ID: 1155974285

View in Genome Browser
Species Human (GRCh38)
Location 18:32111174-32111196
Sequence GTTAACACGCAGATAACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155974279_1155974285 8 Left 1155974279 18:32111143-32111165 CCCTACTTCCGGACCAAATAACC 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1155974285 18:32111174-32111196 GTTAACACGCAGATAACTTTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1155974281_1155974285 0 Left 1155974281 18:32111151-32111173 CCGGACCAAATAACCAAATATCT 0: 1
1: 0
2: 1
3: 24
4: 235
Right 1155974285 18:32111174-32111196 GTTAACACGCAGATAACTTTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1155974282_1155974285 -5 Left 1155974282 18:32111156-32111178 CCAAATAACCAAATATCTGTTAA 0: 1
1: 0
2: 2
3: 38
4: 415
Right 1155974285 18:32111174-32111196 GTTAACACGCAGATAACTTTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1155974280_1155974285 7 Left 1155974280 18:32111144-32111166 CCTACTTCCGGACCAAATAACCA 0: 1
1: 0
2: 1
3: 2
4: 48
Right 1155974285 18:32111174-32111196 GTTAACACGCAGATAACTTTGGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155974285 Original CRISPR GTTAACACGCAGATAACTTT GGG Intronic
902058214 1:13619687-13619709 GTTAACATGCAGCTATATTTTGG - Intergenic
907929213 1:58983637-58983659 CTTAACACACAGCTAACGTTTGG - Intergenic
913137292 1:115904792-115904814 GGTAACACCAAGAAAACTTTGGG - Intergenic
1068038937 10:51798556-51798578 CTGAACACTCAGATAGCTTTGGG - Intronic
1069285567 10:66710689-66710711 ATTATCACAGAGATAACTTTAGG - Intronic
1074726399 10:116314648-116314670 ATTAAGATGCAGATATCTTTGGG - Intergenic
1080709284 11:34731381-34731403 GTTAAAACGCACATACCTCTGGG - Intergenic
1080732109 11:34967321-34967343 GTTAACACACAAACAAATTTTGG - Intronic
1086025654 11:82287489-82287511 ATTAGGACGCAGATATCTTTGGG + Intergenic
1086539703 11:87893982-87894004 TTGAACCTGCAGATAACTTTGGG + Intergenic
1091308869 11:134559055-134559077 GTTAAAATGCAGATACCTCTGGG + Intergenic
1092632108 12:10392531-10392553 CTTAACACGCAGCCAACTTGTGG + Intronic
1095179355 12:39129393-39129415 GTTAACATTAAGAGAACTTTAGG + Intergenic
1097533794 12:60839525-60839547 GTTAAGACTAAGACAACTTTGGG - Intergenic
1098376493 12:69821062-69821084 GTTCACACACAGTTTACTTTTGG + Exonic
1102696966 12:114807588-114807610 GGTAACAGGCAAATAACTTCAGG + Intergenic
1107249565 13:38342344-38342366 GTTAATACTCTGATAGCTTTGGG + Intergenic
1109348819 13:61149404-61149426 GTCCACAGGCAGATAACATTAGG + Intergenic
1113986423 13:114319999-114320021 GTGAACAGGCAGATCACATTAGG + Intronic
1115615854 14:35093908-35093930 GTTAAGAATCTGATAACTTTGGG - Intronic
1116620891 14:47201758-47201780 ATAAAAACTCAGATAACTTTAGG - Intronic
1116845388 14:49860589-49860611 GTTAGCACATAGATATCTTTGGG + Intergenic
1125879292 15:43178888-43178910 GTTAACACCAAGTTAACTTAAGG + Intronic
1126162688 15:45628904-45628926 GCAAACACAAAGATAACTTTTGG + Intronic
1126522461 15:49611953-49611975 GTTACCACGGAGAAAACTTTGGG - Intronic
1130159473 15:81384479-81384501 GTTAAGACGTAGATAGATTTTGG - Intergenic
1133936557 16:10274216-10274238 TTTAATGTGCAGATAACTTTGGG + Intergenic
1137960644 16:52878630-52878652 GTCAGCAGGTAGATAACTTTGGG - Intergenic
1150837183 17:68574788-68574810 ATTAAGACGCAGATCTCTTTGGG - Intronic
1155561903 18:27087878-27087900 ATTAACACACAGATCACCTTGGG - Intronic
