ID: 1155983138

View in Genome Browser
Species Human (GRCh38)
Location 18:32201829-32201851
Sequence GGTCTAAGAAGATCAAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155983138_1155983143 28 Left 1155983138 18:32201829-32201851 CCTGTTCTTGATCTTCTTAGACC 0: 1
1: 1
2: 0
3: 13
4: 133
Right 1155983143 18:32201880-32201902 TTCCTTGAATGTCTATGCAATGG 0: 1
1: 0
2: 3
3: 16
4: 202
1155983138_1155983139 -9 Left 1155983138 18:32201829-32201851 CCTGTTCTTGATCTTCTTAGACC 0: 1
1: 1
2: 0
3: 13
4: 133
Right 1155983139 18:32201843-32201865 TCTTAGACCTGCCTCAACAGAGG 0: 1
1: 0
2: 0
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155983138 Original CRISPR GGTCTAAGAAGATCAAGAAC AGG (reversed) Intronic
902638973 1:17754372-17754394 GTTCACAGAAGTTCAAGAACAGG - Intergenic
905597565 1:39221187-39221209 GGTTCAAGAAGATAAAGAACTGG - Intronic
913273954 1:117120364-117120386 GATCGAAGGAGATCAAGAACAGG + Intronic
914693531 1:150053961-150053983 AGGCTAAGAAGCCCAAGAACAGG + Intergenic
915430370 1:155861321-155861343 GGAATAAGAAGAAAAAGAACAGG - Intronic
921699055 1:218246440-218246462 TCTCTAAGAAGATCAAGTAAAGG - Intergenic
1065178355 10:23100301-23100323 GCACTAAAAAGAGCAAGAACAGG - Intronic
1066630985 10:37459180-37459202 GGACTCAGAAGATCTAGACCAGG - Intergenic
1073155779 10:101345367-101345389 GAGCTAAGGAGATCAAGACCAGG - Intergenic
1074155953 10:110799686-110799708 CGTCTATGAAGTTCAAGAACAGG - Intronic
1075012355 10:118885534-118885556 TTTCTATGAAGTTCAAGAACAGG + Intergenic
1075021275 10:118954253-118954275 TTTCTGAGAAGAGCAAGAACCGG + Intergenic
1077682850 11:4261006-4261028 TATCTAAGAACATCAAGAATTGG - Intergenic
1077687192 11:4305747-4305769 TATCTAAGAACATCAAGAATTGG + Intergenic
1077692353 11:4356937-4356959 TATCTAAGAACATCAAGAATTGG + Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1085139205 11:74124991-74125013 TGTCTAAGAAGAAAAAGAAAAGG - Intronic
1085200478 11:74698938-74698960 CCTTTAAGAAGACCAAGAACTGG + Intronic
1085942140 11:81217560-81217582 GGTCAAAGAAGAACAAAAAAAGG + Intergenic
1087530754 11:99378628-99378650 AGTATAAGAAAATCAAGAAAGGG - Intronic
1087674192 11:101140094-101140116 GGAGTATGAAGGTCAAGAACTGG + Intergenic
1091937147 12:4443154-4443176 GGTCTATGAAATACAAGAACGGG - Intronic
1093289390 12:17302211-17302233 GATCGATGAGGATCAAGAACTGG + Intergenic
1094084359 12:26573544-26573566 GGTCTAAGATGATAAGGAGCAGG + Intronic
1096263738 12:50108186-50108208 GGTTTAGGAAGATGATGAACAGG - Intronic
1100271829 12:93033005-93033027 GTTCTAGGAAAATAAAGAACAGG + Intergenic
1104412592 12:128571868-128571890 TATCTAAGAAGATGAAGACCTGG - Intronic
1108679101 13:52764041-52764063 GGTCTACAAAGATCTAGAAAGGG - Intergenic
1110157553 13:72336236-72336258 GCTTTAAGAACATCAATAACTGG - Intergenic
