ID: 1155987916

View in Genome Browser
Species Human (GRCh38)
Location 18:32250134-32250156
Sequence TTCTGCAGCTTAGAAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 386}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155987916_1155987917 22 Left 1155987916 18:32250134-32250156 CCTGTGTTTTCTAAGCTGCAGAA 0: 1
1: 0
2: 1
3: 25
4: 386
Right 1155987917 18:32250179-32250201 TTAACTATTAAATAAATGCTTGG 0: 1
1: 0
2: 2
3: 57
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155987916 Original CRISPR TTCTGCAGCTTAGAAAACAC AGG (reversed) Intronic
900770015 1:4533412-4533434 TTCTGGAAGTTAGAAAACTCTGG + Intergenic
900978302 1:6031439-6031461 TTCTGCAGATGAGAAAACTGAGG + Intronic
902238288 1:15071817-15071839 TTCTGGATCACAGAAAACACTGG + Intronic
902405182 1:16178928-16178950 TTTTGCAGCTTTGAAGAAACAGG - Intergenic
902699493 1:18161916-18161938 TTTTGCAGATGAGAAAACAGAGG - Intronic
903363383 1:22791052-22791074 TTTTGCAGATGAGAAAACAAAGG - Intronic
903369235 1:22824609-22824631 TTCTGGAGCTGAGTAAACAGGGG - Intronic
903674878 1:25057338-25057360 TTCTGCAGGTGAGAAAACTGAGG + Intergenic
903683381 1:25112612-25112634 TTTTGCAGCTGAGGAAACAGAGG + Intergenic
903946651 1:26968295-26968317 TTTTACAGCTAAGAAAACAGAGG + Intergenic
905111666 1:35599324-35599346 TCCTGAAGTTTAAAAAACACTGG - Intergenic
905126681 1:35720309-35720331 TCCTCCAGCTAAGAAAATACAGG + Intronic
905358761 1:37403800-37403822 TACTGCATAGTAGAAAACACAGG + Intergenic
906906009 1:49893233-49893255 ATCTGGAACTAAGAAAACACAGG + Intronic
907457740 1:54586207-54586229 TTCTGCAGATGAGAAAACTGAGG - Intronic
907553182 1:55321716-55321738 TTCTGCAGGTGAGAAAACTGAGG - Intergenic
908044360 1:60152518-60152540 TTTTGCAGCTGAGAAAACCGAGG + Intergenic
909637651 1:77835043-77835065 TTCTGTCACTTAGAAAACACTGG - Intronic
910145433 1:84075327-84075349 TTCTGCAGATAAGAAAACTAAGG - Intergenic
910314524 1:85867195-85867217 ATCTGCAGGTTAGAAACCAGAGG + Intronic
912704620 1:111902710-111902732 TTTTGCAGATGAGAAAACAAAGG - Intronic
913225586 1:116695484-116695506 TTTTGCAGATGAGAAAACAGAGG + Intronic
914284232 1:146207735-146207757 ATCTGCAGTTTAAAAAACAATGG + Intronic
914332580 1:146685990-146686012 CTCTGAAGCTTAAAAAACATGGG - Intergenic
914545263 1:148658474-148658496 ATCTGCAGTTTAAAAAACAATGG + Intronic
914621305 1:149412205-149412227 ATCTGCAGTTTAAAAAACAATGG - Intergenic
914731115 1:150371325-150371347 TTTTACAGATTAGAAAACAGAGG + Intronic
915676150 1:157534103-157534125 TTTAGCAGGTTAGAAAACAAGGG + Intronic
915700350 1:157786522-157786544 TTCTGCAGGCCAGAAAACAATGG + Intergenic
916185662 1:162130222-162130244 TTTTGCAGATGAGAAAACAAAGG + Intronic
916832471 1:168507143-168507165 TTCTGCAGATTAGGAAACTGAGG - Intergenic
918277133 1:182964127-182964149 TTCTGCATCTTTTAAAAAACTGG + Intergenic
918439689 1:184554721-184554743 TTCTGTAAATTAGAAAACAAAGG - Intronic
919183114 1:194111108-194111130 TTTTGAATCTTAGAAAATACTGG + Intergenic
919380675 1:196856633-196856655 TTCTGCGGTTTAATAAACACTGG + Intronic
921633382 1:217462290-217462312 TTCTGAAGTTTATAAAACATAGG - Intronic
924111999 1:240709311-240709333 TTCTGAAGTTTAGAAAACTAAGG - Intergenic
1063071564 10:2671646-2671668 TGCTGCAGCTTGGAGTACACAGG - Intergenic
1063344272 10:5296676-5296698 TTTGGTTGCTTAGAAAACACTGG + Intergenic
1063490954 10:6463439-6463461 TTCTGCAGCAGAGAAATCATCGG - Intronic
1063688587 10:8261841-8261863 TTCTGCAGGTTAGAAGGCAGAGG + Intergenic
1066029461 10:31405062-31405084 TTCTGCAGATGAGAAATAACAGG + Intronic
1066245337 10:33577827-33577849 TTCTGCAGATTTGAGAACATGGG - Intergenic
1066292781 10:34029283-34029305 TGGTGCATCTTTGAAAACACTGG - Intergenic
1068987361 10:63119730-63119752 TTCTGCAACTCAGAAAAAATGGG - Intergenic
