ID: 1155986982

View in Genome Browser
Species Human (GRCh38)
Location 18:32240072-32240094
Sequence CTGCTGTTTTTAAGACCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155986982_1155986984 27 Left 1155986982 18:32240072-32240094 CCATTTGGTCTTAAAAACAGCAG 0: 1
1: 0
2: 0
3: 19
4: 233
Right 1155986984 18:32240122-32240144 TTACTTAATTTAGCATTAAAGGG 0: 1
1: 0
2: 0
3: 26
4: 333
1155986982_1155986983 26 Left 1155986982 18:32240072-32240094 CCATTTGGTCTTAAAAACAGCAG 0: 1
1: 0
2: 0
3: 19
4: 233
Right 1155986983 18:32240121-32240143 ATTACTTAATTTAGCATTAAAGG 0: 1
1: 0
2: 2
3: 27
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155986982 Original CRISPR CTGCTGTTTTTAAGACCAAA TGG (reversed) Intronic
901826466 1:11865104-11865126 CTGCTTTTTGTCTGACCAAAGGG - Intergenic
910627009 1:89317427-89317449 CTGCTGTTCTTCAGCCCCAATGG + Intergenic
912389982 1:109296348-109296370 CTACTGTTTACAAGACCAAGGGG - Exonic
912784142 1:112583303-112583325 CTGCTATTTTTATGGCCAGAGGG - Intronic
913200188 1:116489717-116489739 AAGCTGCATTTAAGACCAAAAGG - Intergenic
916701109 1:167295924-167295946 CTGCTGTTTTTAATTCAGAAAGG + Intronic
917489718 1:175487798-175487820 CTCTTGTTTTTAATACCAAATGG + Intronic
917831002 1:178886289-178886311 TTGCTGTTTTTAACTCCAGAAGG + Intronic
918485108 1:185020594-185020616 CTGCAGTTTTTTAGAGCATAAGG - Intergenic
918504663 1:185239037-185239059 CTACTATTTTTAAGATAAAAGGG - Intronic
919428382 1:197462533-197462555 GTAATGTTTTTAGGACCAAAGGG - Intronic
921447631 1:215265236-215265258 CTGCTCTCTTCAAGAACAAAGGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922198432 1:223380731-223380753 CTGCCCTTTATAAAACCAAAAGG + Intergenic
923773385 1:236957369-236957391 CTGCTGTTTTGAATATCAATTGG - Intergenic
1063261593 10:4395237-4395259 CTGGTATTTTAAAGACGAAAAGG + Intergenic
1065829392 10:29600577-29600599 CTGCTGTTTATAAAAGAAAATGG - Intronic
1067076778 10:43192035-43192057 CTGCTGTTTTCAAGTCCACAGGG - Intergenic
1068781302 10:60921759-60921781 CTGCTGCTTTCAAGGCCACAGGG - Intronic
1069345242 10:67461773-67461795 ATGATGTTTTTAAGACAGAATGG - Intronic
1069977705 10:72228117-72228139 ATGCTGTTTTTAATCTCAAAAGG + Intronic
1071885804 10:89949589-89949611 CATCTGTTTGTAACACCAAAGGG - Intergenic
1075474996 10:122726724-122726746 CTGCTCTTTTTAAGACACAATGG + Intergenic
1075625297 10:123959945-123959967 CTGCTGTATTCAAGGCCCAAAGG + Intergenic
1076033239 10:127176857-127176879 CTGCTGTTTTAAAGACTTACTGG + Exonic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1079494827 11:21030347-21030369 CTGCTGTCTGTACGACTAAAAGG - Intronic
1079647502 11:22883931-22883953 CTCCTATTTTTAAGTCCAATGGG - Intergenic
1080137188 11:28869269-28869291 CTGCTGTGTTTTTGCCCAAAGGG + Intergenic
1080289587 11:30655808-30655830 CTGCTGCTTCTTAAACCAAAAGG + Intergenic
1080341287 11:31268344-31268366 CTGATTTTTTTAAGACTCAAAGG - Intronic
1080375775 11:31708982-31709004 CAGATATTTTAAAGACCAAAAGG - Intronic
1081507865 11:43736899-43736921 CTGCTATTTTTAGCAACAAAAGG + Intronic
1081814761 11:45932366-45932388 CTCCTGTTGTGAAGCCCAAATGG - Intronic
1091089333 11:132755101-132755123 CTACTGTTTTTAGGTCAAAATGG + Intronic
1092792193 12:12079893-12079915 CTGCTTTTCTCAAGACTAAAAGG + Intronic
1097565503 12:61264287-61264309 CTCCTGTTTTTAAAACCAGCGGG - Intergenic
1098218994 12:68248605-68248627 CTTTTGTTTATAAGACCAGAAGG - Exonic
1099154734 12:79160186-79160208 GTAATGTCTTTAAGACCAAAAGG + Intronic
1099399866 12:82190339-82190361 ATGCTGTCCTTTAGACCAAATGG + Intergenic
1102730199 12:115102497-115102519 CTGCTTCTTTAAAGAGCAAAAGG + Intergenic
1105505309 13:21004818-21004840 TTGCTGTTTTTAAGGACAACAGG + Intronic
1106001781 13:25730368-25730390 CTTTTGTTTTGAAGAACAAAAGG + Intronic
1107643653 13:42471803-42471825 CTGATGTTTTCAATACCCAAAGG + Intergenic
1107996738 13:45868522-45868544 ATGCTGTTTTTATGACAACAAGG - Intergenic
1108875217 13:55039387-55039409 CAGCTGTTCTTTAGACTAAAAGG + Intergenic
1109472288 13:62824653-62824675 CTTCTGTTTTGAATGCCAAATGG - Intergenic
1109904232 13:68817105-68817127 CTGCTGATTTGAAGACAAAGGGG - Intergenic
1110589265 13:77236000-77236022 CTTCTCTGTTTAAAACCAAAAGG - Intronic
1112017998 13:95347338-95347360 CTGCTGGCTTACAGACCAAATGG + Intergenic
1112433434 13:99373262-99373284 CTGATTTTTTTAAAACCAAAGGG + Intronic
1112775435 13:102838873-102838895 CGGCTGTCTTTAAAACCCAAGGG + Intronic
1113110679 13:106819895-106819917 CTGGTGTTGTTAAGATGAAACGG + Intergenic
1113291553 13:108912017-108912039 CTGCTGGTTTTAAGACAGCAAGG + Intronic
1113377641 13:109780640-109780662 CTGGTCTATTTAAGAACAAAAGG + Intronic
1115049389 14:29038534-29038556 CTCCTGTTTTTAAGACATTATGG + Intergenic
1115744298 14:36420136-36420158 CTTCTGTTTATAAGAAAAAATGG - Intergenic
1117165095 14:53025202-53025224 CTCCTGTTTTCAAGACAAAGGGG - Intergenic
1117689395 14:58290713-58290735 CTGCTGATTTTATGGCCACATGG - Intronic
1118467201 14:66041806-66041828 CTGGTTTATTTAAGAACAAAGGG + Intergenic
1118873798 14:69766143-69766165 AAGCTGCTTTTAAGTCCAAATGG - Exonic
1119697334 14:76723722-76723744 CTCCTGTTTTTAGGAAGAAAAGG - Intergenic
1120632497 14:86907514-86907536 CTGATTTTTTTAAGTCCTAAAGG + Intronic
1125789332 15:42351460-42351482 CTTCTGTTTATAAAAACAAATGG - Intronic
1127745567 15:61967829-61967851 CTGTTGTTTTTAAGTTAAAAAGG - Intronic
1129542032 15:76358294-76358316 CCTCTGCTTTGAAGACCAAAAGG - Intronic
1130099920 15:80885487-80885509 CTGTTGTTTTATAAACCAAAAGG + Intronic
1130388691 15:83435695-83435717 CTGCTTTTCCTAAGACCACATGG + Intergenic
1131538417 15:93256069-93256091 CTGCTTTTTTTTTGAACAAAGGG + Intergenic
1131682220 15:94736069-94736091 GTGCTGTTGTTAATACTAAACGG + Intergenic
1137487495 16:48903698-48903720 CTGCTGTTTTTAAATTCAAATGG - Intergenic
1137811558 16:51357610-51357632 CTGCTGGTTTTAAGCCAAACGGG - Intergenic
1137985476 16:53103806-53103828 GTGCTGTTGTGATGACCAAAAGG - Intronic
1138313165 16:56045449-56045471 ATGCTGTTTTTCTGACAAAAGGG + Intergenic
1138859184 16:60734521-60734543 GTGCCATTTTTAAAACCAAAGGG + Intergenic
1139064387 16:63293881-63293903 CTGCGATTTTTAAGACCAGTAGG - Intergenic
1140248451 16:73272360-73272382 CAGCTGTTTTTCAGACTAACAGG - Intergenic
1140909188 16:79436550-79436572 CTGCTTATTTTTACACCAAAGGG + Intergenic
1143055392 17:4158380-4158402 CTCCTGATTTTTAGAGCAAATGG - Intronic
1144029299 17:11305154-11305176 CTGCTTTTTGTAAGAGGAAAAGG - Intronic
1144117017 17:12105699-12105721 GTGTTGTTTGTATGACCAAAAGG + Intronic
1144483710 17:15647921-15647943 CAGCTGCTCTTAAAACCAAAGGG + Intronic
1144914976 17:18717087-18717109 CAGCTGCTCTTAAAACCAAAGGG - Intronic
1145042375 17:19586470-19586492 ATGCTGTATTTTAGATCAAATGG - Intergenic
1148194459 17:45703222-45703244 CTGCAGTATTTAAAACCTAAAGG + Intergenic
1149181470 17:53942845-53942867 GTGCTGTTATTAAAACCACAAGG - Intergenic
1152890296 17:82877318-82877340 CTGCTATTTTTAACAACAAATGG - Intronic
1154404359 18:14075076-14075098 CTCCTGTTTTTAAAACCATCAGG + Intronic
1155373065 18:25124314-25124336 CAGCTGTTGTTAAAACTAAAAGG - Intronic
1155699660 18:28727857-28727879 CTGCTGGATTTAATAGCAAAGGG + Intergenic
1155890029 18:31256200-31256222 CTAATGTTTTTAAGAGCCAAGGG - Intergenic
1155986982 18:32240072-32240094 CTGCTGTTTTTAAGACCAAATGG - Intronic
1156318946 18:35999759-35999781 CTGCTGTTTTTATCAAGAAATGG - Intronic
1156363186 18:36402177-36402199 TTTCTGTTTTTAAAAACAAAAGG - Intronic
1156797262 18:41061573-41061595 CTTCTGTTTTTGACACCACAAGG + Intergenic
1156898558 18:42274173-42274195 CAGCCTTCTTTAAGACCAAAGGG + Intergenic
1157008883 18:43621984-43622006 CTGGTTTTATGAAGACCAAAGGG - Intergenic
1158989602 18:62855002-62855024 CTGCTGCTTTTTAAACTAAATGG + Intronic
1159568426 18:70083319-70083341 CTTATGATATTAAGACCAAAAGG + Intronic
1159743705 18:72206253-72206275 GTGCTGTTTTTAAGAGAAAGAGG - Intergenic
1160458697 18:79021069-79021091 CTGCTGTTTCTAAGCCCGGAAGG - Intergenic
926319421 2:11738527-11738549 CGGCTGTTTTTAAGACAGGAGGG - Intronic
927814532 2:26202951-26202973 CTGATGTTTCTAAGACGAAAAGG + Intronic
928894971 2:36250630-36250652 CTGGAGTTTTTAAGAACTAAAGG - Intergenic
930948783 2:57111182-57111204 CTGCTGTTCTTATAACAAAAGGG - Intergenic
931334585 2:61326657-61326679 TTGCTGTTTTACAGATCAAAAGG + Intronic
931996739 2:67845943-67845965 CTTGTGTTTTTAAGACAGAAGGG - Intergenic
933024338 2:77235798-77235820 CTGCTTTTTTGAAGATCAGATGG + Intronic
934095493 2:88598842-88598864 CTGATGTATTTAAGAGTAAAGGG + Intronic
935348756 2:102135142-102135164 CTGTTTTTTTTAAAATCAAAAGG + Intronic
937286598 2:120758060-120758082 CTGATGTGTTTAAGACCTGACGG + Intronic
937794591 2:126001889-126001911 CTGCTGGTGTGAAGGCCAAAGGG - Intergenic
939144339 2:138394597-138394619 CTGCTGTTATTAAAAACAAGAGG + Intergenic
939276282 2:140001534-140001556 CTCCTGTTATTAAGATCAATGGG + Intergenic
944960866 2:204871893-204871915 ATGCTGTCTTTAAGAATAAAGGG - Intronic
945136882 2:206639019-206639041 CTGCTATTTTTTAGATCCAATGG + Intergenic
945587502 2:211684859-211684881 CTGGGGTTTTTAAGAGCAAGGGG - Intronic
1170488714 20:16847735-16847757 ATGCTGTTTTTAAAAAAAAATGG - Intergenic
1173504843 20:43578634-43578656 CAGCTGTTTTGAAGATCAAATGG + Intronic
1176364997 21:6027410-6027432 CTGCTGTTTCTGAGTCCACAGGG - Intergenic
1178444964 21:32631359-32631381 CTGCTTTTGTTATGACCAAGAGG + Exonic
1178677519 21:34643795-34643817 GTGCTGTTTTTATTAGCAAAAGG - Intergenic
1179553701 21:42159557-42159579 CTGCTGTATTGAAGCCAAAACGG - Intergenic
1179758521 21:43511135-43511157 CTGCTGTTTCTGAGTCCACAGGG + Intergenic
1183145646 22:35989017-35989039 CTGCTCTTTTTAAGAAGAGATGG - Intronic
949984135 3:9525984-9526006 CTACTTTTTTTAAAACTAAAGGG - Intronic
951008521 3:17648188-17648210 CTGCTGTTTTGAAGATCAGATGG - Intronic
952005135 3:28835018-28835040 CAGCAGTTTTTAAAACAAAATGG - Intergenic
952085937 3:29821090-29821112 TTGCTGTTTTTCTGCCCAAATGG + Intronic
952192143 3:31035184-31035206 CTGTTATTTTTAAAACCCAAGGG + Intergenic
953066026 3:39471953-39471975 CTGGTGTCTTCAAGTCCAAAGGG + Intronic
954986336 3:54796924-54796946 CAGCTGTTTTCAAGAGCAACAGG + Intronic
956169396 3:66421008-66421030 CTCCTGTTTTTAAAACCATCAGG + Intronic
956244583 3:67167953-67167975 CTGCTTTTCTTAAGACTAACGGG + Intergenic
956659793 3:71585431-71585453 GTGCTGGTCTCAAGACCAAAGGG - Intergenic
957767514 3:84645524-84645546 TTGCAGTGTTTAAGAACAAAAGG - Intergenic
960450462 3:117800621-117800643 CTGGTGTTTTTAATCCCCAAAGG - Intergenic
961731124 3:128965618-128965640 CTTCTGTTTTTAAAGTCAAAAGG + Intronic
962694479 3:137934040-137934062 GTGCTGTTTTTGAGTCCACAGGG + Intergenic
964373135 3:156022487-156022509 CAGCTGTTTTTAAGATTAAATGG - Intergenic
