ID: 1155965606

View in Genome Browser
Species Human (GRCh38)
Location 18:32032700-32032722
Sequence ACCAAGCCCGGCCCTCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155965606_1155965613 12 Left 1155965606 18:32032700-32032722 CCCAGTGGAGGGCCGGGCTTGGT 0: 1
1: 0
2: 2
3: 34
4: 195
Right 1155965613 18:32032735-32032757 TATAATCCCAACTACTTGGGAGG 0: 126
1: 6268
2: 67239
3: 170066
4: 312862
1155965606_1155965615 18 Left 1155965606 18:32032700-32032722 CCCAGTGGAGGGCCGGGCTTGGT 0: 1
1: 0
2: 2
3: 34
4: 195
Right 1155965615 18:32032741-32032763 CCCAACTACTTGGGAGGCTGAGG 0: 2471
1: 96204
2: 208066
3: 253517
4: 271335
1155965606_1155965611 8 Left 1155965606 18:32032700-32032722 CCCAGTGGAGGGCCGGGCTTGGT 0: 1
1: 0
2: 2
3: 34
4: 195
Right 1155965611 18:32032731-32032753 CCTGTATAATCCCAACTACTTGG 0: 1
1: 11
2: 99
3: 970
4: 12900
1155965606_1155965612 9 Left 1155965606 18:32032700-32032722 CCCAGTGGAGGGCCGGGCTTGGT 0: 1
1: 0
2: 2
3: 34
4: 195
Right 1155965612 18:32032732-32032754 CTGTATAATCCCAACTACTTGGG 0: 1
1: 5
2: 93
3: 1093
4: 14891
1155965606_1155965617 22 Left 1155965606 18:32032700-32032722 CCCAGTGGAGGGCCGGGCTTGGT 0: 1
1: 0
2: 2
3: 34
4: 195
Right 1155965617 18:32032745-32032767 ACTACTTGGGAGGCTGAGGCAGG 0: 2103
1: 81035
2: 183698
3: 225936
4: 236452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155965606 Original CRISPR ACCAAGCCCGGCCCTCCACT GGG (reversed) Intronic
902334567 1:15747578-15747600 ACCAAGCCAGCCCCTGCCCTCGG + Exonic
903674334 1:25054784-25054806 GACAAGCCTGTCCCTCCACTGGG - Intergenic
905205933 1:36342865-36342887 GCCAAGCCCTGCCCTCCAGGGGG + Intronic
905443292 1:38008047-38008069 ACCAAGCCCGGCCAACCATTGGG - Intergenic
906101272 1:43264715-43264737 ACCGTGCCCGGCCCTTAACTTGG - Intronic
907308768 1:53527778-53527800 GCCAAGCCCAGCACCCCACTCGG - Intronic
912557540 1:110527142-110527164 ACCATGCCCTGTCCTCAACTAGG + Intergenic
913547933 1:119887816-119887838 ACCAACCCCCTCCCTCCCCTAGG - Intergenic
914847083 1:151289278-151289300 GCCCAGCCCGGCCCTCCCCCGGG - Intronic
915376943 1:155404740-155404762 ACCACGCCCAGCCCTCCAATTGG - Intronic
915814092 1:158948901-158948923 ACCAAGCCTGTCCCTGCACCTGG + Intronic
918861421 1:189831040-189831062 ACCACGCCCGGCCTGCCTCTAGG + Intergenic
920152431 1:203919822-203919844 CCCCAGCCCGGCCAGCCACTCGG - Intergenic
920546502 1:206822794-206822816 AACAAGCCAGGCCCTGCACTAGG - Intronic
922749997 1:228065803-228065825 ACCAAGCCCCGCCCTGGGCTCGG - Intergenic
923566187 1:235077606-235077628 ACCAAGCCAGGCACTCCCTTTGG + Intergenic
923602850 1:235418915-235418937 ACCACGCCCGGCCCTCCCCAGGG - Intronic
1064153699 10:12886429-12886451 TCCAAGCCCTGCCAGCCACTGGG + Intergenic
1065168442 10:23004925-23004947 ACCACGCCCGGCCCCCCTCTTGG - Intronic
1067096164 10:43302047-43302069 ACCAAGCCTGTCCCTGCACCCGG + Intergenic
1069443963 10:68455926-68455948 ACCATGCCTGGCCCTCTAATGGG - Intronic
1070815138 10:79318154-79318176 CCCAAGCCAGGGCCCCCACTGGG - Intergenic
1070982262 10:80659202-80659224 ACCAAGCAAGGCCCTCCTGTAGG - Intergenic
1072421450 10:95292986-95293008 ACCGTGCCCGGCCCTCCACTTGG - Intergenic
1072577861 10:96716970-96716992 ACCACGCTCGGCCCTCCATTGGG - Intronic
1073445388 10:103577258-103577280 ACCAAACCCTCCCCTCCATTAGG + Intronic
1076048036 10:127310418-127310440 ACAAAGCCCGGCCATGCCCTTGG - Intronic
1076737580 10:132465682-132465704 ACCGCACCCGGCCCTCCGCTCGG + Intergenic
1077402662 11:2366842-2366864 GCCAAGCCTGGGCCTCCAGTGGG - Intergenic
1080605880 11:33864577-33864599 ACCCTCCCCGGCACTCCACTGGG - Intronic
1081403228 11:42666683-42666705 ACCATGCCTGGCCTCCCACTGGG - Intergenic
1081526366 11:43930387-43930409 ACCAGGCCCGGTCCAACACTGGG - Intronic
1081688583 11:45059637-45059659 ACCAAGCCTGTCCCACCTCTGGG - Intergenic
1083169419 11:60914196-60914218 ACCAAACCCGCGCCTCAACTCGG - Exonic
1083179423 11:60974606-60974628 ACCAAGCCAGGCCCAGCACCCGG - Intronic
1083359431 11:62095759-62095781 ACCAGGCCCGGCCCTCTGGTTGG + Intergenic
1083408048 11:62472203-62472225 GCCCAGCCCCGGCCTCCACTTGG + Intronic
1083727977 11:64638172-64638194 CCCAAGCCCAGACCTCCCCTGGG + Intronic
1083993677 11:66261635-66261657 GCCAGGCCTGGCCCTTCACTGGG + Intronic
1084024371 11:66438648-66438670 GCCATGCCCGGGCCCCCACTAGG - Exonic
1084214756 11:67641192-67641214 TCCCAGCCTGGCCCTCCCCTGGG - Intergenic
1085532254 11:77198779-77198801 CCCAAGCCCATCCCTCCACTAGG - Intronic
1085927512 11:81039047-81039069 ACCAAGCCTGTCCTTGCACTCGG - Intergenic
1086853538 11:91839470-91839492 ACCATGCCCGGCCCTCCTCCAGG + Intergenic
1088801505 11:113311533-113311555 CCCCAGCCCAGCACTCCACTGGG - Intergenic
1089387355 11:118077142-118077164 ACCAAGGCCTGCCCTGCACTCGG + Exonic
1089591713 11:119546223-119546245 ACCAAGCCTGACACTCCAGTTGG + Intergenic
1090265489 11:125350759-125350781 ACCAAGCTCGCCCCTCCCCAGGG - Intronic
1092563358 12:9639147-9639169 ACCACGCCCGGCCTTCCCCAAGG + Intergenic
1094301591 12:28970356-28970378 ACCGCGCCCGGCCCTCCCTTAGG + Intergenic
1094354153 12:29559723-29559745 ACCAAGCAAAGCCCTCCACCTGG + Intronic
1096091363 12:48904033-48904055 ACCGACCGCGGTCCTCCACTGGG + Intronic
1100587444 12:95993245-95993267 ACCAACCCCATCCCTCCACCTGG + Intronic
1100635457 12:96431160-96431182 ACCACGCCTGGCCCTCCTTTTGG + Intergenic
1103276027 12:119712542-119712564 GCCAAGCCCGGCCCACCTCCAGG + Intronic
1103402640 12:120653820-120653842 ACCACGCCCGGCCCGCCTCTTGG + Intronic
1104452623 12:128883300-128883322 ACTACGCCCGGCCCTAAACTTGG - Intronic
1105535255 13:21259739-21259761 GACCAGTCCGGCCCTCCACTGGG - Intergenic
1105579459 13:21680931-21680953 ACTAAGCCCAGCTCCCCACTTGG - Intronic
1106056041 13:26238208-26238230 ACCATGCCCAGCCCTCATCTTGG + Intergenic
1107085992 13:36428758-36428780 ACCGTGCCCGGCCCTTTACTAGG - Intergenic
1108334134 13:49421613-49421635 ACCAAGGCCTCCCCTCCACATGG + Intronic
1113289196 13:108886274-108886296 ACCGCGCCCGGCCCTCCTTTGGG + Intronic