1070709935 10:78673621-78673643 TTTTCCAGCTTTGCAAACACAGG + Intergenic
1070796450 10:79219768-79219790 TTCTGCAGCTGAGAACACTGAGG + Intronic
1071257021 10:83880019-83880041 TTCTACAGATTAGGAAACTCAGG - Intergenic
1071838248 10:89441367-89441389 TTCTGCAGCTTTGGAAACTGAGG + Intronic
1071860239 10:89664870-89664892 ATCTGCAGCTTAGAAAGAAGAGG + Intergenic
1072135830 10:92544734-92544756 TTCTTCTGCATATAAAACACAGG + Intronic
1072204406 10:93189886-93189908 TTCTGCAGATTGGAAAATATTGG + Intergenic
1072237270 10:93464200-93464222 TTCCACAGCTTAGAAAACTCAGG - Intronic
1073527162 10:104194807-104194829 TTTTGCAAAATAGAAAACACAGG + Intronic
1073985396 10:109202641-109202663 TTCTGCAGCTGAGGAAACTGAGG + Intergenic
1074171468 10:110942994-110943016 TTCTTCATCTTAGAAAACTGAGG - Intronic
1074653270 10:115550423-115550445 TTCTATAGCTTAGAACACTCTGG - Intronic
1074752530 10:116600462-116600484 TGATACAGTTTAGAAAACACAGG + Intronic
1075630594 10:123998533-123998555 TTCTGCAGATAAGAAAACAGAGG + Intergenic
1075712035 10:124536014-124536036 TTCTGCTGCTTTAAAACCACTGG + Intronic
1076037716 10:127214765-127214787 TTCTGAAGCCTAAGAAACACTGG - Intronic
1077446464 11:2593310-2593332 TTTTGCTGCTCAGAGAACACTGG + Intronic
1077446478 11:2593385-2593407 TTTTGCTGCTCAGAGAACACTGG + Intronic
1077668115 11:4133883-4133905 TTCTGCATCTTAGAATCAACTGG + Intronic
1077873378 11:6282086-6282108 TTCTTCAACTTAGAGAACAAGGG + Intergenic
1079105260 11:17567853-17567875 TTTTGCAGATTAGAAAACCAAGG - Intronic
1079322686 11:19464537-19464559 TTCTGCAGATGAGAAAACTGAGG - Intronic
1079346068 11:19653495-19653517 TTTTGCAGATAAGAAAACTCAGG + Intronic
1080385091 11:31806146-31806168 TACCGCAGCTTCGAAAACTCGGG + Intronic
1080998326 11:37633853-37633875 TTCTGCAGCCTAGGAAACTCAGG - Intergenic
1081588762 11:44406381-44406403 TTTTGCAGATTGGAAAACAGAGG - Intergenic
1081650612 11:44821624-44821646 TTCTTCAGATGAGAAAACTCAGG - Intronic
1085851648 11:80127321-80127343 TTTTGCAGATGAGAAAACATAGG - Intergenic
1086439598 11:86814856-86814878 TTCTGCCTCTCAGAAAACATTGG - Intronic
1088556263 11:111064346-111064368 TGCTGCAGCCAAGCAAACACAGG - Intergenic
1088591011 11:111403275-111403297 TTCTGAAGCATAAAAAGCACAGG - Intronic
1090167486 11:124565557-124565579 TTTTGAAACTTAGAAAACGCAGG + Intergenic
1090337076 11:125977310-125977332 TTCTGCAACTCTCAAAACACAGG + Intronic
1091037203 11:132244962-132244984 TACACCAGCTGAGAAAACACGGG - Intronic
1091600912 12:1917192-1917214 TTTTGCAGCTGAGGAAACAGAGG - Intronic
1092627573 12:10343677-10343699 TTCTGGAGCTGAGAAAATATGGG - Intergenic
1092685193 12:11035677-11035699 TCCTGCAACTTAGAAGAAACTGG + Intronic
1094249440 12:28342142-28342164 TTCTGCATCTCAGAAACAACAGG - Intronic
1096332408 12:50725745-50725767 TTTTGCAGATTAGAAAACTGAGG + Intronic
1098070980 12:66674391-66674413 TTCTGCAGATGAGAAAAGATGGG + Intronic
1099212476 12:79809466-79809488 TTCTGAAGTTTAAAAAACATAGG - Intronic
1099647998 12:85384312-85384334 TTCTACAGCTTAGACAAATCAGG - Intergenic
1100814431 12:98372649-98372671 TTCTCCATATTATAAAACACTGG + Intergenic
1101192247 12:102347197-102347219 TTCTGTAGGTTAGAAAACTTGGG - Intergenic
1101254973 12:102967559-102967581 TTATGCAGATGAGAAAACAAAGG - Intergenic
1102422668 12:112816326-112816348 TTCTGGCCCATAGAAAACACAGG + Intronic
1102533535 12:113564494-113564516 TTTTGCAGATGAGAAAACAGAGG - Intergenic
1102735803 12:115158278-115158300 TTTTGCAGATGAGAAAACAAGGG + Intergenic
1103608461 12:122106117-122106139 GTCTGCAGCTTTGAAGACAGAGG - Intronic
1105756283 13:23467095-23467117 TTTTGCAGCTGAGAAAACGAAGG + Intergenic
1105958930 13:25311180-25311202 TTTTGGAGCTTAGAAATCAGAGG + Intronic
1106183044 13:27384491-27384513 TTCTGCAGATGAGAAAACTGAGG - Intergenic
1106273919 13:28184668-28184690 TTCTACAGTCTTGAAAACACTGG + Intronic
1106327171 13:28704272-28704294 TTCTGCAGCTGAGGAAACTAAGG + Intronic
1107749707 13:43551916-43551938 TTCTTTAGTTTAGAAAACACTGG + Intronic
1108003354 13:45924398-45924420 TTTTTCAACTTAGAAAACAATGG - Intergenic
1108294325 13:48998172-48998194 TTCTGCCTTCTAGAAAACACTGG - Intronic
1108481653 13:50878397-50878419 TTCTGCATCTTATAAAAGAGTGG + Intergenic
1111303778 13:86379766-86379788 TGCTGCAGCTTAGATATCATAGG - Intergenic
1111931612 13:94518448-94518470 TTCCACAGCTCAGAAAATACTGG + Intergenic
1111984103 13:95048296-95048318 TTTTGAAGCTTAGAAAAAATAGG + Intronic
1113004831 13:105688473-105688495 TTCAGCAGGTTAAAAATCACTGG + Intergenic
1113828766 13:113277728-113277750 TTCTACAGCTTAGGAGTCACAGG - Intergenic
1115091011 14:29575397-29575419 TACTGCAGCTGATAAAACATAGG + Intergenic
1115925002 14:38422931-38422953 TTATGAAACTTAGAAAACATTGG - Intergenic
1117167799 14:53056645-53056667 TTCTACAGCTCAGGAAACTCAGG - Intronic
1118085971 14:62417762-62417784 TTGTGCAGCTTAGAGAACTAAGG + Intergenic
1119043810 14:71299204-71299226 TTCTCCAGGTAAGAAAACAGAGG - Intergenic
1119782988 14:77290612-77290634 TGCTGCAGCTAAGAGAACAGAGG - Intronic
1121329582 14:93041488-93041510 CTGTGCAGGTCAGAAAACACAGG + Intronic
1121993045 14:98579719-98579741 TTTTGTAGCTTAGCACACACAGG - Intergenic
1123995544 15:25715741-25715763 TGCTGCAGCAGAGAAAATACAGG + Intronic
1124610076 15:31202117-31202139 TTCTACAGATGAGAAAACATAGG + Intergenic
1125333566 15:38605521-38605543 TTTTACAGATTAGAAAACAGAGG - Intergenic
1125686554 15:41566949-41566971 TTCTGAAGCTCAGAGAAAACTGG - Intronic
1126226838 15:46280639-46280661 TTCTGCAGATGAGAAAACTAAGG - Intergenic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1127023171 15:54773954-54773976 TACTGGAGCTTATAACACACAGG + Intergenic
1127112456 15:55689146-55689168 TAATGCAGCTTATCAAACACTGG - Intronic
1127245593 15:57170073-57170095 TTTTGCAGATTAGTAAACAGAGG + Intronic
1127961102 15:63891549-63891571 TTTTGCAGATGAGAAAACAGAGG - Intergenic
1128886955 15:71296866-71296888 TTTTGCAGATGAGAAAACAGAGG - Intronic
1129271184 15:74420043-74420065 TCCTGCAGCTGAAAAAACAGTGG - Intronic
1129801195 15:78415838-78415860 TTCAGCAGCGCTGAAAACACTGG - Intergenic
1131151337 15:90049233-90049255 TTTTGCAGTTGAGAAAACAGAGG + Intronic
1131316451 15:91342427-91342449 CTCTGCAGATGAGAAAAGACAGG + Intergenic
1133600873 16:7339162-7339184 TTTTGCAGCCTAGAAAACTGAGG - Intronic
1133678781 16:8100781-8100803 TTCTGCAGCTCACAAATCAATGG - Intergenic
1134032908 16:11006885-11006907 TTCTGCAACCAAGAAATCACAGG + Intronic
1134152607 16:11816935-11816957 TAATGCAGCTTAGAGAACCCAGG + Intergenic
1135108654 16:19672934-19672956 ATCTGCAGGTTAAAAATCACTGG + Intronic
1135166359 16:20142661-20142683 TTTTGCAGATGAGAAAACAGAGG - Intergenic
1135402189 16:22173670-22173692 TTCTGAAGCTTAGAAAGCAAGGG - Intronic
1135825370 16:25722638-25722660 TTATACAGCCTTGAAAACACAGG + Intronic
1135977532 16:27119087-27119109 TACTTAAGCTTACAAAACACTGG + Intergenic
1137239979 16:46647937-46647959 TACTCCAGCTTGGACAACACAGG + Intergenic
1138055470 16:53828508-53828530 TTCTGCAGTTAAGAGAACAAAGG - Intronic
1138314761 16:56060444-56060466 ATCTGCAGGTTAGAAAACTGGGG + Intergenic
1138317900 16:56086161-56086183 TTCTGGATCTTAGGAAACATTGG + Intergenic
1139333965 16:66217794-66217816 TTCTGCAGATGAGAAAACTGAGG - Intergenic
1140001034 16:71025251-71025273 CTCTGAAGCTTAAAAAACATGGG + Intronic
1140807056 16:78542321-78542343 TTCTCCAGCTTGCAGAACACAGG - Intronic
1142227137 16:88883020-88883042 TTCTGCAGCTGAGGAAACTGAGG + Intronic
1142818262 17:2445270-2445292 GTTTGTAGCCTAGAAAACACAGG + Intronic
1143161272 17:4873019-4873041 TTCAGCAGCTCGGAAACCACTGG - Intronic
1144013108 17:11169196-11169218 TTTTACAGCTTAAGAAACACAGG + Intergenic
1145062310 17:19740997-19741019 TTCTACAGATTTGGAAACACTGG - Intronic
1145066274 17:19763427-19763449 TTGTGCAGCTTAGCAAAAATGGG - Intergenic
1147022390 17:37547094-37547116 TCATACAGATTAGAAAACACTGG - Intronic
1147595202 17:41712380-41712402 CTCTGCAGGTGAGAAAACCCAGG + Exonic
1147904064 17:43811427-43811449 TTTTGCAGCTGAGAAAACTGAGG + Intronic
1149272590 17:54996628-54996650 TTCTACAGCTAAGAAAATAGAGG + Intronic
1149417999 17:56480273-56480295 TTCTGCAGTTTAGTAACCACAGG - Intronic
1149612368 17:57966958-57966980 TTTTACAGCTTAGGAAACAGAGG + Intergenic
1149635638 17:58166801-58166823 CTGTGCAGCTGAGGAAACACTGG - Intergenic
1149729831 17:58934157-58934179 CTCTGCAGCTTAGAGAAGAATGG + Intronic
1150327734 17:64270088-64270110 CACTGCAGCTTAGAAAGCACTGG - Intergenic
1151773271 17:76178735-76178757 TTTTGCAGGTAAGAAAACAGAGG + Intronic
1152473925 17:80505345-80505367 TACTGCAGCTTCTAAAACTCGGG + Intergenic
1153009562 18:525732-525754 CTCTGCAACTCAGAAAGCACAGG - Intergenic
1153419569 18:4889332-4889354 GACTGCAGCTCAAAAAACACTGG - Intergenic
1154072178 18:11162550-11162572 ATCTGCAGAAGAGAAAACACTGG - Intergenic
1155431205 18:25760716-25760738 TTCTGTAGATTAGAATACAAGGG + Intergenic
1155987916 18:32250134-32250156 TTCTGCAGCTTAGAAAACACAGG - Intronic
1156016179 18:32549680-32549702 TTTTGCAGCTGAGAAAACCAAGG + Intergenic
1157203935 18:45682671-45682693 TTGTGCATCTTAGAAAAGAGAGG - Exonic
1157331583 18:46708002-46708024 ATTTGCAGCTGAGAAAACAAAGG - Intronic
1157345134 18:46822628-46822650 TTCTGGAGGTTTGAAAACAGTGG + Intronic
1158043633 18:53128543-53128565 TTATGGTGCTTTGAAAACACTGG - Intronic
1158213522 18:55076166-55076188 CTCTGGAGCTTGGAAAACTCAGG - Intergenic
1158409073 18:57188423-57188445 TTCTGGAACTTAGAAAAGATGGG + Intergenic
1160061181 18:75530441-75530463 TTCTGCAGCTCAGAAAACTGAGG - Intergenic
1160125204 18:76165468-76165490 TTCTGCAGCTTTGAAATCTGTGG + Intergenic
1160238058 18:77101361-77101383 CCCTGCAACTTAAAAAACACAGG + Intronic
1161881656 19:6958642-6958664 TTCTGGAGCTTAGGAGACAAAGG + Intergenic
1163304144 19:16467005-16467027 TTCTGCAGATGAGAAAACTAAGG + Intronic
1163597378 19:18227908-18227930 TTCTACAGATGAGAAAACAGAGG + Intronic
1165040851 19:33066432-33066454 TTTTGCAGCCTAGAAAACGGAGG - Intergenic
1165350756 19:35273963-35273985 TTCTGCAGCAAAGAAAAAAGAGG - Intronic
1166228948 19:41414430-41414452 TTCTGGAGATTAGAAAACTGAGG - Intronic
1166552332 19:43674512-43674534 TTCTCCAGCTGAGAAAACTGAGG - Intergenic
1166774397 19:45303464-45303486 TTCTGCAGATGAGAAAACCGAGG - Exonic
1167193290 19:48007216-48007238 TTCTGCAGATGAGGAAACAAAGG + Intronic
926195227 2:10759637-10759659 CTCTGCTGCTTGGAACACACAGG - Intronic
927152720 2:20204984-20205006 TTTTGCAGATGAGAAAACAGAGG + Intronic
928451754 2:31384156-31384178 TTGTGTACATTAGAAAACACAGG + Intronic
929330911 2:40679559-40679581 TTCTGCAACTTAAAATACAGAGG - Intergenic
929748554 2:44685386-44685408 TCTTTCAGCTTAGAATACACTGG + Intronic
932114479 2:69033909-69033931 TTAAGCTCCTTAGAAAACACAGG - Intronic
932192226 2:69750744-69750766 TTCTGCAGCTAAAGACACACTGG - Intronic
932956788 2:76360348-76360370 TTCTGCAGTTTAAGATACACAGG - Intergenic
933132995 2:78696609-78696631 TTATGCAGCCAAAAAAACACAGG - Intergenic
933698465 2:85237690-85237712 TTCTGCAGCTGTGTAAACAGTGG + Intronic
937619449 2:123968734-123968756 ATCTGCAGTTTGGGAAACACTGG + Intergenic
937626850 2:124053580-124053602 TTCTTCAGCTGAGAAAACCATGG + Intronic
939139383 2:138335487-138335509 TTCTTCTGGTTAGAAAGCACTGG - Intergenic
940529278 2:154859508-154859530 TACTGTAGCTTTTAAAACACTGG - Intergenic
941171499 2:162142799-162142821 GACTGCAGCTTAGAAAACAGGGG + Intergenic
941235463 2:162966663-162966685 TTCTGCAGATGAGGAAACAGAGG - Intergenic
941251776 2:163173945-163173967 TGCATCAGCTTAGAGAACACAGG - Intergenic
941441954 2:165549450-165549472 TTCTCCAGCATAGAAAACACAGG + Intronic
941539614 2:166766263-166766285 TTCTGCCTCTTAGAGCACACGGG + Intergenic
942290428 2:174464203-174464225 CTCTACACCTTAGGAAACACTGG - Intronic
942311066 2:174657469-174657491 TTCTGGAGCTTTGAAAACCCTGG - Intronic
942323744 2:174757950-174757972 TTCTGCAGATGAGAAAACAAAGG + Exonic
942736620 2:179121769-179121791 ATATGCAGCTTAGAAAACAAAGG - Exonic
944166623 2:196729178-196729200 TTCTTCAGCTTAAAACACAAGGG - Exonic
944507862 2:200432225-200432247 TGCTGCAGCATAGAATACAGAGG + Intronic
945494028 2:210488161-210488183 TTCTGCAGTTTAAAAAAAAAAGG - Intronic
945832929 2:214808470-214808492 TTCTGCAAGTTAGAAATCAAAGG + Intronic
947192943 2:227528368-227528390 TTTTGCAGCTCAGGTAACACAGG - Intronic
947270651 2:228330448-228330470 TTCTGCAGCAGAGAGAAGACAGG - Intergenic
947390008 2:229629139-229629161 ATTTGCAGCTTGGAAAACAGAGG - Intronic
947991337 2:234489826-234489848 TTCTGCAGTTTAAAAAATATTGG - Intergenic
948429232 2:237908741-237908763 TCCTGCACCATAGAAAACAGAGG - Intronic
948566343 2:238889644-238889666 CACTGCAGCTTAGATAACTCAGG - Intronic
1168752424 20:292285-292307 TTCTGCCTCTTAAAAATCACAGG + Intergenic
1169952345 20:11059177-11059199 TTCTGCATCTTAGAAAAACTGGG - Intergenic
1170814829 20:19704906-19704928 TTCTGCAGATTAGGAAACCAAGG + Intronic
1170953046 20:20953994-20954016 TTTTGGGGCTTTGAAAACACAGG - Intergenic
1171232846 20:23501103-23501125 TTCTGCTGCACAGAAATCACTGG - Intergenic
1171364683 20:24615779-24615801 TCCTGCAGCTCAGAGAACATGGG + Intronic
1172293787 20:33793705-33793727 TTTTACAGCTGAGAAAACCCAGG + Intergenic
1177279741 21:18965816-18965838 TTATGCACCTGAGAAAACTCAGG + Intergenic
1177802413 21:25840858-25840880 TTCTGAGGCATATAAAACACGGG + Intergenic
1177813946 21:25955582-25955604 TTCTGCAGCTTTGACAATCCAGG - Intronic
1178217523 21:30616697-30616719 TTCTGCTGTTTTGAAGACACAGG - Exonic
1178419370 21:32431207-32431229 TTCCACAGCTGAGAAAACCCAGG + Intronic
1179931379 21:44573243-44573265 TTCAGCAGCCTAGAAAACCAAGG + Intronic
1180224318 21:46380737-46380759 TTCCACAGCTCTGAAAACACTGG + Intronic
1180822799 22:18843223-18843245 TTCTCTTGCTTACAAAACACTGG - Intergenic
1181190164 22:21132802-21132824 TTCTCTTGCTTACAAAACACTGG + Intergenic
1181209038 22:21277722-21277744 TTCTCTTGCTTACAAAACACTGG - Intergenic
1181653667 22:24276851-24276873 TTCTCTTGCTTACAAAACACTGG + Intronic
1182079833 22:27521142-27521164 TTCTGCAGCTGGGAAAACTGAGG + Intergenic
1182849151 22:33456906-33456928 TTCTGCAACTTATAAAACTTGGG + Intronic
1183100883 22:35583404-35583426 TTTTGCAGCTGAGGAAACAGAGG + Intergenic
1183828474 22:40405874-40405896 TTCTGCAGCTTGGAGGACTCAGG + Intronic
1184082502 22:42233280-42233302 TTCTGCAGATGAGGAAACAAAGG + Intronic
1184441482 22:44519323-44519345 TTCTGCAGCTTCCTAGACACTGG + Intergenic
1184640037 22:45865831-45865853 CTCTGCAGCTTCGACCACACAGG + Intergenic
1184900189 22:47441806-47441828 TTATGCAGCTTACAAAATACAGG + Intergenic
1203217901 22_KI270731v1_random:17726-17748 TTCTCTTGCTTACAAAACACTGG + Intergenic
1203272936 22_KI270734v1_random:69131-69153 TTCTCTTGCTTACAAAACACTGG - Intergenic
949160587 3:876985-877007 TACTGAAGGTTAGGAAACACTGG + Intergenic
949491041 3:4589356-4589378 ATCTGCAGCTTGAAAAACACTGG + Intronic
950283901 3:11729931-11729953 TTATGCAGATGAGAAAACAGGGG + Intergenic
951422486 3:22503828-22503850 CACTGTAGCTGAGAAAACACTGG - Intergenic
951595574 3:24314934-24314956 TTTTGAAGTTTAAAAAACACAGG + Intronic
951705777 3:25543024-25543046 TTTTGCCACTTAGGAAACACTGG + Intronic
