ID: 1155958109

View in Genome Browser
Species Human (GRCh38)
Location 18:31970964-31970986
Sequence TCTGACTTTCAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155958109_1155958112 -9 Left 1155958109 18:31970964-31970986 CCATCCTCCTTCTGAAAGTCAGA No data
Right 1155958112 18:31970978-31971000 AAAGTCAGAGAGCACTTCCCAGG No data
1155958109_1155958115 17 Left 1155958109 18:31970964-31970986 CCATCCTCCTTCTGAAAGTCAGA No data
Right 1155958115 18:31971004-31971026 ATTCTCTGAAAACTGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155958109 Original CRISPR TCTGACTTTCAGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr