ID: 1155976541

View in Genome Browser
Species Human (GRCh38)
Location 18:32138004-32138026
Sequence AAACTGGGTCTCTCATATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155976541 Original CRISPR AAACTGGGTCTCTCATATAC TGG Intronic
909863369 1:80635891-80635913 AAACAGGTGCTCTCAAATACAGG + Intergenic
910221134 1:84890422-84890444 GAGCATGGTCTCTCATATACAGG - Intronic
912028354 1:105206557-105206579 ACAGTGGCTTTCTCATATACTGG - Intergenic
916974183 1:170057225-170057247 AAAATGGGTCTTTCACATATTGG + Intronic
917946591 1:179978912-179978934 AAAGTGAGTCTCTTATAGACAGG + Intronic
919045052 1:192440912-192440934 AGACTGGCTCTCTCATCTTCAGG - Intergenic
919976904 1:202618790-202618812 AATCTTGGTCTCTCAGCTACTGG - Intronic
920684515 1:208099177-208099199 AAACTGGATCTCTCATGTTGGGG - Intronic
920831975 1:209473622-209473644 TCACTGGTTCTCTCATAAACAGG - Intergenic
922568012 1:226614026-226614048 TAACAGGTGCTCTCATATACAGG - Intergenic
1063875884 10:10477898-10477920 AAAATGGATCCCTCATATAATGG + Intergenic
1065294427 10:24260990-24261012 TAACTGGGTCTCTTGTAAACAGG - Intronic
1067213353 10:44280278-44280300 ATACAGGGACTCTCATATAATGG + Intergenic
1068711440 10:60139534-60139556 AAACTGGTTTTCTCACACACAGG + Intronic
1072581532 10:96744325-96744347 AAAATGGATCTCTCAGATGCTGG - Intergenic
1073187250 10:101623461-101623483 AAATTGGATCTCTCATACATTGG + Intronic
1073814630 10:107193106-107193128 AAACTAGGTCTCTCACTCACTGG + Intergenic
1075672973 10:124276641-124276663 AGACTGGGTCTGTCATGTCCCGG - Intergenic
1077208842 11:1358687-1358709 AAACTTGGTATCTGATTTACAGG - Intergenic
1078984532 11:16579904-16579926 TAACTGGAACTCTCATACACTGG - Intronic
1079987593 11:27215188-27215210 AAACTGGGTATTTCAACTACAGG + Intergenic
1080925820 11:36754882-36754904 ACCATGGGTCTCTCATAAACAGG - Intergenic
1082958071 11:58893068-58893090 AAGCTGGGTGTCTCTTATTCTGG + Intronic
1086368747 11:86135098-86135120 GAACAGAGTCTGTCATATACTGG + Intergenic
1090114085 11:123947703-123947725 AAACTCGGCCTCCCATATGCAGG - Intergenic
1093129586 12:15374197-15374219 AAACTGGGTCACTGAAATACTGG + Intronic
1096039717 12:48502889-48502911 TAACTGGATCTCTCATATATTGG - Intergenic
1100917480 12:99442088-99442110 ACACTGGTTCTCTCATATGAAGG - Intronic
1101781337 12:107840616-107840638 AAACTGGCTTTCTCAAATACTGG + Intergenic
1103236314 12:119375688-119375710 AAACTGTCTTTGTCATATACAGG - Intronic
1106165334 13:27240452-27240474 CAACTGGGCCTCTCACATAAAGG + Intergenic
1107844450 13:44496939-44496961 AAACTGGATCCCTCATACAATGG + Intronic
1108738817 13:53313697-53313719 AAACTGGGCCTTTCATAAATGGG + Intergenic
1113717528 13:112523326-112523348 AAACTGGGTAACTCAGATAGTGG - Intronic
1114841602 14:26269074-26269096 AAACTGGATCTGTCATATACTGG - Intergenic
1115848199 14:37561249-37561271 AAACTGAATCTCTCATCTTCAGG - Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1124492557 15:30167171-30167193 AATCTTGGTCTCTCAGCTACTGG - Intergenic
1124685259 15:31777063-31777085 AAACTGGGTCGCTCATAAACAGG + Intronic
1124750977 15:32371154-32371176 AATCTTGGTCTCTCAGCTACTGG + Intergenic
1126945345 15:53813112-53813134 AAACAGGGTCTCTGTTTTACAGG - Intergenic