954740223 3:52743678-52743700 TTTTGCAGCTAAGGAAACAGAGG - Intronic
954804672 3:53210508-53210530 TTCTTTAGCATAGAAAAGACAGG - Intergenic
955126875 3:56121113-56121135 TTCTACAGGTGAGAAAACAGAGG - Intronic
955134146 3:56199390-56199412 TTCTGGAGCTGAGAAAACAAGGG + Intronic
955756043 3:62226065-62226087 TTTTGCAGATCAGAAAACAGAGG + Intronic
955791611 3:62593816-62593838 TTTTGCATCTTAGCAATCACTGG + Intronic
956430210 3:69178778-69178800 TTTTGCAGCTTAGGCAACTCTGG - Intronic
956499595 3:69868275-69868297 TTTTGCAGCTGAGAAAACTGAGG + Intronic
956806205 3:72814596-72814618 TTTTACAGCTTAAAAAATACTGG + Intronic
958008199 3:87840739-87840761 TTATTCAGCTTTAAAAACACAGG + Intergenic
960026027 3:113010871-113010893 TACTCAAGCTTAGAAAGCACAGG + Intronic
961037302 3:123651582-123651604 CTCTGCTGCTTGGAATACACTGG - Intronic
961228400 3:125276086-125276108 TTCTGGTGCTTGAAAAACACTGG + Intronic
961669945 3:128521647-128521669 TTCTGCAGATAAGGAAACAGAGG - Intergenic
961884590 3:130088172-130088194 TTCCACAGCTAAGAAAACCCAGG - Intronic
962431472 3:135324349-135324371 TTTTGCAGATTAGAAACCTCAGG - Intergenic
962953867 3:140246524-140246546 TTGTGCAGGCCAGAAAACACAGG - Intronic
963102108 3:141617728-141617750 TTTTAAAGCTTGGAAAACACAGG + Intergenic
963581824 3:147135211-147135233 TTCTGCAGTTTAAAAGACAGTGG + Intergenic
964127239 3:153247757-153247779 TTCTGCAGCTCAGACAGAACTGG - Intergenic
964224690 3:154384635-154384657 TTTTTCAGATGAGAAAACACAGG + Intronic
965147643 3:164927283-164927305 ATTTGGAGGTTAGAAAACACTGG + Intergenic
969478063 4:7432444-7432466 TTCTACAGATTAGAAAACTGAGG + Exonic
969820191 4:9714110-9714132 TTCCACAGCTGAGAAAACCCAGG + Intergenic
970504827 4:16717302-16717324 TTCTGCAGGTCAGAAAAAGCAGG + Intronic
971181893 4:24336281-24336303 TTCTGCTGCTGAGAAGAGACAGG + Intergenic
973635217 4:52856030-52856052 CACTGCAGCTTAGAAAGGACTGG - Intergenic
973792294 4:54389669-54389691 TTTTACAGCTGAGAAAACAGAGG + Intergenic
973843271 4:54884836-54884858 TTCTGTAGCTTATGAACCACAGG + Intergenic
973898407 4:55440784-55440806 TTCTGCAGCTTTGTATACTCTGG + Intronic
974571848 4:63662183-63662205 TTCTGCTCGTTGGAAAACACTGG - Intergenic
976311620 4:83619078-83619100 TTCAGGAGCTTAGAAAAATCTGG + Intergenic
977479304 4:97554657-97554679 TCCTGAAGTTTAGAAAACATAGG - Intronic
977482350 4:97594089-97594111 TTTTGGAGGTTAGAAGACACTGG - Intronic
977576552 4:98681018-98681040 TTTTGCAGCTGAGATAACAGTGG + Intergenic
979435839 4:120689085-120689107 ATCTGTAGCTTAGAAAACTGTGG + Intronic
979589085 4:122457733-122457755 TTTTGCAGATTAGAAAACTGAGG + Intergenic
979614220 4:122723844-122723866 TTCTGTAGCTTAGATATCATGGG - Intergenic
981141420 4:141273922-141273944 TTTTACAGATTAGAAAACAGAGG + Intergenic
981424458 4:144587256-144587278 TTTTGCAGGTGAGAAAACTCAGG + Intergenic
981699298 4:147591327-147591349 TTCTACAGATTAGAAAACTGAGG + Intergenic
982130664 4:152225932-152225954 ATTTGCAGCTGAGGAAACACAGG - Intergenic
982567214 4:157000267-157000289 TTTCGCAGCTTAGCAAACTCAGG - Intergenic
983397748 4:167223585-167223607 TTGTGCAGCTGAGGAAACTCAGG - Intronic
983823079 4:172221375-172221397 TTCAGCAGGTTATAAAACCCAGG + Intronic
983982568 4:174016671-174016693 TTCTGCAGCTTAGCATGCAATGG + Intergenic
984849522 4:184142011-184142033 ATCTACAGCTGAGAAAACAGAGG + Intronic
985313330 4:188627970-188627992 TTCTGCAGATTAGAAAAATGAGG + Intergenic
986280870 5:6321391-6321413 TTCTGCAGCTATGGAAACCCTGG + Intergenic
986611361 5:9571094-9571116 TCCTGAAGCTTAATAAACACAGG - Intergenic
986659428 5:10045677-10045699 TCCTGCAGCTTGGGAAACCCTGG - Intergenic
987215893 5:15736827-15736849 ATCTGCAACTTAAAATACACAGG - Intronic
988824573 5:34922252-34922274 TTTTGAAGCTAAGAAAAAACAGG + Exonic