967502686 3:190218133-190218155 CTGCTCTTTCCAAGAACAAAGGG + Intergenic
970313269 4:14804850-14804872 CAGCTGATTTTAATACCAGATGG - Intergenic
970329686 4:14966785-14966807 CTCCTGTTTTTAAAACCATCAGG + Intergenic
970415047 4:15848345-15848367 CTGCTGTTTTTTTGACCAGCAGG + Intronic
971121770 4:23712420-23712442 CTGATGTTTTTAAAATCATATGG - Intergenic
971174173 4:24264823-24264845 CTGTTGTTTTTGTGGCCAAATGG + Intergenic
972010580 4:34175812-34175834 CTACTTTGTTGAAGACCAAATGG - Intergenic
972429839 4:38970217-38970239 CTACTGTCTTTAAGACTAAAGGG - Intronic
973083328 4:46023230-46023252 GTGCCGTTTTAAAGACCATAAGG - Intergenic
973583159 4:52364524-52364546 CACCAGTTTTTATGACCAAATGG + Intergenic
973864151 4:55094947-55094969 TTGCTTTTTTATAGACCAAAGGG - Exonic
974799297 4:66795655-66795677 ATTCTGATATTAAGACCAAAAGG + Intergenic
975408105 4:74015188-74015210 CTCCTCTTTTTATCACCAAAAGG + Intergenic
975631096 4:76403111-76403133 GTGCTGTTTATAAAACAAAATGG - Intronic
976080762 4:81352277-81352299 CTGCTGTTTTTACAATGAAATGG + Intergenic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
982015400 4:151148485-151148507 ATGATGTGTTTAAGAGCAAATGG - Intronic
986621002 5:9674234-9674256 CTGCTTTATTGAAGACTAAATGG - Intronic
987298177 5:16572875-16572897 CTGCTGTTTTTAAGAGACGAGGG - Intronic
988114300 5:26864802-26864824 GTGCTGTACTTAAGACAAAAAGG - Intergenic
988123699 5:27001278-27001300 GTGCAGTTTCTAAGACTAAATGG + Intronic
989518816 5:42376780-42376802 CTGTTGTTTTTAAGACCACCTGG - Intergenic
990189015 5:53237419-53237441 ATGCTGTTTTGAAGGCAAAAAGG + Intergenic
991591274 5:68254047-68254069 TTGCTGCATTTATGACCAAAGGG - Intronic
992972998 5:82082000-82082022 CTTCTGTTTTTAAAACCATCAGG + Intronic
995333697 5:110975421-110975443 CTCCTGTTTTTAAAACCATCAGG + Intergenic
1003809043 6:9759099-9759121 CAGCTGGTTTTGAAACCAAACGG + Intronic
1004305793 6:14500776-14500798 CTGCTGCCGTTAACACCAAAAGG - Intergenic
1006977781 6:38119797-38119819 TTGCTCTTTTGAAGATCAAAGGG - Intronic
1006990781 6:38212956-38212978 CTAATGTTTTAAATACCAAAGGG + Intronic
1007682498 6:43644320-43644342 CTGTTGTTTTTAGATCCAAATGG - Intergenic
1008233651 6:49016357-49016379 CTGGTGTTTTTATGAAAAAATGG + Intergenic
1010452567 6:76019225-76019247 CTGCTGGTTTCCAGACCAACAGG - Intronic
1010837485 6:80608170-80608192 CTGCTGTTTTTTATACCAGAAGG - Intergenic
1010992376 6:82493879-82493901 CTGAGTTTTTTAAGCCCAAAAGG - Intergenic
1012407688 6:98919124-98919146 CTACTGTTTTTAGGCCCAGAAGG + Intronic
1013608997 6:111776419-111776441 CTACTGTTTTTAAGATGAATGGG - Intronic
1013962774 6:115920602-115920624 CTGCAGTTTTTGTAACCAAAAGG - Intergenic