1130909254 15:88259736-88259758 AAACTGGGTATCTCAGAGGCAGG + Intergenic
1135385087 16:22031973-22031995 AAACTGGAACCCTCCTATACTGG - Intronic
1136555965 16:31008106-31008128 AAACGGGGTCTCTGAGACACTGG - Intronic
1139051733 16:63131782-63131804 AAACTGGAAGTCTCATACACTGG + Intergenic
1140425039 16:74853862-74853884 AAACTGGTTCTATCATGCACTGG - Intergenic
1140685353 16:77428548-77428570 CAACTGGAACTCTCATACACTGG + Intronic
1141073510 16:80980255-80980277 AAACTGGCTTTTTCATATAAAGG + Intronic
1141073529 16:80980401-80980423 AAACTGGCTTTTTCATATAAAGG + Intronic
1141073548 16:80980547-80980569 AAACTGGCTTTTTCATATAAAGG + Intronic
1144914043 17:18707497-18707519 TAACTGGGTCCCTCATCTCCCGG - Intronic
1146066134 17:29637067-29637089 AAACAAGCCCTCTCATATACTGG + Intronic
1150855869 17:68752042-68752064 GAACTGGGACTCTAATATAGAGG + Intergenic
1155976541 18:32138004-32138026 AAACTGGGTCTCTCATATACTGG + Intronic
1156845977 18:41665608-41665630 AATCTGGGTCTCTCAGAGCCAGG - Intergenic
1162835233 19:13312553-13312575 CATCTGAGTCTCTCATATTCAGG + Intronic
1163644566 19:18481293-18481315 AAACTGGTTCTCTCACGGACTGG + Intronic
1166582237 19:43911784-43911806 GAACTGGGACTTTCATACACTGG + Intergenic
925677533 2:6380467-6380489 AAATTGTGTCTCTTATAAACAGG - Intergenic
926438914 2:12866959-12866981 AAACTGGGTGGCTTATAAACAGG + Intergenic
926522802 2:13937463-13937485 AAACTGAATCTCTCATTCACTGG - Intergenic
928323058 2:30298833-30298855 AAACTGGAACTCTCATACATTGG - Intronic
929220420 2:39459044-39459066 CAACTGGGACACTCACATACTGG + Intergenic
929467431 2:42157887-42157909 AAACAGGTACTCTCATATACAGG - Intergenic
929847881 2:45550996-45551018 AAAGTGGTTTTCTCACATACAGG - Intronic
932859759 2:75277975-75277997 TGACTGGCTCACTCATATACTGG + Intergenic
938042500 2:128087313-128087335 AAAATGGATCTCTCATACACTGG + Intergenic
938154831 2:128926102-128926124 AAACTGGGTCTAGGATACACAGG - Intergenic
940932913 2:159457318-159457340 AAATTGGTACTGTCATATACAGG + Intronic
942239565 2:173947523-173947545 GAAATGGGTTTCTCATGTACAGG + Intronic
1173909053 20:46650814-46650836 CACCTTGGTCTCCCATATACTGG - Intronic
1177259094 21:18705965-18705987 AAACTGGAACTCTTAGATACTGG + Intergenic
1177345794 21:19868022-19868044 AATCTGTGTCTCTCATAAAAGGG - Intergenic
1177594969 21:23226737-23226759 TACCTGGGTTTCTCAAATACTGG + Intergenic
949767556 3:7543842-7543864 AAACTGTGCCTCTCATTTAAAGG - Intronic
950039611 3:9911437-9911459 AAACAGGGTCTCTCACATCCTGG + Exonic
951924269 3:27889912-27889934 AAACTGGCTTTCTCAGTTACTGG - Intergenic
953112014 3:39951802-39951824 AAAATGCTTCTCTCATAGACAGG + Intronic
957601922 3:82347776-82347798 AAACAGGCCCTCTCATATGCTGG + Intergenic
960824838 3:121771670-121771692 AAACTGAGCCTCTCATCTATAGG - Intronic
963288257 3:143459525-143459547 ACACTGGGTATCACATATGCAGG - Intronic
964144065 3:153437188-153437210 ACACTGGGACTCTCATTTATGGG + Intergenic
965753486 3:172000814-172000836 ATTCTAGGTATCTCATATACAGG - Intergenic
967274657 3:187762146-187762168 AAACTAGGTCTCCCTTCTACTGG + Intergenic
968763435 4:2455073-2455095 AAACTGTGTCTCTCCTAAAAAGG - Intronic
979191177 4:117860481-117860503 AAACTGGGTCTCTCATATCAGGG + Intergenic