1113311812 13:109140187-109140209 ACCAAGCCCGGGGCTCGACTCGG - Intronic
1113517618 13:110915229-110915251 TCCAAGCCCCGCCCTCCGCCCGG - Intergenic
1113894496 13:113755086-113755108 GCCAAGCCCAGCCCTGCTCTGGG + Intergenic
1113916695 13:113878127-113878149 AACAGGCCTGGCCCTCCACACGG + Intergenic
1117867504 14:60165131-60165153 TCCGAGCCCGGCCTCCCACTCGG + Intronic
1118836942 14:69484545-69484567 ACGGAGCCCGGCCCTCCAGCCGG + Intergenic
1121127337 14:91416979-91417001 ACCAAGCCCGGCCTTCTCCTAGG + Intronic
1121432989 14:93900468-93900490 ACCAAACCCCACCCTCCACATGG + Intergenic
1121904593 14:97728143-97728165 TCCAAGGCCTGCCCACCACTAGG - Intergenic
1123927846 15:25135697-25135719 ACCAAGGCAGGCGTTCCACTGGG - Intergenic
1124961066 15:34395498-34395520 ACCATGCCCGGCCTTCCATAAGG - Intronic
1124977696 15:34541719-34541741 ACCATGCCCGGCCTTCCATAAGG - Intronic
1127341084 15:58044806-58044828 TCCAAAACCGGCCCTCCTCTGGG - Intronic
1128117915 15:65123473-65123495 ACCATGCCCGGCCCTTCAACAGG + Intronic
1129256553 15:74337197-74337219 ACCATTCCCGGGCCTCCTCTGGG - Intergenic
1129831486 15:78673884-78673906 ACCAAGCCAGGCCCATCTCTTGG + Intronic
1130607999 15:85334953-85334975 ACCACGCCCGGCCCCGCACCTGG - Intergenic
1131176726 15:90213941-90213963 ACCGAGCCCGGCCCTCAAGTAGG - Intronic
1132252168 15:100342036-100342058 CCCAAGCCCCGCCTTCCCCTCGG + Intergenic
1139298695 16:65925556-65925578 ACCACACCCGGCCCACCACCCGG - Intergenic
1139345846 16:66303189-66303211 ACCATGCCCGGCCCTGAAATAGG - Intergenic
1140332514 16:74071644-74071666 ACCAAGCCCAGCCACCCTCTTGG - Intergenic
1140415414 16:74770743-74770765 CACTAGCCCAGCCCTCCACTGGG - Intronic
1141531563 16:84649584-84649606 TCCCACCCCGGCCCTCCCCTAGG - Intronic
1143031256 17:3968544-3968566 ACCATGCCCGGCCTCCCACTTGG + Intergenic
1144478771 17:15611985-15612007 ACCAGCCCTGGCCCTCCCCTCGG + Intronic
1144638584 17:16925720-16925742 ACCAGGCCAGGCCCTCTGCTCGG + Intergenic
1144641509 17:16939825-16939847 GCCAGGCCTGGCCCTGCACTAGG + Intronic
1144919531 17:18751748-18751770 ACCAGCCCTGGCCCTCCCCTCGG - Intronic
1148054582 17:44786622-44786644 ACCAAGCCTGGGCCACCACTGGG + Intergenic
1151740756 17:75980045-75980067 ACCGCGCCCGGCCCTACACTAGG - Intronic
1152198749 17:78933165-78933187 ACCACGCCCGGCCTTCCCTTTGG + Intergenic
1155750852 18:29421190-29421212 ACCAAGCCTGTCCCTGCACTTGG + Intergenic
1155965606 18:32032700-32032722 ACCAAGCCCGGCCCTCCACTGGG - Intronic
1156583387 18:38405491-38405513 CCCACCCCCAGCCCTCCACTGGG + Intergenic
1157542927 18:48524939-48524961 ACCAAGCAGGTCCTTCCACTTGG - Intergenic
1157602354 18:48902005-48902027 ACCAAGCCCGACCCTCAACCAGG + Intergenic
1160697431 19:491793-491815 CCCAAGCCCCCCCCTCCCCTGGG + Intronic
1160697514 19:491992-492014 CCCAAGCCCCCCCCTCCCCTGGG + Intronic
1160741610 19:688886-688908 ACCACGCCCGGCCCCACACAGGG + Intronic
1160957170 19:1699134-1699156 GCCCCGCCCGGCCCTCCACTCGG - Intergenic
1161178826 19:2865887-2865909 ACCAAGACCCGCCCTTCCCTTGG - Intergenic
