ID: 1155978928

View in Genome Browser
Species Human (GRCh38)
Location 18:32160761-32160783
Sequence ACACCCTCCTGAACTGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155978928_1155978933 8 Left 1155978928 18:32160761-32160783 CCCAGAACAGTTCAGGAGGGTGT No data
Right 1155978933 18:32160792-32160814 GAGAAAAGACTGAGATGCAGAGG No data
1155978928_1155978935 10 Left 1155978928 18:32160761-32160783 CCCAGAACAGTTCAGGAGGGTGT No data
Right 1155978935 18:32160794-32160816 GAAAAGACTGAGATGCAGAGGGG No data
1155978928_1155978934 9 Left 1155978928 18:32160761-32160783 CCCAGAACAGTTCAGGAGGGTGT No data
Right 1155978934 18:32160793-32160815 AGAAAAGACTGAGATGCAGAGGG No data
1155978928_1155978936 23 Left 1155978928 18:32160761-32160783 CCCAGAACAGTTCAGGAGGGTGT No data
Right 1155978936 18:32160807-32160829 TGCAGAGGGGCCAGATCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155978928 Original CRISPR ACACCCTCCTGAACTGTTCT GGG (reversed) Intronic