157 ACTAGACTGAAAATCCTGCAGGG + Intergenic
989009159 5:36850669-36850691 AACAAACTACAAAATCTGGAAGG + Intergenic
989111715 5:37913219-37913241 AGTAAACTGGAACTCCTGGAAGG - Intergenic
991658419 5:68926453-68926475 ACTAAACTGCAGAAGCTGGAGGG - Intergenic
992220954 5:74572953-74572975 AACAAACTGCAAAAGCAGGAAGG + Intergenic
993033877 5:82735694-82735716 ACCAAACTCCAAGACCTTGATGG + Intergenic
993518230 5:88864413-88864435 GAGAAACTGCAATACCTGGATGG + Intronic
994081241 5:95710910-95710932 AGAAAACTCCAAAAACTGGAGGG - Intergenic
994956017 5:106533516-106533538 AACAAATTGGAAAACCTGGAAGG - Intergenic
996534413 5:124562369-124562391 ATTAAAGTGCAAATGCTGGATGG + Intergenic
997000141 5:129749679-129749701 ACTAAACTGCATAGCATAGAAGG - Intronic
998307491 5:141094300-141094322 AATAAATTTCAGAACCTGGAAGG - Intergenic
1001172678 5:169435647-169435669 AATAAACTGCAAAATATAGAAGG - Intergenic
1001594590 5:172889967-172889989 ATTAAACTCCACCACCTGGATGG - Intronic
1002438746 5:179252449-179252471 ACTAAATATCAAAACGTGGATGG - Intronic
1004535529 6:16497267-16497289 ATTATACTGAAAGACCTGGATGG - Intronic
1005738802 6:28772588-28772610 AGAAAACTCCAAAAACTGGAGGG - Intergenic
1005989069 6:30892172-30892194 ACTCACCTGCATAGCCTGGAAGG - Exonic
1007130989 6:39473382-39473404 ATTAAATTGGAAAACCTGTAGGG - Intronic
1008738368 6:54574870-54574892 ACTGAACTTGAAAAACTGGATGG - Intergenic
1008908828 6:56711135-56711157 ATTAAAATGCAAAAACTGAATGG + Intronic
1010190576 6:73191758-73191780 ACTAAACTGCAAACTCTACAAGG - Intronic
1016028302 6:139311638-139311660 ACTAAACTGGAGAAACTGGAAGG + Intergenic
1016790017 6:148058626-148058648 ACTGAATGGCAAAAGCTGGAAGG - Intergenic
1018720411 6:166567735-166567757 TCTAAACTGGAAAACCTGTTCGG + Intronic
1021241988 7:18213907-18213929 ACTAAACTTACAAAGCTGGAAGG - Intronic
1021312977 7:19116234-19116256 ATTAAGCTGAACAACCTGGAAGG + Intronic
1021436515 7:20623895-20623917 AATAAACTACATGACCTGGAGGG - Intronic
1024949418 7:54843681-54843703 GCTTAACTTCAAAACCTGTAAGG + Intergenic
1027781059 7:82521146-82521168 ACTAAATTGCAGAAAATGGAAGG + Intergenic
1030185746 7:106760035-106760057 ACTAAGCTGGAAAATCTGGCTGG - Intergenic
1030930602 7:115519660-115519682 TCTGAACTGCAAAACCTGGTAGG + Intergenic
1034956248 7:155337261-155337283 AGTAAGCTGCAAATGCTGGATGG + Intergenic
1036025877 8:4908370-4908392 ACTAAACTACAGAACCAAGAAGG - Intronic
1039081132 8:33735006-33735028 ACAAAAGTGCAAAACCTCTATGG + Intergenic
1039189390 8:34955262-34955284 TCTAAACTGGGAAACCGGGAAGG + Intergenic
1040505407 8:48043391-48043413 ACTAAACTGCAAAACTTTGATGG - Intronic
1045701819 8:104875627-104875649 ACTAGACTGTAAACTCTGGAAGG + Intronic
1046178432 8:110610304-110610326 ACCACACTGCAAAAGCAGGATGG + Intergenic
1047661055 8:127037315-127037337 AATAAACAGCTAAATCTGGAAGG + Intergenic
1048038228 8:130698487-130698509 ACAATACTGCAAATGCTGGAGGG + Intergenic
1048632548 8:136259917-136259939 ACTAACTTGCAAAACATGGGTGG - Intergenic
1049979401 9:890539-890561 ACTAAAGTGCAAGCTCTGGAAGG - Intronic
1050994648 9:12200910-12200932 AATAAAATGAAAAAACTGGAAGG + Intergenic
1052362335 9:27574146-27574168 ACTCCACTGCAAACCCTGGTAGG + Intergenic
1052694979 9:31866214-31866236 AACAAACTGAAAAACCTAGAAGG - Intergenic
1054959583 9:70953034-70953056 GCTATACTGCTAAAGCTGGACGG + Intronic
1056812426 9:89775068-89775090 ACTGATCTGCAAGAGCTGGAGGG - Intergenic
1058845491 9:108953979-108954001 ACTAAACCTAAAAACCTTGAGGG - Intronic
1059307157 9:113362844-113362866 GCTAAAATGCAAAATCTGAATGG - Intronic
1059907171 9:119000601-119000623 ACTAAAGTGACAAACCTGAAAGG - Intergenic
1060706763 9:125809597-125809619 AATAAACTGTAAAACTTAGAAGG + Intronic
1188973673 X:36647780-36647802 AATAAATTGCAAGACCTGGAGGG - Intergenic
1189304773 X:39978828-39978850 ACTACACAGCAAAACTTGCAGGG - Intergenic
1189582611 X:42423186-42423208 AATAAACTGGAAATCTTGGAGGG + Intergenic
1192566200 X:72165671-72165693 ACTAAATTGTAAAAACTGAATGG + Intergenic
1195008473 X:100711152-100711174 TCTAAACAGCAAAACCTGAAAGG + Intronic
1195168223 X:102240850-102240872 ACTAAACAGCAAAACATTCAAGG - Intergenic
1195190634 X:102446237-102446259 ACTAAACAGCAAAACATTCAAGG + Intronic
1198426488 X:136525939-136525961 ACTTAACTGCTAGACCTAGATGG + Intergenic
1198747020 X:139901265-139901287 AGTCAACTTCCAAACCTGGAAGG - Intronic
1199085916 X:143630810-143630832 AATAAACTGCAGAACATTGAGGG - Exonic
1200087647 X:153616615-153616637 TGGAAAGTGCAAAACCTGGATGG + Intergenic
1200846280 Y:7834608-7834630 AGAAAACTCCAAAAACTGGAAGG + Intergenic
1200934911 Y:8729946-8729968 AATAAACTACAAAATCTGTAAGG - Intergenic
1201730475 Y:17197294-17197316 ACTAAAACTCAAATCCTGGAAGG + Intergenic
1202128184 Y:21586909-21586931 AATAAACTGCAAAATCTCTAAGG + Intergenic
1202181632 Y:22144889-22144911 AATAAACCGCAAAATCTGTAAGG - Intergenic
1202209728 Y:22441513-22441535 AATAAACCGCAAAATCTGTAAGG + Intergenic