1163250343 19:16122993-16123015 ACCAAGCCCTCCCCTGCACCAGG + Intronic
1165745341 19:38227365-38227387 ACCATGCCCGGCCCACCAGCAGG + Intronic
1165945932 19:39442240-39442262 ACCGTGCCCAGCCCACCACTTGG + Intronic
1166565351 19:43761959-43761981 ACCAAGCCCGGCCATAAAGTTGG - Intergenic
1166705173 19:44904385-44904407 AACAGGCCCGGCCCGGCACTGGG + Intergenic
1166925405 19:46263652-46263674 ACCATGCCCGGCCCTGCTCCTGG + Intergenic
1166948896 19:46413455-46413477 CCCCAGCCCGGGCCTCCAGTAGG + Exonic
1167393872 19:49214461-49214483 ACCACGCCCGGCCCTCTTCCAGG + Intergenic
1168411537 19:56143235-56143257 ACCAAGTCCAGCTCTTCACTGGG - Intronic
926138987 2:10357258-10357280 ACCAAGCCAGGCCAGCCACATGG + Intronic
927510681 2:23642256-23642278 ACCATCCCCGGCCCTGCACTGGG - Intronic
933824799 2:86149586-86149608 ACCATGCCCGGCCTTCCCCAAGG - Intronic
934036964 2:88096323-88096345 ACCAAGCCCAGCTCTCTACTAGG + Intronic
934664376 2:96159343-96159365 ACCCAGCCCGGCCCACACCTTGG - Intergenic
934774043 2:96926012-96926034 ACCATGCCCCGCCAGCCACTTGG - Intronic
935671660 2:105561587-105561609 ACCACGCACCGCCCTCCACTGGG - Intergenic
937994029 2:127679694-127679716 ACCAAGCCCAGCCCCTCTCTTGG - Intronic
938729407 2:134134609-134134631 ACCACGCCCTGCCCACCCCTGGG - Intronic
941844350 2:170118427-170118449 ACCAAGCCTGTCCCTGCACTCGG - Intergenic
941915403 2:170809781-170809803 ACCACACCTGGCCATCCACTTGG - Intergenic
943797247 2:192012039-192012061 ACCTCGCCCGGCCCACCACCAGG + Intronic
946071321 2:217036521-217036543 ACAAAGGCAGGGCCTCCACTTGG + Intergenic
947555798 2:231092308-231092330 ACCAAACCTGTCCCTGCACTCGG + Intronic
948058799 2:235028845-235028867 ACCAAGCCCCTCCCACCACGGGG - Intronic
949015773 2:241709476-241709498 ACCAAAGCCAGCCTTCCACTTGG - Intronic
1172662420 20:36576269-36576291 AGCAAGGCCCACCCTCCACTTGG - Intronic
1173194003 20:40899025-40899047 ACCATGCCCGGCTCTCCGCTTGG - Intergenic
1173889916 20:46498883-46498905 ACCGCGCCCGGCCCTTCACATGG - Intergenic
1173982747 20:47237445-47237467 ACCACGCCCGACCCTCTTCTTGG + Intronic
1174192136 20:48748102-48748124 ACGACGCCAGGCCCTGCACTGGG + Intronic
1174356706 20:50003172-50003194 ACCACACCCGGCCCTGCACCAGG + Intergenic
1175454072 20:59096577-59096599 ACCACGCCCGGCCTACTACTTGG + Intergenic
1180621865 22:17167704-17167726 ACCCAGCCTGACCCTCCACAGGG - Intergenic
1181475825 22:23167262-23167284 ACCAAGCTCAGCCCTCCTCAGGG + Intergenic
1182043962 22:27259908-27259930 ACCAAGCCCCTCCCTTCTCTGGG + Intergenic
1183302935 22:37067179-37067201 ACCGTGCCCGGCCCTCCACATGG - Intronic
1183428878 22:37753920-37753942 GCCAAGCCCAGCCCACCTCTGGG - Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184253508 22:43274404-43274426 ACCCTGCCCTGCCCTCCACAGGG + Intronic
1184494195 22:44827804-44827826 TCCAGGCCCGGCCCTCTCCTGGG - Intronic
1185376195 22:50483607-50483629 ACCCAGCCCTGCCCTGCCCTGGG - Exonic
949413228 3:3787977-3787999 ACCAGGCCCGGCCAACCACGTGG - Intronic
950078580 3:10205290-10205312 ACCCAGCCCTCCCCTCCTCTGGG - Intronic
