ID: 1155976094

View in Genome Browser
Species Human (GRCh38)
Location 18:32133424-32133446
Sequence TACCTACATTTGGCATCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155976094_1155976097 -6 Left 1155976094 18:32133424-32133446 CCTGGGGATGCCAAATGTAGGTA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1155976097 18:32133441-32133463 TAGGTAAAAACAAAACAGGCTGG 0: 1
1: 0
2: 8
3: 68
4: 589
1155976094_1155976096 -10 Left 1155976094 18:32133424-32133446 CCTGGGGATGCCAAATGTAGGTA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1155976096 18:32133437-32133459 AATGTAGGTAAAAACAAAACAGG 0: 1
1: 0
2: 2
3: 43
4: 511
1155976094_1155976098 14 Left 1155976094 18:32133424-32133446 CCTGGGGATGCCAAATGTAGGTA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1155976098 18:32133461-32133483 TGGTCTTCCCCTCATAACTGAGG 0: 1
1: 0
2: 2
3: 5
4: 135
1155976094_1155976099 18 Left 1155976094 18:32133424-32133446 CCTGGGGATGCCAAATGTAGGTA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1155976099 18:32133465-32133487 CTTCCCCTCATAACTGAGGAAGG 0: 1
1: 0
2: 2
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155976094 Original CRISPR TACCTACATTTGGCATCCCC AGG (reversed) Intronic
900285111 1:1895326-1895348 CACCTACATTCTGCACCCCCTGG - Intergenic
901066229 1:6496016-6496038 TTCCTCCTTTTGTCATCCCCAGG + Intronic
908547366 1:65175086-65175108 GACCTTCATTTGACAACCCCTGG + Intronic
917735842 1:177919604-177919626 TACCTGCATTTGGAAACCACCGG + Intergenic
1063536314 10:6887122-6887144 TCCCTACTTTTGGCTTCCCTGGG - Intergenic
1066634042 10:37483549-37483571 TCCCTAAATTTGGCAGACCCTGG + Intergenic
1068881765 10:62056920-62056942 TACAGAAATTTGACATCCCCTGG + Intronic
1070653209 10:78252930-78252952 TCCCTGCATTTGGCATCCGTTGG + Intergenic
1074626700 10:115197680-115197702 TTCCTACATATGGATTCCCCAGG - Intronic
1081718166 11:45266205-45266227 GACCTACATTTAGGATCCACTGG + Intronic
1084894317 11:72254406-72254428 TGTCTACACTTGGCAACCCCAGG + Intergenic
1090612520 11:128484193-128484215 TACCTTCTTTTGGAAACCCCTGG + Intronic
1093074579 12:14744550-14744572 TATCTTCATTTAGCATCCTCAGG - Intergenic
1097260642 12:57718142-57718164 GGCCTATATTTGGCTTCCCCTGG - Exonic
1099156763 12:79186905-79186927 TATTTACATTTGTCATCTCCAGG - Intronic
1100133479 12:91524696-91524718 TACTTACATGTGGCATCCACAGG - Intergenic
1101935265 12:109052048-109052070 TACCCACATTTTACATCCCAGGG - Intronic
1103223391 12:119265807-119265829 TCCCCACTTTTGGCATCCCCAGG - Intergenic
1110714432 13:78684897-78684919 CTCCTACATTTGGTATCTCCAGG + Intergenic
1125284439 15:38076920-38076942 AGGCCACATTTGGCATCCCCAGG + Intergenic
1126205834 15:46043636-46043658 TGCCTTCATTTGGTATCCACGGG - Intergenic
1130108472 15:80946407-80946429 CAGCTCCATTTGGCATCCCCTGG - Intronic
1137906341 16:52325783-52325805 TACATATATTTGGCAGCCTCAGG + Intergenic
1138632982 16:58313856-58313878 TACCTCCACTTTGCATCCCCAGG - Intronic
1140878478 16:79175570-79175592 TACCTACATTTTCCACTCCCTGG - Intronic
1141017627 16:80465476-80465498 TACCCCCATTTGGCATCAGCTGG - Intergenic
1148861784 17:50608275-50608297 AACCTCCATTTGGCATCATCTGG - Intronic
1151241071 17:72758346-72758368 TAGCTACATGTGGCATGCTCTGG + Intronic
1152658467 17:81530768-81530790 CACCTGCAGTTGGCATCCTCGGG + Intronic
1154030596 18:10750298-10750320 TAGGTACAATTGGCATCTCCTGG - Intronic
1155976094 18:32133424-32133446 TACCTACATTTGGCATCCCCAGG - Intronic
1156203640 18:34861685-34861707 TACCTACATTTGGAAAACGCTGG + Intronic
1156742529 18:40349652-40349674 TAGATTCATTTGGCATGCCCTGG + Intergenic
1163236782 19:16034493-16034515 TCCCAGCATTGGGCATCCCCTGG - Intergenic
1165302429 19:34979096-34979118 TACCACCATTTGGAATCTCCTGG - Intergenic