980750780 4:137084830-137084852 AAACTGGATCACTCGTACACGGG - Intergenic
980772431 4:137394061-137394083 AAACTGGATCTCTGATACAATGG - Intergenic
981383793 4:144103471-144103493 AACCTGGATCTCCCATATATTGG + Intergenic
982558959 4:156905288-156905310 AAACAGTGTCTGTCATATAAGGG - Intronic
983045553 4:162982647-162982669 AAATTGGGTCTCTTTTATAAGGG + Intergenic
983396036 4:167196806-167196828 ACACAGGCCCTCTCATATACTGG + Intronic
986155196 5:5167309-5167331 AAACTCAGTCTCTCTTATCCAGG - Intronic
988798479 5:34674366-34674388 AAACTTGGACTCTCACATTCTGG - Intronic
992054094 5:72970382-72970404 ATACTGGGTATCTTATAGACAGG + Intronic
994852454 5:105073225-105073247 AAACTAGAGCTCTCATACACAGG + Intergenic
1005792215 6:29315242-29315264 AAATTAAGTCTCTCATATATTGG - Intergenic
1006952470 6:37834917-37834939 TAACCGGAACTCTCATATACTGG - Intronic
1010835136 6:80577152-80577174 AAAGTGGATCTCTTATAAACAGG - Intergenic
1013771473 6:113632661-113632683 AAGCTGGGTATCTCTTACACAGG - Intergenic
1015074238 6:129135209-129135231 ATACTGGGTCTGTCATAGACAGG + Intronic
1017059341 6:150467628-150467650 AAACTGGGTGTGGGATATACAGG - Intergenic
1017216557 6:151914512-151914534 AATCTGCGTATATCATATACTGG + Intronic
1021094357 7:16518515-16518537 AAACAGGGTCTCTCACAGAAGGG + Intronic
1022001701 7:26232259-26232281 AAACTGGGTTAATTATATACTGG - Intergenic
1026441050 7:70444609-70444631 AAATTGGTTCTCTTTTATACAGG + Intronic
1032599041 7:133273405-133273427 AAACAGGATCTCTCATGTAAAGG + Intronic
1033612481 7:142978011-142978033 AAACTGGATCACTCATATATTGG + Intergenic
1037228209 8:16621337-16621359 TTACTGGTTCTCTCATATACTGG - Intergenic
1043127439 8:76417610-76417632 AAAGTATTTCTCTCATATACTGG + Intergenic
1043629339 8:82308994-82309016 AAATTCAGTATCTCATATACTGG - Intergenic
1046129963 8:109954696-109954718 AAACTGGTTCTCTCATTCCCAGG + Intergenic
1046965510 8:120160956-120160978 AAAGAGGGACTCTAATATACAGG + Intronic
1048744165 8:137594620-137594642 AAAGGGGGTCTATTATATACTGG + Intergenic
1048875513 8:138834149-138834171 AAACTGTCTCTCTCAGACACTGG + Intronic
1048954382 8:139523494-139523516 TAATTGGGTCTCTAATAGACTGG + Intergenic
1049025189 8:139983627-139983649 AAACTGGGCCTTTGATATCCAGG - Intronic
1052420001 9:28232049-28232071 AAACTATGTCTCTTATATATTGG + Intronic
1052805858 9:33012626-33012648 AAGCTGGGTCACTCATATACTGG - Intronic
1055254322 9:74349368-74349390 TAACTGGAACTCTCATATATTGG - Intergenic
1057626211 9:96679480-96679502 AAACCGGCACTCTCATACACTGG + Intergenic
1057634195 9:96747831-96747853 GAACTAGATCTCTTATATACTGG - Intergenic
1058683209 9:107457898-107457920 AGCCTGGCTCTCACATATACTGG - Intergenic
1058741850 9:107951599-107951621 AAACTGCATCTCTCACACACTGG - Intergenic
1060584952 9:124780065-124780087 TAACTAGGTCTCTCCTAAACTGG + Intronic
1186740314 X:12510392-12510414 AAACTGAGTGCCACATATACAGG + Intronic
1192699915 X:73457966-73457988 TCACTGGGTCTCTCATATCATGG + Intergenic
1199348171 X:146767047-146767069 AAACTGGTTCTCTCACATTGCGG - Intergenic
1199902052 X:152185230-152185252 AAAATGGATCTCTAATGTACAGG - Intronic
1201573131 Y:15434556-15434578 AAAATGGGCCTCTCCTATATGGG - Intergenic