1111926671 13:94470357-94470379 GGACTAATAAGATCAAGCTCTGG + Intronic
1118695610 14:68382045-68382067 GACCTAGGAAGAACAAGAACAGG + Intronic
1119502289 14:75140114-75140136 AGTCTAGGAAGTTCAAGATCAGG - Intronic
1119998325 14:79277502-79277524 GCTCTAAAAAGGTGAAGAACAGG - Intronic
1124059580 15:26277428-26277450 AGTCCAAGAAGCTCAAGAAGCGG - Intergenic
1125323433 15:38512528-38512550 GGTCTAAACAGATCTAAAACTGG + Intronic
1126321831 15:47432671-47432693 GGTCTGAGAAGAAACAGAACAGG + Intronic
1126527157 15:49668857-49668879 ATTCTAAGGAGGTCAAGAACAGG + Intergenic
1129092102 15:73162192-73162214 AGGCTTAGAAGATCAAGAAGAGG - Intronic
1129654396 15:77514331-77514353 TTTCTATGAAGGTCAAGAACAGG + Intergenic
1130915552 15:88301832-88301854 TGTCTTGGAAGATCAAGAAAGGG - Intergenic
1131638166 15:94259999-94260021 GGTTGAAGGAGATTAAGAACAGG - Intronic
1133785112 16:8967395-8967417 GGACTAAGGAGATGAAAAACCGG + Intergenic
1136558069 16:31020407-31020429 GAGCTCAGAAGTTCAAGAACAGG + Intergenic
1138561544 16:57803505-57803527 GGCCCAAGAAGATCAAGGAGAGG + Intronic
1138616489 16:58171528-58171550 GTTATTTGAAGATCAAGAACAGG + Intronic
1139009012 16:62609646-62609668 GGTCTAACAAAGTCAAGGACAGG + Intergenic
1139188362 16:64833753-64833775 TGTATATGAAGTTCAAGAACAGG + Intergenic
1140233444 16:73137460-73137482 CTTCTAAGGAGATTAAGAACGGG + Intronic
1140276478 16:73513354-73513376 GGCCTGAGAAGCTCCAGAACAGG + Intergenic
1140633679 16:76885382-76885404 GGGCTAAGAAAATTAAGACCAGG - Intergenic
1148112969 17:45157320-45157342 TGCCAAAAAAGATCAAGAACAGG + Intergenic
1149048106 17:52271073-52271095 TGTCTAGAAAGATCAAGAAGTGG - Intergenic
1151334724 17:73433228-73433250 GGTCTTGGAAGATGAAGAGCTGG + Intronic
1152790548 17:82276495-82276517 GGTCTCAAAAGTTCAAGATCGGG + Intergenic
1155983138 18:32201829-32201851 GGTCTAAGAAGATCAAGAACAGG - Intronic
1157313150 18:46567334-46567356 GGACTCAGAAGAGCAAGAGCAGG - Intronic
1157548103 18:48561770-48561792 GGTCTAGGAGGACCAAGACCTGG + Intronic
1157656731 18:49397451-49397473 AGTCTGAGAAGAACAAGAACTGG + Intronic
1158652026 18:59296832-59296854 GGTAGATGAAGATCAAGAAGAGG - Exonic
1166889927 19:45984883-45984905 AGTCTAAGAACATCAAGTTCTGG - Intergenic
1167225954 19:48240432-48240454 GGTCTAAAAAGGTCAGAAACAGG + Intronic
1168440755 19:56364827-56364849 ATTCTAAGAAGGCCAAGAACTGG + Intronic
926806331 2:16715372-16715394 GGTTTTAGAAGATCTTGAACTGG - Intergenic
931820626 2:65947950-65947972 ACTCTAAGAAGATGATGAACAGG - Intergenic
932587030 2:73036766-73036788 GGTCTCAGAAGAACACGAAAAGG + Intronic
933811864 2:86037610-86037632 GCTCCCAGAAGACCAAGAACTGG + Intronic
935460421 2:103325565-103325587 GGTGTAAGAAGACTAAGAAAAGG + Intergenic
936013498 2:108941072-108941094 TGTATATGAAGATCTAGAACAGG - Intronic
936385782 2:112027775-112027797 GGGCTAAGAAGATCAGGAGCAGG - Intronic