933857055 2:86425383-86425405 TTTCTTCATTTAGCATCCCCTGG - Intergenic
935719532 2:105967897-105967919 TACAGGCAGTTGGCATCCCCAGG + Intergenic
937725904 2:125166240-125166262 TACCTTCATTTGGCTCCTCCTGG - Intergenic
942352890 2:175071966-175071988 CACCTGCCTTTGGCATCCCTTGG - Intergenic
945643895 2:212465740-212465762 TACCTAAAGTAGTCATCCCCTGG + Intronic
946097274 2:217286151-217286173 GACCTAAATTTGGCATCCTATGG - Intronic
1169411042 20:5370642-5370664 TGGCTACATTTGCCATCTCCAGG + Intergenic
1179104738 21:38388819-38388841 TATCTACAAAGGGCATCCCCGGG + Intronic
952309875 3:32178755-32178777 TCTCCACATTTGGCATCACCTGG + Intergenic
954855829 3:53642716-53642738 CACCTCCATTTGTCATCCCTGGG + Intronic
957714544 3:83908244-83908266 TTCCTACATTTAGGATCCCAAGG - Intergenic
962908065 3:139823324-139823346 CACCTACAGATGGCACCCCCAGG + Intergenic
963986977 3:151607510-151607532 TACCTAAAATTGTAATCCCCTGG - Intergenic
966974879 3:185074712-185074734 TATCTTCATTTGGTTTCCCCGGG + Intergenic
974117255 4:57594608-57594630 GTCCTACATTTGGCATCTACAGG - Intergenic
981756925 4:148150026-148150048 TACCTAGAATTGGAATCCCTAGG - Intronic
986314035 5:6574266-6574288 TTGCTAAATTTGGCAACCCCTGG + Intergenic
988451466 5:31347824-31347846 AATCTACATTTGGCATCTTCTGG + Intergenic
990185811 5:53207746-53207768 CTCCCTCATTTGGCATCCCCTGG - Intergenic
992181150 5:74199732-74199754 TTCCTCCCTTTGGCATCCTCTGG - Intergenic
993425390 5:87757397-87757419 TACCTACAAGTGGAATCACCGGG + Intergenic
997571259 5:134929468-134929490 TTCCTCCAATGGGCATCCCCTGG - Intronic
999041066 5:148413187-148413209 TTCCTATATTTGGTATCTCCTGG - Intronic
1000535250 5:162470910-162470932 TACCTGCAGTTGTCATCACCTGG + Intergenic
1004478016 6:15992140-15992162 TACCTATTTTTAGCATCCACTGG - Intergenic
1006379953 6:33691622-33691644 CAGCTCCATGTGGCATCCCCAGG - Exonic
1010113933 6:72277644-72277666 TACATAAATTTGGAATCCCAGGG + Intronic
1010614695 6:77997990-77998012 TGCCTACATTTCACATCTCCCGG + Intergenic
1011415974 6:87120492-87120514 TTACTACATTTGGCTTCCCAAGG + Intergenic
1014249011 6:119096991-119097013 TAACTACATTTCTCATCACCAGG - Intronic
1014941686 6:127447697-127447719 TAGTTACATTTGGCATTTCCTGG + Exonic
1019409537 7:900549-900571 TACCTGCAGGTGGCATTCCCAGG - Exonic
1021514399 7:21467253-21467275 TACCTTCATTTGGGAACCACTGG + Intronic
1026045978 7:66905509-66905531 TTCCTCAATTTGGCATCTCCAGG + Intergenic
1031679090 7:124649104-124649126 TACGTACATTTGGTATTCACTGG - Intergenic
1032507088 7:132443755-132443777 GACCAACATGTGGCATCTCCAGG + Intronic
1033119664 7:138656405-138656427 TACCTGCCTTTGGCATCCTATGG - Intronic
1033836009 7:145312982-145313004 TACATACAGTTGGCTTCTCCTGG - Intergenic
1042426257 8:68651736-68651758 TCCCCACTTTTGGAATCCCCAGG - Intronic
1043479063 8:80634260-80634282 TGCCTCCTTTTGGCATGCCCAGG - Exonic
1048284806 8:133133505-133133527 TACCCACATTTGCAACCCCCTGG + Exonic
1048936637 8:139362956-139362978 AACCTTCATTTGGCATATCCAGG + Intergenic
1050598530 9:7227759-7227781 TCCCTACATTTCCCAGCCCCTGG + Intergenic
1057246232 9:93456756-93456778 TACCTACAATTCTCACCCCCAGG + Intronic
1062228554 9:135467726-135467748 TATCACCATTTGGCAACCCCTGG - Intergenic
1189168364 X:38884515-38884537 TACCTACATTTTGCATTCCTTGG + Intergenic
1189559588 X:42178376-42178398 CACCTACGTGTGGCATCTCCAGG - Intergenic
1195320703 X:103719418-103719440 TACGTACATCTGGCATTACCTGG - Intronic
1199942056 X:152637155-152637177 AACCTTCATTCTGCATCCCCTGG + Intergenic
1200088769 X:153624730-153624752 AACCTACATTTGGTGTCTCCTGG - Intergenic
1201399591 Y:13590899-13590921 TACCTATATTAGGGTTCCCCAGG + Intergenic
1201682443 Y:16662533-16662555 CACATACATCTGGGATCCCCAGG - Intergenic