ID: 1155951109

View in Genome Browser
Species Human (GRCh38)
Location 18:31914258-31914280
Sequence ACGCACTAAAAAATTATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155951107_1155951109 1 Left 1155951107 18:31914234-31914256 CCTAGCAAACAACAAAATGATAT 0: 1
1: 0
2: 1
3: 43
4: 488
Right 1155951109 18:31914258-31914280 ACGCACTAAAAAATTATGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155951109 Original CRISPR ACGCACTAAAAAATTATGGC TGG Intronic
901927555 1:12576124-12576146 ACGCTCTGAAAAAATGTGGCAGG + Intronic
902668653 1:17956633-17956655 AGGCACTAAAAAATTAGCACCGG + Intergenic
903123333 1:21231122-21231144 ACACTCAAAAAAATTATTGCTGG - Intronic
905554105 1:38868607-38868629 ACACACAAAAAAAATGTGGCTGG + Intronic
906565325 1:46796446-46796468 ACGCAATAAAAAATGAAGGGGGG - Intronic
907153274 1:52308477-52308499 ATGTACAAGAAAATTATGGCCGG - Intronic
910587435 1:88894934-88894956 ACCCTCTAAAACATTATGACAGG - Intergenic
910710584 1:90175819-90175841 ACTCCTTAAAAAATTATGGAAGG + Intergenic
910721819 1:90295038-90295060 ACTCACCTAAAAATTAGGGCAGG + Intergenic
913668136 1:121069438-121069460 TCAGAGTAAAAAATTATGGCTGG - Intergenic
914019883 1:143856879-143856901 TCAGAGTAAAAAATTATGGCTGG - Intergenic
914658379 1:149764784-149764806 TCAGAGTAAAAAATTATGGCTGG - Intergenic
915293794 1:154905559-154905581 AAACACTAAGAAATTAAGGCTGG - Intergenic
918404563 1:184198726-184198748 ACTGATTAAAAAATTAGGGCTGG - Intergenic
919367102 1:196675408-196675430 ACACACTAACAACTTTTGGCTGG + Intronic
922932163 1:229398485-229398507 TCTCAATAAAAAATTAAGGCGGG - Intergenic
923125471 1:231030720-231030742 ACACTCTAAAAAATTATTGAAGG + Intronic
924828724 1:247570055-247570077 ACACACTAAAAAATAATAGAGGG - Intronic
1063540350 10:6927580-6927602 ATGAAATAAAAAATTATAGCAGG + Intergenic
1063941064 10:11129726-11129748 ACGCAATAAAAAATGATAACGGG - Intronic
1064300227 10:14116775-14116797 AAGCAAGGAAAAATTATGGCAGG - Intronic
1066149054 10:32595397-32595419 ACGCAATAAAAAATTATAAAGGG - Intronic
1066274005 10:33850684-33850706 ACGCAATAAAAAATTATAAAGGG - Intergenic
1067665743 10:48276946-48276968 ACGCAATAAAGAATTTTGACAGG - Intergenic
1067669328 10:48305430-48305452 ATGCAATAAATAATTATTGCAGG + Intergenic
1069730753 10:70610694-70610716 AGGCACTAAAGAATTATCGCAGG - Intergenic
1072388513 10:94957755-94957777 ACGCAATAAAAAATGATGAAGGG - Intronic
1073165579 10:101446630-101446652 ATGGACTAAAAAATTAGGCCAGG + Intronic
1078919458 11:15815787-15815809 ATGCACTATAAAATCTTGGCTGG - Intergenic
1080396634 11:31895873-31895895 AGGCACAAAAAAATTAAGGAAGG - Intronic
1082047365 11:47740884-47740906 ACACACAAAAAAAATGTGGCTGG - Intronic
1082731877 11:56807955-56807977 ACACACAAAAAAATAATGCCCGG - Intergenic
1087445677 11:98249667-98249689 AAGCACTAAAAATTTATGCAAGG - Intergenic
1087794560 11:102441843-102441865 ACGCAATAAAAAATGATGAAGGG + Intronic
1090515715 11:127424220-127424242 TTGCACTAAAAAATTTTGGGGGG - Intergenic
1093319972 12:17702227-17702249 ACGCAATAAAAAATGATGAAGGG - Intergenic
1093350480 12:18093889-18093911 ACGCAATAAAAAATGATGAAGGG + Intronic
1095564768 12:43610117-43610139 ACGCAATAAAAAATGATAGATGG + Intergenic
1097951285 12:65431380-65431402 AGGCACAAAAAAATTAATGCTGG - Intronic
1098642344 12:72854274-72854296 ACGCAATAAAAAATGATAACAGG - Intergenic
