ID: 1155960511

View in Genome Browser
Species Human (GRCh38)
Location 18:31991023-31991045
Sequence CTGTGACATGCACAGGGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155960511_1155960515 9 Left 1155960511 18:31991023-31991045 CCTCAACCCTGTGCATGTCACAG No data
Right 1155960515 18:31991055-31991077 TATTCCTGTCCAACAGGATGTGG No data
1155960511_1155960518 21 Left 1155960511 18:31991023-31991045 CCTCAACCCTGTGCATGTCACAG No data
Right 1155960518 18:31991067-31991089 ACAGGATGTGGTATGTGTTCTGG No data
1155960511_1155960519 29 Left 1155960511 18:31991023-31991045 CCTCAACCCTGTGCATGTCACAG No data
Right 1155960519 18:31991075-31991097 TGGTATGTGTTCTGGAAGAGTGG No data
1155960511_1155960514 3 Left 1155960511 18:31991023-31991045 CCTCAACCCTGTGCATGTCACAG No data
Right 1155960514 18:31991049-31991071 TCTTGCTATTCCTGTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155960511 Original CRISPR CTGTGACATGCACAGGGTTG AGG (reversed) Intergenic
No off target data available for this crispr