ID: 1155950431

View in Genome Browser
Species Human (GRCh38)
Location 18:31905379-31905401
Sequence GTCCATATGCACCAAAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155950431_1155950434 20 Left 1155950431 18:31905379-31905401 CCTACACTTTGGTGCATATGGAC 0: 1
1: 0
2: 1
3: 4
4: 57
Right 1155950434 18:31905422-31905444 CCACCAGCCTTGCACAGCTCTGG 0: 1
1: 1
2: 2
3: 19
4: 265
1155950431_1155950439 28 Left 1155950431 18:31905379-31905401 CCTACACTTTGGTGCATATGGAC 0: 1
1: 0
2: 1
3: 4
4: 57
Right 1155950439 18:31905430-31905452 CTTGCACAGCTCTGGGCTCAGGG 0: 1
1: 2
2: 4
3: 40
4: 336
1155950431_1155950438 27 Left 1155950431 18:31905379-31905401 CCTACACTTTGGTGCATATGGAC 0: 1
1: 0
2: 1
3: 4
4: 57
Right 1155950438 18:31905429-31905451 CCTTGCACAGCTCTGGGCTCAGG 0: 1
1: 0
2: 2
3: 42
4: 393
1155950431_1155950435 21 Left 1155950431 18:31905379-31905401 CCTACACTTTGGTGCATATGGAC 0: 1
1: 0
2: 1
3: 4
4: 57
Right 1155950435 18:31905423-31905445 CACCAGCCTTGCACAGCTCTGGG 0: 1
1: 0
2: 3
3: 23
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155950431 Original CRISPR GTCCATATGCACCAAAGTGT AGG (reversed) Intronic
907047434 1:51308049-51308071 GTCCACATGCACCACAGAGAAGG - Intronic
907064121 1:51462553-51462575 GTCCACATGCACCACAGAGAAGG + Intronic
916499391 1:165373876-165373898 GCCCATATGCACCTAAATGTGGG + Intergenic
918259495 1:182782727-182782749 CTCCATATGCACAAAAGTTGTGG + Intergenic
1066573385 10:36798452-36798474 GTCCATATACATCAAAATATAGG - Intergenic
1070438396 10:76416039-76416061 TTCCATATGATACAAAGTGTAGG - Intronic
1076450512 10:130554089-130554111 GGCCACATCCACTAAAGTGTGGG - Intergenic
1078437060 11:11334064-11334086 GAGCATATGGACCACAGTGTCGG - Intronic
1081164676 11:39792982-39793004 GTCCGAATGCACCAAAATGTTGG - Intergenic
1083059773 11:59857762-59857784 GAGCATATGCACGACAGTGTAGG + Intronic
1086922345 11:92601773-92601795 GTCCTTCTGCACCAGAGTTTAGG + Intronic
1089205508 11:116758535-116758557 GCCAATATGCACCAAGATGTTGG - Intronic
1091191178 11:133696468-133696490 AAGCATATGCACCAAAATGTTGG - Intergenic
1091948936 12:4575176-4575198 GTACATTTGCACCAATGTTTTGG - Intronic
1091951505 12:4596657-4596679 CTTCATATGCACCACATTGTAGG - Exonic
1093934389 12:24985237-24985259 GGCCATATGGATCAAATTGTTGG - Intergenic
1111223971 13:85245095-85245117 GTCCAAACCCACCAAATTGTGGG + Intergenic
1120207968 14:81606761-81606783 TTCAATATGCAGCAAAGTTTTGG - Intergenic
1126177198 15:45747060-45747082 GTCCGTATGCACAGAATTGTTGG + Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1131598130 15:93820056-93820078 TTCCATATGCACCAAGGTGATGG + Intergenic
1137315206 16:47312218-47312240 ATTCATATGCAGCAAATTGTGGG - Intronic
1137923487 16:52516090-52516112 GTTCATCTGGTCCAAAGTGTTGG + Intronic
