ID: 1155951932

View in Genome Browser
Species Human (GRCh38)
Location 18:31922964-31922986
Sequence GGAGTTCAGTGGCTCTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102941
Summary {0: 1, 1: 9, 2: 257, 3: 7507, 4: 95167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155951932 Original CRISPR GGAGTTCAGTGGCTCTCTCT TGG (reversed) Intronic
Too many off-targets to display for this crispr