988978374 5:36538359-36538381 TTTTGCAGATGAGAAAACTCAGG + Intergenic
989163353 5:38412226-38412248 TTCTGCAACTTAGAAAATCATGG - Intronic
990918824 5:60939809-60939831 TTCTAGAGACTAGAAAACACTGG - Intronic
991196995 5:63946412-63946434 TCCTGCATTTTAGAAAACTCAGG + Intergenic
991606421 5:68406272-68406294 CCCTGCAGTTTGGAAAACACTGG - Intergenic
993071615 5:83171334-83171356 TTCTCCTGCTTAAAAATCACTGG + Intronic
993570590 5:89534027-89534049 TAATACAGCTTAGAACACACAGG - Intergenic
994118001 5:96082378-96082400 TTTTGCAGCTGAGAAAAAGCAGG + Intergenic
995434357 5:112119209-112119231 GTCTGTAACTTAGAAAAAACAGG + Intergenic
995502039 5:112817785-112817807 TTTTGCAGCTCAGAAAACTGAGG + Intronic
995705847 5:114989004-114989026 TTCTGCAGACCAGAAAACAGTGG + Intergenic
996005501 5:118416137-118416159 TTCTAGAACTAAGAAAACACAGG + Intergenic
998441071 5:142162644-142162666 TTCTGCAGCTGAAAAAAAAATGG + Intergenic
998793552 5:145792827-145792849 TTCTGTAACTTAGTAAACACAGG - Intronic
999260802 5:150237680-150237702 TTCTACAGCTGAGGAAACAGAGG - Intronic
999605217 5:153306581-153306603 TTTTTCAGCTTAGAAAACAGAGG - Intergenic
1002945990 6:1761137-1761159 TTCTGAATCTTGGAGAACACAGG - Intronic
1003212064 6:4077763-4077785 ATCTGGAACTTAGAAAACAGGGG + Intronic
1003260860 6:4514593-4514615 TTCTGCAGAAAACAAAACACCGG + Intergenic
1003864496 6:10350787-10350809 TTCTGCAGTTTGGACAACTCAGG + Intergenic
1004132366 6:12932831-12932853 TTATGGAGCTTAGAAATGACTGG + Intronic
1004470480 6:15924492-15924514 TTCTACAGATGAGAAAACAGAGG - Intergenic
1004554600 6:16683427-16683449 TTCTGCAGCGTAGTTAACAGAGG - Intronic
1004891878 6:20108853-20108875 TTTTCCAGTTGAGAAAACACAGG + Intronic
1005276037 6:24219491-24219513 GTTGGCAGATTAGAAAACACTGG - Intronic
1005410452 6:25539677-25539699 TTAAGCAGCTTTGAAACCACAGG - Intronic
1006575224 6:35040276-35040298 TTTTGCAGGTGAGAAAACTCAGG - Intronic
1006792986 6:36715823-36715845 TTCTGCAGCCCAGGAAACAGAGG - Intronic
1006872524 6:37265041-37265063 TATTGCAGCTTAAAAAAGACAGG - Intronic
1006926416 6:37657969-37657991 TTCTGCAGATGAGAAAACTGAGG - Intronic
1007415504 6:41689088-41689110 TTTTGCAGCTGAGAAAACTGGGG + Intronic
1007520772 6:42450857-42450879 TTCTCCAGCTAAGAAACCGCAGG - Intronic
1011473895 6:87734163-87734185 TTTTGCAGATAAGAAAACCCAGG + Intergenic
1011635734 6:89371411-89371433 TTCTGCAGCTTTGACCACCCGGG - Intronic
1013577431 6:111498371-111498393 TTCAGCAGCTCAGAAATCCCTGG + Intergenic
1014310982 6:119801184-119801206 TTTCACAGCTGAGAAAACACAGG - Intergenic
1014746334 6:125205197-125205219 TTCTGGACCTAAGAAAACACAGG + Intronic
1015029472 6:128576927-128576949 TGCTGAAGTTTAGAAACCACTGG + Intergenic
1015528992 6:134201899-134201921 TGCTGCAGTGTAGAAACCACGGG + Intronic
1017028575 6:150201617-150201639 TTCACCAGCTTAGAACTCACGGG - Intronic
1017346829 6:153392582-153392604 TGCTGCTGCTTAGAAAAAACTGG - Intergenic
1017354540 6:153487755-153487777 TTCTGAATCTTAGAAATCACTGG - Intergenic
1017551531 6:155514529-155514551 TTCAACAGCTTAGAAGACATGGG - Intergenic
1019558145 7:1642634-1642656 TTCTGCAGCTGAAACAGCACGGG - Intergenic
1020317973 7:6920183-6920205 TTCTACAGCTGAGAAAACCCAGG - Intergenic
1021001568 7:15337888-15337910 TGCTGCAGCTAAGAATCCACTGG - Intronic
1021901287 7:25288324-25288346 TTTTACAGGTTAGAAAACTCAGG + Intergenic
1021904884 7:25323358-25323380 TTTTGCAGCTGAGGAAACTCAGG - Intergenic
1022280387 7:28902803-28902825 TTCTGTAGCTTAAAAAATATTGG - Intergenic
1022573621 7:31476645-31476667 TTTTACAGCTGAGAAAACAGAGG + Intergenic
1022757478 7:33309056-33309078 TTTTGCAGATGAGAAAACTCAGG - Intronic
1023369475 7:39498755-39498777 TTCTGAGGCATAGAAAACTCAGG - Intergenic
1023610167 7:41964760-41964782 TTCTGCAGATTAGAGCACAGCGG + Exonic