938170641 2:129072657-129072679 GGCCAAAGAAGATGGAGAACAGG + Intergenic
940629385 2:156218380-156218402 AGGCTAAGAAGTTCAATAACAGG - Intergenic
944329267 2:198445854-198445876 AGTCTGAGAAGTTCAAGATCAGG - Intronic
945204427 2:207316910-207316932 TGTCTACAAAGATCAATAACAGG + Intergenic
947751071 2:232532682-232532704 TTTGTAAGAAGTTCAAGAACAGG + Intronic
1169839087 20:9914779-9914801 TTTCTATGAAGTTCAAGAACAGG + Intergenic
1170384852 20:15805215-15805237 GATCTGAGAAGCTGAAGAACTGG + Intronic
1171887803 20:30672377-30672399 GATCTAGGAAGATCTAGAAGGGG - Intergenic
1179019937 21:37630279-37630301 GCTCAAAGGAGATCAAGATCAGG - Intronic
1181852555 22:25760627-25760649 TTTATAAGAAGTTCAAGAACAGG - Intronic
1182701584 22:32244111-32244133 AGGCTCAGAAAATCAAGAACAGG - Intronic
1182880592 22:33729695-33729717 GGACAATGAAGATCAACAACAGG + Intronic
1183618006 22:38956710-38956732 GGTCTAGTAAGAGCCAGAACAGG + Intronic
1184200902 22:42968708-42968730 GGCCTAAAAAGAACAAAAACAGG + Intronic
1185295098 22:50049284-50049306 AGTCAAAGAAAATCAAGAAATGG - Exonic
949764547 3:7511756-7511778 GGTGTAAGAACATGAAGAACAGG + Intronic
951161874 3:19432905-19432927 ATTCTAAGAAGAGAAAGAACAGG - Intronic
952585963 3:34892613-34892635 GGTAACAGAAGACCAAGAACAGG - Intergenic
954111009 3:48433035-48433057 GGGCTGAGAGGACCAAGAACTGG - Exonic
957816566 3:85307007-85307029 TTTATAAGAAGTTCAAGAACAGG - Intronic
958164010 3:89855670-89855692 GGTCTAACAAGATCATGTAATGG + Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
960543298 3:118884096-118884118 GGTGTAAGTAGAAAAAGAACTGG - Intergenic
960810892 3:121626586-121626608 AGTCTAAGAATATGAAGAACAGG + Intronic
961663198 3:128481232-128481254 AGTCCAAGAAGAGCAAGAAAGGG - Exonic
966966200 3:184996954-184996976 TGTCTAAGATGAGGAAGAACAGG + Intronic
968079640 3:195837016-195837038 GGTCAAAGGAGAACAAGAAGGGG - Intergenic
969902635 4:10363988-10364010 GTTCTTAGAAGCTCAAGAACAGG - Intergenic
970353126 4:15226085-15226107 AGTCAAAGCAGATCAAGAAATGG + Intergenic
971369552 4:26005547-26005569 GGTTAAAGAAGACTAAGAACTGG - Intergenic
973133847 4:46681432-46681454 GGCCTTAGAAAATCAAGAACTGG - Intergenic
973588472 4:52415864-52415886 GGTACAAGAAGATGAAGAATAGG + Intergenic
980570300 4:134607726-134607748 GGTCTAACAATATCAAGTGCTGG - Intergenic
984260340 4:177436968-177436990 AGCCTGAGAAGTTCAAGAACAGG - Intronic
987476801 5:18400396-18400418 GTGCAAAGAACATCAAGAACAGG - Intergenic
989775637 5:45203678-45203700 CTTCTAAGAAAATCAAGAACTGG + Intergenic
990852153 5:60218278-60218300 TTTCTATGAAGAACAAGAACAGG + Intronic
992558845 5:77930177-77930199 GGTCCAACAAGACCTAGAACAGG + Intergenic
994964663 5:106653511-106653533 ACTCTAAGAAAATCAAGAAAGGG + Intergenic
996020006 5:118580353-118580375 GATATAAGAAAATCAAGTACAGG - Intergenic