1102167452 12:110818063-110818085 ACAAAATAAAAAATTGTGGCCGG - Intergenic
1104864984 12:131948125-131948147 ACACACTGAAAATTTTTGGCTGG - Intergenic
1105774136 13:23640755-23640777 ACTTACTGCAAAATTATGGCAGG - Intronic
1107404629 13:40101024-40101046 AAGCAATAATAAATTAAGGCTGG - Intergenic
1107551165 13:41477192-41477214 ACGCAATAAAAAATTATACAGGG - Intergenic
1110698149 13:78516056-78516078 ACGCAATAAAAAATGATAACGGG - Intergenic
1111784401 13:92769227-92769249 ATGGACTAGAATATTATGGCAGG + Intronic
1112378015 13:98862050-98862072 ATTCACTAAAAATTTATGGGGGG - Intronic
1113140180 13:107138829-107138851 GGGCACTAAGAAATGATGGCAGG - Intergenic
1114869808 14:26642654-26642676 ACACAATAAAAAATGATGGAGGG - Intergenic
1115094974 14:29623445-29623467 GAGAAGTAAAAAATTATGGCAGG + Intronic
1116042302 14:39700437-39700459 ACGCAATAAAAAATTATGAAGGG - Intergenic
1116137870 14:40951758-40951780 ACGCAATAAAAAATTATGAAGGG - Intergenic
1117808173 14:59516461-59516483 ACGCAATAAAAAATGATAACTGG + Intronic
1118104741 14:62645266-62645288 ACCCTCCAAAAAATTATGTCAGG + Intergenic
1118494826 14:66297754-66297776 ACGCAATAAAAAATGATAGAGGG + Intergenic
1119139580 14:72254161-72254183 ATGAACTAAAAAATTATTTCAGG - Intronic
1124220248 15:27844789-27844811 ACACATTAAAAATTTATTGCTGG - Intronic
1125188509 15:36961814-36961836 ATGGATTAAAAAAATATGGCTGG - Intronic
1126554383 15:49969417-49969439 ACACAATAAAAAATTATGAAGGG + Intronic
1126824856 15:52538988-52539010 AGGCATTAAAATATTGTGGCTGG + Intergenic
1128927662 15:71673337-71673359 ACGCAATAAAAAATGATAGAGGG - Intronic
1131415411 15:92251831-92251853 ACGCAATAAAAAATGATGAAGGG + Intergenic
1146580505 17:34033656-34033678 ACGCAATAAAAAATGATGAAGGG + Intronic
1153173450 18:2343741-2343763 ACGCAATAAAAAATGATAGAGGG + Intergenic
1155951109 18:31914258-31914280 ACGCACTAAAAAATTATGGCTGG + Intronic
1156280335 18:35630846-35630868 ACGCAATAAAAAATGATGAAGGG + Intronic
1156541870 18:37920279-37920301 AAGTACTAAAAAATTAGGCCGGG - Intergenic
1162908775 19:13838651-13838673 ACTCACTAAAGACTTAGGGCTGG - Intergenic
926384336 2:12321381-12321403 ACTCCCTAAAAAAGTATGGCAGG + Intergenic
928041642 2:27883855-27883877 ATACATTAAAAAATTATGGCTGG - Intronic
929026628 2:37610940-37610962 ACTCACTCATAAATTAAGGCTGG - Intergenic
929272485 2:39987819-39987841 ACGCAATAAAAAATGATGAAGGG + Intergenic
930803333 2:55465438-55465460 ACGCAATAAAAAATTATAAAGGG + Intergenic
931369588 2:61649927-61649949 AAACACTAAAAACTTTTGGCTGG + Intergenic
936371771 2:111907799-111907821 ACGCTCTTAAATATTCTGGCTGG + Intronic
938722879 2:134081881-134081903 ACGCATTAAATACTTCTGGCAGG - Intergenic
938878852 2:135563717-135563739 AACCACAAAAAAATTAAGGCTGG - Intronic
938966813 2:136395931-136395953 ATGAAATAAAAAAATATGGCAGG + Intergenic
940942056 2:159573075-159573097 AAGGACTAAAAAATTAGGGGTGG + Intronic
942564182 2:177250346-177250368 ACCCACTAAATAATTATGTTGGG + Intronic
944572445 2:201058378-201058400 AATCACAAAAATATTATGGCTGG - Intronic
944582436 2:201143665-201143687 TAGAATTAAAAAATTATGGCTGG + Intronic
946097462 2:217287784-217287806 ATGCAGTAAAATATTTTGGCTGG - Intronic
948176872 2:235950408-235950430 ATGCAAGAGAAAATTATGGCTGG + Intronic
1171560205 20:26117639-26117661 ACGCAATAAAAAATGATAACGGG + Intergenic
1173878438 20:46392045-46392067 ACTCACAAAAAAGTTATGGTGGG - Intronic