1138211438 16:55166538-55166560 GTTCTTCTGCACCAAAGGGTTGG + Intergenic
1147645696 17:42032561-42032583 GTACATACACCCCAAAGTGTGGG - Intronic
1151515497 17:74592424-74592446 TTCCACATGCACAAAAGTTTGGG - Exonic
1154410152 18:14135811-14135833 GTCCATTTTCACCAAAGAGGAGG + Intergenic
1155950431 18:31905379-31905401 GTCCATATGCACCAAAGTGTAGG - Intronic
1156508983 18:37619481-37619503 GTCTATATACAGCAAAGTGCTGG - Intergenic
926264949 2:11307781-11307803 GTACATATGCAACAATCTGTTGG - Intronic
940611354 2:155996019-155996041 GTCTATATACAGAAAAGTGTAGG - Intergenic
943139510 2:183963052-183963074 TTCCATGTGCACCTAAGTATGGG + Intergenic
945060057 2:205900868-205900890 GTCCATTTGCAGGAAAATGTTGG + Intergenic
1173218503 20:41111141-41111163 GTCCATGTGCACTAGAGTGAGGG + Intronic
1176862909 21:14022600-14022622 GTCCATTTTCACCAAAGAGGAGG - Intergenic
1182716636 22:32361567-32361589 GGCCATATCTACCAAACTGTTGG + Intronic
955953271 3:64263402-64263424 GTCCATGTGCCCCAAAGACTAGG + Intronic
957120576 3:76085834-76085856 GCTCAAATGCACAAAAGTGTGGG - Intronic
968402605 4:311630-311652 GTCCATTTTCACTAAAGAGTAGG + Intergenic
970795954 4:19913849-19913871 TTACATCTGCACCAATGTGTAGG - Intergenic
976537598 4:86236441-86236463 ATCCAGATTTACCAAAGTGTAGG - Intronic
986166192 5:5273274-5273296 GTCCACTTGCCCCAAAGTGCTGG - Intronic
986736520 5:10672268-10672290 GTCCTTATGCTGCAAAATGTTGG + Intergenic
992277999 5:75140894-75140916 GTTCGTAGGCAGCAAAGTGTTGG - Intronic
997752756 5:136364263-136364285 GTCTACATGCACCTAAGTTTAGG + Intronic
1001863367 5:175080453-175080475 GTCCATCTGCCCCATAGAGTAGG - Intergenic
1014966440 6:127759303-127759325 GTCCATATTCACAAATATGTAGG + Intronic
1016838088 6:148499391-148499413 GAGCATTTGAACCAAAGTGTAGG + Intronic
1017246081 6:152226768-152226790 GTCCATAGGCTCCAAAGACTGGG - Intronic
1027270455 7:76515779-76515801 ATCCATATGCACAAGAGGGTTGG - Intronic
1028466580 7:91159543-91159565 GTCCATATTATCTAAAGTGTTGG + Intronic
1041903040 8:63002818-63002840 GTCTATATGGAGCCAAGTGTCGG + Intergenic
1042693346 8:71528237-71528259 GTCCATATGCACCAAACAGATGG - Intronic
1046686878 8:117237571-117237593 CTCCAAATGCAGCAAATTGTGGG + Intergenic
1052554465 9:29996709-29996731 GGACATATGCCCCAATGTGTTGG + Intergenic
1055606989 9:77980794-77980816 TTACATATGTATCAAAGTGTGGG - Intronic
1058121182 9:101140793-101140815 GTACATACACACCAAACTGTGGG - Intronic
1186006531 X:5078289-5078311 GCCCATAAGCACTAAAGTGAAGG - Intergenic
1187359372 X:18610366-18610388 GTCCATCTGGAACAAACTGTGGG - Intronic
1188797179 X:34481449-34481471 GTGCATATGCACACAAGTGCTGG + Intergenic
1193927068 X:87500487-87500509 GTCCATGTTCAACATAGTGTTGG - Intergenic
1200409994 Y:2851511-2851533 GTCCATAAGCACCAAAGCAGTGG - Intronic
1202049606 Y:20766864-20766886 GTCCATAAGCACCAGAGCATTGG - Intronic