1026266710 7:68801668-68801690 TTCTGCATTTGAGAAAGCACTGG - Intergenic
1028058054 7:86273416-86273438 GTCTGCAGATGAGAAAACAGTGG - Intergenic
1028511751 7:91632852-91632874 TTTTTCATCTAAGAAAACACTGG + Intergenic
1029985563 7:104919971-104919993 TTTTGCAGATTAGAAAACTGAGG - Intergenic
1031337886 7:120559409-120559431 TTCTGCAGATGAGAACACAAAGG + Intronic
1031639674 7:124145860-124145882 TGCTGCAGCTCAGAAGAAACAGG - Intergenic
1031751356 7:125579135-125579157 TTCTGCAGCTATCAAAACAAAGG - Intergenic
1031813658 7:126405097-126405119 GTCTGAAACTTGGAAAACACAGG + Intergenic
1031953644 7:127918982-127919004 TTCTCCATGTTAGAAAAAACTGG + Intronic
1032155722 7:129466030-129466052 TGCTGCTGCTCAGCAAACACTGG - Intronic
1032268400 7:130383834-130383856 TTGTGCAGCTTAGAAGCCAGAGG - Intronic
1032537864 7:132679301-132679323 TTTTGCAGATGAGAAAACAAAGG - Intronic
1033215186 7:139488180-139488202 CTCTGGAGCATAGAAAACAGGGG - Intergenic
1033994099 7:147323977-147323999 TTCTTTAGCTTAGAAAGCAAAGG + Intronic
1036050769 8:5194336-5194358 ATCTGCAGCTTAGAAAAATTTGG + Intergenic
1036782419 8:11658786-11658808 TTCTCCAGATGAGAAAACAGAGG + Intergenic
1038641778 8:29334694-29334716 TTCTGCAGCTGAAAAAGCCCTGG - Exonic
1039108815 8:34019506-34019528 GGCTGTTGCTTAGAAAACACGGG + Intergenic
1040978073 8:53215840-53215862 TTCTGCAGGCTAGAAATCTCAGG + Intergenic
1042610699 8:70597262-70597284 TTAAGAAGCTTGGAAAACACTGG + Intronic
1042639850 8:70921851-70921873 TTCTGGAGATTAGAAAAAAAGGG - Intergenic
1043821713 8:84874330-84874352 TTTTGCAGATGAGAAAACAAAGG + Intronic
1045542060 8:103096037-103096059 GTCTTCAACTTAAAAAACACTGG - Intergenic
1045751392 8:105488438-105488460 TTTTGCAGAATAGGAAACACAGG + Intronic
1047857155 8:128923588-128923610 TTCTGCAACTCAGAGAACAGAGG - Intergenic
1048790822 8:138101665-138101687 ATATGCATCTTAGGAAACACTGG + Intergenic
1049263340 8:141651814-141651836 TTTTGCAGCTGAGGAAACAGAGG + Intergenic
1052623770 9:30947642-30947664 TTCTGCTGCTTACAAGACACTGG - Intergenic
1055425056 9:76186565-76186587 TTCTGCTGCTTCCAAAATACAGG - Intronic
1055891139 9:81124960-81124982 TTTTGCAGTATAGAAAACTCAGG - Intergenic
1056147172 9:83743838-83743860 TTCTGAAGCTTAGGAAACATAGG - Intronic
1056985740 9:91362218-91362240 TTTTGCAGCTTACTTAACACAGG - Intergenic
1057060566 9:92000275-92000297 ATTTGCAGCATAGAAAACAAAGG + Intergenic
1059767278 9:117395444-117395466 CTCTGCACCTCATAAAACACAGG + Intronic
1060219938 9:121759194-121759216 ATGTGTAGCTTAGAAAACAGAGG - Intronic
1061496250 9:130976250-130976272 TTCTGCAGAGGAGAAAACAGAGG + Intergenic
1061621875 9:131815890-131815912 TTCTACAGATCAGAAAACAGGGG + Intergenic
1187107155 X:16255073-16255095 TTCTGCCAATTAGAAAACAAAGG + Intergenic
1187599712 X:20814611-20814633 TTCTGTAAATGAGAAAACACAGG - Intergenic
1188132921 X:26459888-26459910 TTATGGAGCTTAGTAAACGCTGG - Intergenic
1188863754 X:35288803-35288825 TTCTGGCTCTGAGAAAACACAGG - Intergenic
1190186685 X:48241100-48241122 TTCAATAGCTTAGACAACACTGG + Intronic
1190248070 X:48703846-48703868 TTCTGCAGATGAGAAAACTGAGG + Intronic
1190627337 X:52349450-52349472 TTCAGCAGCTTAGATGACAATGG - Intergenic
1193005870 X:76617692-76617714 CTCTGTAGGCTAGAAAACACTGG - Intergenic
1194376824 X:93146182-93146204 TTCTGCAGCTTCAGAAACATGGG - Intergenic
1195669666 X:107459034-107459056 TTCTGGAGCTAAGATAACATTGG + Intergenic
1197722385 X:129754355-129754377 ATGTGGAGCTTTGAAAACACTGG - Intronic
1198478622 X:137019670-137019692 TTTTCCAGCTGAGAAAACAGAGG + Intergenic
1199169148 X:144716209-144716231 GCCTGCTGCTTAGAAAACATAGG - Intergenic
1199412400 X:147539439-147539461 TTCTGCAGGTCAGAAACCAGAGG + Intergenic
1201523134 Y:14899348-14899370 TTCTGCAGCTCAGATAACAGGGG + Intergenic