950571225 3:13801263-13801285 AGCATGCCCTGCCCTCCACCTGG + Intergenic
952492283 3:33884145-33884167 ACCTGGCCAGGCCTTCCACTTGG + Intergenic
953033609 3:39193203-39193225 ACCAGGCCCAGCTCTTCACTGGG + Intergenic
954049618 3:47962989-47963011 GGCAAGCCTGGCCCTCCAGTGGG - Intronic
954398359 3:50305177-50305199 TCAAAGCACGGCCCCCCACTGGG - Intronic
954404637 3:50338567-50338589 ACCGCACCCGGCCCTTCACTGGG + Intronic
954685312 3:52366973-52366995 GCAGAGCCCGGCCTTCCACTGGG - Intronic
954798516 3:53173767-53173789 ACCATGCCTGGCCCTTCCCTGGG + Intronic
969660203 4:8522976-8522998 ACCCCACCCTGCCCTCCACTCGG - Intergenic
971271218 4:25148061-25148083 ACCGTGCCTGGCCCTCTACTAGG - Intronic
972131100 4:35834314-35834336 ACCATGCCCAGCCCTTCACTAGG + Intergenic
972404845 4:38735812-38735834 GCCCAGCTCAGCCCTCCACTAGG + Intergenic
975134055 4:70857119-70857141 ACCATGCCCAGCCCTCCATAGGG - Intergenic
975883842 4:78941307-78941329 ACCACGCCCGGCCCCTTACTAGG + Intergenic
981763929 4:148226273-148226295 GCCAATCCCCGCCCACCACTAGG + Intronic
982668983 4:158297663-158297685 ACCAAGCCTGTCCCTGCACTCGG - Intergenic
984893918 4:184518436-184518458 ACCACGCCCGGCCCTTCTTTTGG + Intergenic
984997754 4:185452603-185452625 ACCGAGCCCGGCCTTGAACTTGG - Intronic
986213345 5:5694938-5694960 ACCATGCCCCCACCTCCACTGGG + Intergenic
987689091 5:21244145-21244167 ACCAGGCCCCACCCTCCACCAGG - Intergenic
989177165 5:38539236-38539258 ACCGCGCCCGGCCTTCCTCTTGG + Intronic
989374559 5:40747345-40747367 ACCACGCCCGGCCCAAAACTTGG + Intronic
993706541 5:91178034-91178056 ACCGAGCCCTGCCTTGCACTTGG - Intergenic
997413863 5:133710288-133710310 TACAAGCCCGGCCCTCCACCAGG + Intergenic
997704207 5:135931148-135931170 AGCAAGCCAGGCCCTCCGCGGGG - Intronic
998426973 5:142037019-142037041 GCCATGCCCGGGCCCCCACTAGG - Intergenic
999024217 5:148207539-148207561 ACCGTGCCCGGCCCTTCAGTAGG - Intronic
1004640863 6:17514072-17514094 ACCGCGCCTGGCCCTCCACATGG - Intronic
1005186428 6:23167338-23167360 ACCAAGCCTGTCCCTACACTTGG - Intergenic
1007342185 6:41198319-41198341 ACCAAACCTTGCCCTCCACGCGG + Exonic
1007402107 6:41608711-41608733 ACCAAGCCCAGGCCTCTGCTTGG - Intergenic
1009847423 6:69151152-69151174 TCCAAGCCCAGCACACCACTAGG + Intronic
1011693132 6:89887936-89887958 ACACAGCCAGGCTCTCCACTGGG - Intergenic
1012588538 6:100950997-100951019 ACCAAGCCTGTCCCTGAACTTGG - Intergenic
1017382094 6:153843048-153843070 ACCGCGCCCGGCCCACCAATTGG - Intergenic
1017869910 6:158478603-158478625 AACAAACACGGCCCTCCCCTGGG + Intronic
1019376385 7:694744-694766 ACCATGCCCGGCCCTTCACCTGG - Intronic
1020228115 7:6296211-6296233 ACCACGCCCGGCCTGCTACTTGG + Intergenic
1021395563 7:20143676-20143698 ACCACGCCCAGCCCTACATTTGG + Intronic
1025711723 7:63917205-63917227 ACCATGCCCGGCCCTCTTCCTGG + Intergenic
1028020434 7:85764728-85764750 ACCAAGCCTGTCCCTGCACCTGG - Intergenic
1029298282 7:99558766-99558788 GCCAGGCCCGCCCCTCCCCTCGG + Exonic