1174882433 20:54294889-54294911 ACACACTAAAAAGTTATCACAGG + Intergenic
1175558540 20:59895166-59895188 ATCAACTAAATAATTATGGCAGG + Intronic
1177111758 21:17037388-17037410 ACGCAATAAAAAATGATAGAGGG + Intergenic
1178299137 21:31437230-31437252 TGTCACTAAAATATTATGGCTGG + Intronic
1178925515 21:36771700-36771722 ATGCTTTTAAAAATTATGGCCGG + Intronic
1182069489 22:27453557-27453579 AAACACCAAAAAATAATGGCTGG - Intergenic
956193104 3:66625792-66625814 ACGCATTAAAAACATATGGAAGG - Intergenic
956676543 3:71738688-71738710 AGGCAATAGAAAATTATAGCTGG + Intronic
957414741 3:79886796-79886818 AAGCAATAAAAAATATTGGCTGG + Intergenic
959349576 3:105244634-105244656 ACATACTTAAAAATAATGGCTGG - Intergenic
960077477 3:113504088-113504110 AGGCACTAAACTATCATGGCAGG + Intronic
960569071 3:119167770-119167792 ACGCAATAAAAAATTATAAAGGG + Intronic
965223869 3:165962146-165962168 ACGCAATAAAAAATTATAAAGGG + Intergenic
967869463 3:194218082-194218104 ACTTATTAAAAAATTATGGCTGG - Intergenic
970600187 4:17636063-17636085 ACTCACTAAAAAATTAATACAGG - Intronic
970907799 4:21237522-21237544 ACGCAATAAAAAATGATAACGGG + Intronic
971168287 4:24206676-24206698 ACACACAAAAAAATAATAGCTGG + Intergenic
972324523 4:38002756-38002778 ACGCTCTTAAAAATTATGGGTGG + Intronic
974132228 4:57770913-57770935 ACGCAATAAAAAATGATGAAGGG + Intergenic
974494173 4:62605433-62605455 ACGCAATAAAAAATGATGAAGGG + Intergenic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
976592822 4:86866274-86866296 ACGCACTAAAAAATGATAAAGGG + Intergenic
976809616 4:89086959-89086981 ACGCAATAAAAAATTATAAAGGG - Intronic
977340677 4:95753504-95753526 ACGCAATAAAAAATGATGAAGGG + Intergenic
977374481 4:96184169-96184191 ACGCACAAGAAAACTATAGCTGG + Intergenic
977618892 4:99114513-99114535 ACGCACTAAAAAATGATAAAGGG - Intergenic
979800508 4:124902952-124902974 ACAGACTAAAGAATAATGGCAGG + Intergenic
980629907 4:135417669-135417691 ACGTACATAAAAATTATGGTAGG - Intergenic
983600522 4:169521531-169521553 ATGCACTAAGAAGTTATTGCAGG - Intronic
984372703 4:178887232-178887254 ATGCAATAAAAAATGATGGAGGG + Intergenic
985071757 4:186172648-186172670 ACGCAATTAAAAGCTATGGCAGG + Exonic
988614266 5:32758451-32758473 ACGCAATAAAAAATTATAAAGGG - Intronic
991279104 5:64890685-64890707 AAGAACTAGAAAATGATGGCTGG - Intronic
993317920 5:86434887-86434909 ACGCAATAAAAAATTATAAAGGG - Intergenic
994161175 5:96558500-96558522 ACGCACTAAAAAATGATAAAGGG + Intronic
994429986 5:99646240-99646262 GTTCACTAAAAAATTGTGGCTGG + Intergenic
994547342 5:101183289-101183311 ACGCAATAAAAAATGATAACGGG + Intergenic
994882462 5:105516084-105516106 ACGCAATAAAAAATGATAACGGG - Intergenic
998169528 5:139864310-139864332 AAGCACTCCATAATTATGGCTGG + Intronic
999842261 5:155440861-155440883 ATACACTAAAATATCATGGCTGG + Intergenic
1001093983 5:168762070-168762092 AAGAGCTAAAAAATTATAGCTGG - Intronic
1006609028 6:35281543-35281565 AAGCACTAAAAAACTGTGACAGG - Intronic
1009719668 6:67451363-67451385 ACACACTAAAACATTCTGGAGGG - Intergenic
1010737515 6:79459690-79459712 ACGCAATAAAAAATGATAACGGG - Intergenic
1012230944 6:96760986-96761008 ATGCATTAAAAAATAATGACAGG - Intergenic
1012372266 6:98522163-98522185 ACGCAATAAAAAATTATAAAGGG - Intergenic
1013582098 6:111545648-111545670 AAATACAAAAAAATTATGGCTGG + Intergenic