1014994063 6:128118977-128118999 CTGTTCTTTTCAAGACTAAATGG - Intronic
1015029219 6:128574188-128574210 CTGCTGAGTTTAAGAAGAAAAGG - Intergenic
1016084908 6:139901925-139901947 CTCCTGTTTTTAAAACCATCAGG - Intergenic
1016122619 6:140363093-140363115 CTCCTGTTTTTAAAACCAGCAGG - Intergenic
1016167046 6:140959215-140959237 CTGCCATCTTTAAGGCCAAATGG - Intergenic
1016339021 6:143041174-143041196 CTCCTGTATTTAAGACTAATAGG - Intergenic
1018445726 6:163856277-163856299 CTGCTCTATTTATGACCAAATGG - Intergenic
1018446729 6:163865187-163865209 CTGCTGTTATTTAAACAAAATGG - Intergenic
1020418537 7:7971903-7971925 CTGCTGTTTTAAACACCAGGTGG + Intronic
1021288419 7:18812678-18812700 TTGCTGTTTTTAATAACAATTGG + Intronic
1021315267 7:19141594-19141616 AGGCTTTTTTTAAGACCTAATGG - Intergenic
1022462005 7:30618121-30618143 CTACTTTTTTTAAAACAAAAAGG + Intronic
1023512508 7:40968648-40968670 CTGCTGATCTCAAGACCAAAAGG + Intergenic
1023895814 7:44431977-44431999 CTGTGGTTTTTAAAAACAAATGG - Intronic
1024112017 7:46156990-46157012 CTGCTTTTTTTAAAACTGAATGG - Intergenic
1024571831 7:50729670-50729692 CTGCCATTTTTAAAATCAAAAGG - Intronic
1024575194 7:50757473-50757495 CTGGTCTTTTTAGGACCAAAAGG + Intronic
1024641224 7:51330215-51330237 CTCCTGTTTTTCAGAGAAAATGG + Intergenic
1030653770 7:112143852-112143874 GTGCTGTGATTGAGACCAAAGGG - Intronic
1032023148 7:128421312-128421334 CTGCTGTGTTTTAGAACAGAGGG + Intergenic
1032024241 7:128428963-128428985 CTGCTGCTGTTAAGAACCAATGG - Intergenic
1032990804 7:137393223-137393245 CTGCTTTTTTTAAAAAAAAATGG - Intronic
1033571459 7:142632829-142632851 CTGCCATTTTAAAGACCAATTGG - Intergenic
1034291665 7:149937392-149937414 CTGCTTTTATTCAGATCAAATGG - Intergenic
1034390755 7:150785703-150785725 CTGCAGTTTTTAACACGAAAAGG + Intergenic
1034573684 7:151979415-151979437 AAGCTGTTTTTAAGAGTAAAAGG - Intronic
1034779244 7:153862116-153862138 CTGCTTTTCTGAAGTCCAAATGG - Intergenic
1034814424 7:154159506-154159528 CTGCTTTTATTCAGATCAAATGG + Intronic
1039739310 8:40366735-40366757 CTGTTGTTTTTATCACAAAAAGG + Intergenic
1040045230 8:42956064-42956086 ATTCTGTTTTAAAGACAAAAGGG - Intronic
1040874713 8:52139295-52139317 ATGCTGTTTGTAACACTAAATGG - Intronic
1042137465 8:65645386-65645408 CTGCTGTTGTTAATGCCCAAAGG - Intronic
1044098456 8:88099338-88099360 CAGCTGTCTTAAAAACCAAAAGG - Intronic
1044913691 8:97089521-97089543 CTGCTGCTTTTAAGCCCATGGGG - Intronic
1045268704 8:100643558-100643580 GTGCTGTTTTGAGGAACAAATGG - Intronic
1046387126 8:113519701-113519723 CTGCTGTTTTCATGAGCATATGG + Intergenic
1046416940 8:113928736-113928758 CAGCTGCTTTTAAGTCAAAATGG + Intergenic
1046929227 8:119825991-119826013 CTCCTGTTTTTAAAACCATCAGG - Intronic