1155974285 18:32111174-32111196 GTTAACACGCAGATAACTTTGGG + Intronic
1156540337 18:37903415-37903437 TGTAACACGCAGACCACTTTGGG - Intergenic
1163608964 19:18291522-18291544 GATACCACTCAGACAACTTTGGG - Intergenic
930591515 2:53333251-53333273 GTTTTCACGAAGACAACTTTAGG + Intergenic
931230378 2:60369426-60369448 GATATCATGCAGATAACTTTTGG - Intergenic
941460708 2:165768687-165768709 GTGAACTTGAAGATAACTTTTGG - Intronic
945405563 2:209443674-209443696 GTTAACTCTCACAAAACTTTGGG - Intronic
947925942 2:233922625-233922647 GCAAACACTCACATAACTTTAGG - Intronic
1173224472 20:41154216-41154238 GTTAACAGGCTTATAAATTTGGG + Intronic
1178146418 21:29745454-29745476 GAGAAAAGGCAGATAACTTTGGG + Intronic
953688167 3:45094464-45094486 GTTATCAGGCAGATAACTTGAGG - Intronic
961548883 3:127655465-127655487 GTAAACACTCAGTTAACTGTGGG - Intronic
964277759 3:155025925-155025947 GATACCAGGCAGATAACTTGAGG - Intronic
972682837 4:41323695-41323717 GTTAACCCTCAGTTAAATTTTGG - Intergenic
979469896 4:121083099-121083121 GTTCAAACACAGAAAACTTTTGG - Intergenic
979571216 4:122227834-122227856 GATAATACGCACATACCTTTAGG + Intronic
980222296 4:129934550-129934572 GTTAAAACCACGATAACTTTTGG - Intergenic
983295943 4:165869468-165869490 CATAAAACGCAGATAATTTTAGG - Intergenic
985047551 4:185955610-185955632 CCTAACACGCTGATGACTTTCGG + Intronic
986932884 5:12849666-12849688 GTTAAAAAGCATATAATTTTAGG - Intergenic
989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG + Intronic
991728757 5:69562345-69562367 GTTTACAGGCAGATCACTTGAGG + Intronic
991805187 5:70417494-70417516 GTTTACAGGCAGATCACTTGAGG + Intergenic
991866197 5:71065528-71065550 GTTTACAGGCAGATCACTTGAGG - Intronic
1004318850 6:14616428-14616450 GTTCACATGCAAATATCTTTGGG + Intergenic
1009809564 6:68643377-68643399 GTTTGCCCTCAGATAACTTTAGG + Intronic
1009949449 6:70379098-70379120 GTTAAATCTCAGATAACTTTTGG + Intergenic
1012331177 6:97989726-97989748 GTAGACACACAGATAATTTTAGG + Intergenic
1012340463 6:98116054-98116076 GTAAAAACGTAGATAAATTTTGG + Intergenic
1012560706 6:100577701-100577723 GTTCACACACAGATAAATTATGG - Intronic
1016500766 6:144718559-144718581 ATTAACACGCAGAGAATTTAAGG + Intronic
1017694637 6:157002309-157002331 GATAACATAAAGATAACTTTGGG - Intronic
1025956001 7:66183535-66183557 GGTAACAGGCAGATCACTTGAGG - Intergenic
1028221412 7:88201371-88201393 GATAAGAAGCAGAGAACTTTGGG + Intronic
1030273608 7:107695927-107695949 GTAAACACCCAGATAACCTAGGG - Exonic
1035734820 8:1880563-1880585 GTTAAAACGCTGAAAAATTTTGG - Intronic
1037730638 8:21520639-21520661 GATAACGGGCAGAAAACTTTAGG + Intergenic
1041960067 8:63604224-63604246 GTTATCAAGCAGATAAAATTTGG + Intergenic
1044738850 8:95305121-95305143 TTCAACACGCAGATAATTCTGGG - Intergenic
1050833683 9:10048848-10048870 GTTAAAATTCAGATATCTTTGGG - Intronic
1054830892 9:69623385-69623407 GTTAAAAAGCAGAAAACTTATGG + Intronic
1057258787 9:93572435-93572457 GTTAGCATGCAAATAACTGTTGG - Intergenic
1057551401 9:96053434-96053456 GTAAACAGGCATATGACTTTTGG + Intergenic
1186730799 X:12407230-12407252 GTTAAAATGCAGACATCTTTGGG + Intronic
1200973273 Y:9179187-9179209 TTAAACAAACAGATAACTTTTGG - Intergenic
1201503258 Y:14669202-14669224 TATAACAGGCAGATAACTATAGG + Intronic
1201991024 Y:20026378-20026400 TTAAACTCACAGATAACTTTTGG + Intergenic
1202137804 Y:21685325-21685347 TTAAACAAACAGATAACTTTTGG + Intergenic