1014185530 6:118430087-118430109 ACGCAATAAAAAATGATGAAGGG + Intergenic
1014274792 6:119375302-119375324 ACGCAATAAAAAATGATGAAGGG - Intergenic
1015260978 6:131237754-131237776 ACGCAATAAAAAATGATGAAGGG - Intronic
1015672852 6:135709874-135709896 AAGAAATAAAAAATCATGGCAGG + Intergenic
1022634957 7:32123005-32123027 ACACAATAAAAAATGATGACGGG + Intronic
1024038454 7:45529734-45529756 ACACACAAAAAAATTAAGCCAGG + Intergenic
1026268280 7:68814247-68814269 ACACACACACAAATTATGGCAGG + Intergenic
1031502305 7:122533753-122533775 ATGTAATCAAAAATTATGGCTGG + Intronic
1031932845 7:127703708-127703730 TCTCAAAAAAAAATTATGGCAGG + Intronic
1032082124 7:128864775-128864797 ACACACAAAAAAAAAATGGCTGG - Intronic
1032615951 7:133471113-133471135 AGATACTAAAAAATTCTGGCCGG + Intronic
1033184633 7:139216205-139216227 ACGCAATAAAAAATGATAGAGGG - Intergenic
1034009908 7:147518732-147518754 ACCTTATAAAAAATTATGGCTGG + Intronic
1035418096 7:158705965-158705987 AAGCAATATAAAATTATAGCAGG + Intergenic
1036490281 8:9218815-9218837 AGGCAGGAAAAAATTTTGGCAGG - Intergenic
1038244180 8:25839091-25839113 ACACAATACATAATTATGGCTGG - Intergenic
1041197535 8:55416067-55416089 ACAAACTTAAAAATTATGGCGGG - Intronic
1041275079 8:56148991-56149013 ACGCAATAAAAAATGATGAAGGG - Intergenic
1043586084 8:81771369-81771391 ACGCAATAAAAAATGATGAAGGG + Intergenic
1043760903 8:84066726-84066748 TCTCACTAAAAAATGAAGGCAGG + Intergenic
1045076284 8:98572950-98572972 GAGCACTTAAAAATTATGTCAGG - Intronic
1048606949 8:135978838-135978860 ACGCAGTAAAAAATGATGAAGGG - Intergenic
1049505657 8:142995385-142995407 AGGCACCAATAAATCATGGCTGG - Intergenic
1050775849 9:9259340-9259362 ACAGACTATAAAACTATGGCTGG + Intronic
1051287612 9:15512544-15512566 ACACACAAAAAAATGATTGCTGG - Intergenic
1052145415 9:25042819-25042841 ACGCAATAAAAAATGATGAAGGG - Intergenic
1053260504 9:36659310-36659332 AAGAAATAAAAAAGTATGGCCGG - Intronic
1055185898 9:73453518-73453540 ACTAAAGAAAAAATTATGGCTGG - Intergenic
1058962253 9:110002880-110002902 ACGCAATAAAAAATTATAAAGGG - Intronic
1059488773 9:114649003-114649025 AAAAACTAAAAAATTATGGCTGG - Intergenic
1059611430 9:115901571-115901593 ACTCATTATAAAATGATGGCTGG + Intergenic
1185939004 X:4292758-4292780 ACAAACTAGAAAATTTTGGCAGG - Intergenic
1186539978 X:10390578-10390600 AGACACTAAAAAATAAAGGCGGG + Intergenic
1187509037 X:19901017-19901039 AAACACTTAAAAATTATCGCAGG + Intergenic
1191165171 X:57382468-57382490 ACGCAATAAAAAATTATGAAGGG + Intronic
1192710429 X:73577666-73577688 ACGGACAAATAAATAATGGCTGG - Intronic
1194052810 X:89092964-89092986 ACCCACTGAAATACTATGGCAGG - Intergenic
1194174545 X:90629830-90629852 ACGCAATGAAACATCATGGCTGG + Intergenic
1195420960 X:104674947-104674969 ACGCAATAAAAAATTATAAAGGG - Intronic
1197508767 X:127344360-127344382 AGGCAATAAAAAATGCTGGCAGG + Intergenic
1197676935 X:129340200-129340222 ACGCAATAAAAAATGATAGAGGG + Intergenic
1198980362 X:142388444-142388466 ACGCAATAAAAAATGATGAAGGG - Intergenic
1200520759 Y:4207524-4207546 ACGCAATGAAACATCATGGCTGG + Intergenic
1201186211 Y:11405548-11405570 ACGCAATAAAAAATGATAGAGGG - Intergenic
1201591482 Y:15619778-15619800 ACACACTAAAAAATGATGAAGGG + Intergenic
1201759373 Y:17520445-17520467 AAGCACTAAAAAATCATAGTTGG + Intergenic
1201842181 Y:18385545-18385567 AAGCACTAAAAAATCATAGTTGG - Intergenic