1048222683 8:132556546-132556568 CTGCTGTTTCTGAGAGCAGAAGG + Intergenic
1048922073 8:139240333-139240355 CTGCTGTTTTGTAGATCACATGG - Intergenic
1050290076 9:4144991-4145013 CTGCAGTTGTTAAAAACAAAAGG - Intronic
1051068982 9:13139370-13139392 CAGCTGTTATTAGGACCAATAGG - Intronic
1051979389 9:22996377-22996399 CTCCTGTTTTTAAAACCATCAGG + Intergenic
1052067229 9:24036905-24036927 ATGCTGTTTTGTAGACCACAAGG - Intergenic
1053267702 9:36727225-36727247 TTGCTATTTTTAATACCTAATGG - Intergenic
1053371150 9:37562791-37562813 TTGCTGTGTATAAGACCAAGTGG + Intronic
1054337616 9:63820845-63820867 CTGCAGTTCTTAAAACAAAACGG + Intergenic
1055240139 9:74173969-74173991 CTGTTGTATTTAAGAAAAAATGG + Intergenic
1055361702 9:75497842-75497864 ATGATCTTTTTAATACCAAAGGG + Intergenic
1055644303 9:78348303-78348325 CTTCTGTTTTTAGGAAGAAATGG + Intergenic
1055777018 9:79777650-79777672 CTGTAGGTTTTAATACCAAAGGG - Intergenic
1056017495 9:82405894-82405916 CTTTTGTTTTGAAGACCAATAGG + Intergenic
1057827307 9:98380907-98380929 CTGCTATTTTGAAAACTAAAAGG + Intronic
1059124490 9:111671053-111671075 CTGTTGTTGTTAAGACAGAATGG - Intergenic
1059999207 9:119943250-119943272 CTGCAGCTTTTAACACCAACTGG - Intergenic
1060870551 9:127036463-127036485 CTGTTGTTATGAAGAACAAATGG + Intronic
1061085345 9:128394795-128394817 TTGCTGTTATTATTACCAAATGG - Intergenic
1062352711 9:136147139-136147161 CTGCTTTTTTTAAGAAAAGAGGG - Intergenic
1186436987 X:9551400-9551422 ATGCTGATGTTAAGACCAACGGG + Intronic
1187765271 X:22634621-22634643 GTACTGTTTTTTAGACTAAAAGG + Intergenic
1188231944 X:27674932-27674954 CTGCCCTTTTTAACACCCAATGG + Intronic
1189155229 X:38750073-38750095 CTGCTCTTTTCTAGACCAACTGG - Intergenic
1193857130 X:86617044-86617066 CTGCTTTGTTGAAGATCAAATGG + Intronic
1194093487 X:89605470-89605492 CTTCTTATTTTAAGTCCAAAGGG - Intergenic
1194550204 X:95288908-95288930 CTGCTATATTTAAAAACAAATGG + Intergenic
1195590984 X:106626708-106626730 AAACTGTTTTAAAGACCAAAAGG - Intronic
1195590987 X:106626777-106626799 ATACTGTTTTAAAGACCAAAAGG - Intronic
1195768645 X:108324197-108324219 CCTCTGTTATTAAGTCCAAATGG + Intronic
1195772896 X:108371271-108371293 TTGCTTTTTTAAAGGCCAAAGGG - Intronic
1196373606 X:115005806-115005828 CTCATATTTTAAAGACCAAAGGG + Intronic
1197502411 X:127258192-127258214 CTGCTGCCTCTAAGACCTAAAGG + Intergenic
1197535101 X:127677383-127677405 CTGCTGGTTTTAAGACTGCATGG - Intergenic
1198041246 X:132854661-132854683 CTGCAGTTTTTAAAAGCAGAAGG - Intronic
1198743912 X:139869934-139869956 TTTCCTTTTTTAAGACCAAATGG - Intronic
1200446116 Y:3261573-3261595 CTTCTTATTTTAAGTCCAAAGGG - Intergenic