ID: 1155960563

View in Genome Browser
Species Human (GRCh38)
Location 18:31991424-31991446
Sequence CTGTTAAAAAGTTGGAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155960563_1155960566 1 Left 1155960563 18:31991424-31991446 CCTATTTTCCAACTTTTTAACAG No data
Right 1155960566 18:31991448-31991470 AATCTTGTTCTTTGAGTACTGGG No data
1155960563_1155960567 2 Left 1155960563 18:31991424-31991446 CCTATTTTCCAACTTTTTAACAG No data
Right 1155960567 18:31991449-31991471 ATCTTGTTCTTTGAGTACTGGGG No data
1155960563_1155960569 12 Left 1155960563 18:31991424-31991446 CCTATTTTCCAACTTTTTAACAG No data
Right 1155960569 18:31991459-31991481 TTGAGTACTGGGGTGTTGGAAGG No data
1155960563_1155960568 8 Left 1155960563 18:31991424-31991446 CCTATTTTCCAACTTTTTAACAG No data
Right 1155960568 18:31991455-31991477 TTCTTTGAGTACTGGGGTGTTGG No data
1155960563_1155960565 0 Left 1155960563 18:31991424-31991446 CCTATTTTCCAACTTTTTAACAG No data
Right 1155960565 18:31991447-31991469 TAATCTTGTTCTTTGAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155960563 Original CRISPR CTGTTAAAAAGTTGGAAAAT AGG (reversed) Intergenic
No off target data available for this crispr