997063981 5:130541602-130541624 GGTCTAAGGAGAAGAATAACAGG + Intergenic
1002358219 5:178648294-178648316 GGTCACAGCAGAGCAAGAACAGG + Intergenic
1002669643 5:180856169-180856191 GGTTTAAGCAGAGCCAGAACAGG - Intronic
1006430095 6:33990216-33990238 GGCCTAAGAAGATTAAGATTTGG + Intergenic
1006812450 6:36828716-36828738 AGTCTAAAAAGCTCAAGAAAAGG + Intronic
1007060717 6:38938191-38938213 GGTCAAATAACTTCAAGAACTGG - Exonic
1008966332 6:57316822-57316844 GGTGGAAGAAGATGAAGCACTGG - Intronic
1011219191 6:85036191-85036213 GTTTTAAGAAGATCAAGGCCGGG + Intergenic
1012492001 6:99792397-99792419 AGAGTAAGAAGGTCAAGAACAGG + Intergenic
1012591253 6:100984291-100984313 TGCTCAAGAAGATCAAGAACAGG - Intergenic
1015028040 6:128560976-128560998 GGGGTAAGCAGAGCAAGAACAGG - Intergenic
1016841222 6:148527401-148527423 GGTCGCAGAAAATGAAGAACAGG - Intronic
1021971737 7:25971481-25971503 GGTCTCAGAACATCAGCAACAGG + Intergenic
1022469569 7:30674046-30674068 GGTCTCTGAAGGTCCAGAACAGG - Intronic
1022630323 7:32078555-32078577 GGTGTAAGAGGGTCAAGAAAGGG + Intronic
1023832230 7:44046093-44046115 GGTCTAAGAGAAACACGAACAGG - Intronic
1028412396 7:90544701-90544723 CATGTAAGAAGTTCAAGAACAGG + Intronic
1029110817 7:98212305-98212327 GGGCCATGAAGACCAAGAACCGG + Exonic
1030045270 7:105489655-105489677 GGTCAAGGAAGAAAAAGAACTGG + Intronic
1036516695 8:9450887-9450909 GGTCAAAGAAGATCAAGAACTGG + Intergenic
1036942136 8:13061866-13061888 GGACTAAGTAGATCCTGAACAGG + Intergenic
1037109507 8:15148900-15148922 GGCCAAAGAAAAGCAAGAACAGG + Intronic
1037130359 8:15401459-15401481 AGTCTAAGATGATCAAGAATAGG + Intergenic
1038133532 8:24759875-24759897 GTTCTAGGAAAAACAAGAACAGG + Intergenic
1038712894 8:29964661-29964683 GGTCTAAGAAGATAAAGCCTGGG + Intergenic
1045315289 8:101038717-101038739 GGTTGAAGAAGAATAAGAACTGG - Intergenic
1050756012 9:9004503-9004525 TGGCTAAGATGATCAAGATCCGG + Intronic
1051176126 9:14362357-14362379 GTTTTATGAACATCAAGAACTGG + Intronic
1051383926 9:16486433-16486455 GGTGTCAGAAGATTAAGTACAGG - Intronic
1051474984 9:17496322-17496344 GGTCTGAGAAGTCCAAGATCAGG + Intronic
1051570453 9:18551202-18551224 GGTCTTACAATATCAAGCACTGG - Intronic
1055678482 9:78690557-78690579 GGTCTTTGAAGATCAAGAAAGGG - Intergenic
1060486845 9:124053116-124053138 TGTCCACGAAGTTCAAGAACAGG - Intergenic
1186799375 X:13078167-13078189 GGTCTGAGAAGGGCAAGTACAGG + Intergenic
1189282446 X:39828330-39828352 GGTCCACGGACATCAAGAACAGG + Intergenic
1194748782 X:97660598-97660620 GGTGTAATAAGACCAAGTACGGG - Intergenic
1195778212 X:108431572-108431594 GGTTTAAGAAGATGCATAACGGG + Intronic
1198219430 X:134586168-134586190 GGTCCAAGAAGACCAACAACTGG + Intronic
1198772277 X:140143559-140143581 GGTATGCGAAGATCAAGAATTGG + Intergenic