1029671760 7:102037639-102037661 ACCACGCCCGGCCCTGGGCTGGG + Intronic
1030289530 7:107858511-107858533 ACCAAGCTCAGCCCTGCTCTGGG + Intergenic
1032367166 7:131310012-131310034 ACCACGCCCGGCCCACAAGTGGG + Intronic
1032585741 7:133144799-133144821 ACCAAGCCCGGCCCACTTATTGG - Intergenic
1033301035 7:140185878-140185900 ACCACGCCCGGCCTCCCACCAGG - Intergenic
1034968650 7:155406186-155406208 ACCATGCCCGCCCCTCCGCTCGG + Intergenic
1037500754 8:19483443-19483465 ACCAAGCTCTGCCCTGCCCTAGG + Intronic
1039487188 8:37919302-37919324 ACCAAGCCCGGCCTTAAAGTAGG + Intergenic
1040531612 8:48270870-48270892 GCCCAGCCTGGGCCTCCACTGGG - Intergenic
1040776063 8:51044574-51044596 CCCAAGCCCTGCCCTCCACTGGG - Intergenic
1041259130 8:56005071-56005093 ACCACGCCCGGCCAGCCACATGG + Intronic
1041319308 8:56596750-56596772 ACCATGCCCGGCCCACTATTTGG + Intergenic
1042155612 8:65841662-65841684 CCCAACCCCAGCCCTCCGCTCGG + Exonic
1047273793 8:123389348-123389370 ACCACGCCCGGCCGACCATTGGG - Intronic
1047457657 8:125030740-125030762 TCCAAGCACAGCCCTCCCCTTGG - Intronic
1047796113 8:128257596-128257618 ACCATGCCCGGCCTTCAACTGGG - Intergenic
1048340980 8:133538223-133538245 ACCATGCCCGGCCATTCAGTAGG - Intronic
1049756802 8:144314369-144314391 CCCAAGACCAGCCCTGCACTGGG - Exonic
1052195798 9:25713471-25713493 ACCGCGCCCGGCCCTCCATGGGG - Intergenic
1053019707 9:34686414-34686436 ACCATGCCCCGCCCCCCACCAGG - Intergenic
1056221156 9:84451769-84451791 ACCAAGCCTGTCCCTCTAGTGGG + Intergenic
1056769019 9:89463644-89463666 ACCATGCCCGGCCCACCATTTGG - Intronic
1057770627 9:97964592-97964614 ACCATGCCTGGCCCTCTTCTGGG - Intergenic
1059423946 9:114209316-114209338 ACCAAGCCCTGCCCACCCCCAGG - Intronic
1060027031 9:120182085-120182107 ACCAAGCACAGCCTTCCACAGGG - Intergenic
1061403899 9:130383243-130383265 ACACAGCACGGCCCTCCACAGGG + Intronic
1061563513 9:131421980-131422002 TCCAAGCCTGGCCCTGCACTCGG + Intronic
1062213252 9:135375931-135375953 ACCAAGCCCGCTCTCCCACTGGG + Intergenic
1062275794 9:135729983-135730005 CCCAAGCCTGTCCTTCCACTGGG + Intronic
1062394041 9:136345568-136345590 GCCAGGCCTGGCCCTCCACCAGG - Intronic
1203631837 Un_KI270750v1:78097-78119 ACCAAGCCCAAACCTCCAGTGGG + Intergenic
1186832071 X:13400700-13400722 ACCAAGCCTGGCCACCCACCTGG + Intergenic
1187067397 X:15854560-15854582 AGCCTGCCCGGCCCGCCACTGGG - Intronic
1194487015 X:94497078-94497100 ACCAAGCCTGTCCCTGCACCTGG - Intergenic
1196243096 X:113366417-113366439 ACTAAGCCCAGCCCAGCACTAGG + Intergenic
1197937454 X:131754041-131754063 ACCACGCCCGGCCGACCTCTGGG - Intergenic
1199700535 X:150372310-150372332 ACCCAGCCAAGCCCTCCACAGGG - Intronic
1200823953 Y:7620067-7620089 ACCAAGCCTGTCCCTGCACCCGG + Intergenic
1202081462 Y:21088449-21088471 ACCAAGCCTGTCCCTGTACTAGG + Intergenic
1202236102 Y:22711021-22711043 ACCAAGCCTGTCCCTGCACCCGG - Intergenic
1202307061 Y:23485147-23485169 ACCAAGCCTGTCCCTGCACCCGG + Intergenic
1202563744 Y:26185439-26185461 ACCAAGCCTGTCCCTGCACCCGG - Intergenic