ID: 1155994356

View in Genome Browser
Species Human (GRCh38)
Location 18:32314001-32314023
Sequence TATACCACATAGAAATATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155994355_1155994356 0 Left 1155994355 18:32313978-32314000 CCTAGACATGAAAGAACAGCTCA 0: 1
1: 0
2: 1
3: 21
4: 246
Right 1155994356 18:32314001-32314023 TATACCACATAGAAATATGTAGG 0: 1
1: 0
2: 1
3: 23
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155994356 Original CRISPR TATACCACATAGAAATATGT AGG Intronic
902834727 1:19039370-19039392 TATACAAAAAATAAATATGTAGG - Intergenic
905713853 1:40131382-40131404 TATATTACTTAGAAATATGAAGG - Intergenic
906365937 1:45209703-45209725 TTAACCAGACAGAAATATGTAGG + Intronic
906564821 1:46791408-46791430 TATATCACATAGAAATACTTTGG + Intronic
907180356 1:52564272-52564294 TATACCAAATAGCACTATGGTGG - Intergenic
908207394 1:61865057-61865079 CATAACACAGAGAAAAATGTGGG - Intronic
908491987 1:64654184-64654206 GATACCAAATTGAAAAATGTTGG + Intronic
909310215 1:74137254-74137276 TATAGTATATAGAAAGATGTTGG - Intronic
910116593 1:83738592-83738614 TATACATCACACAAATATGTTGG - Intergenic
911075837 1:93874049-93874071 TATACCACACAGAAACATCTAGG - Intronic
911796075 1:102077741-102077763 TATAACACATAAAAATTTGAGGG - Intergenic
913555732 1:119965228-119965250 GATACCAAATGGAAATATCTGGG + Intronic
916320704 1:163500334-163500356 TATAGCATATACAAATTTGTAGG - Intergenic
918565961 1:185932242-185932264 TATACTACTTAGAAATAGCTTGG + Intronic
919070218 1:192745982-192746004 TTTGCCTCATAGAAATATATAGG + Intergenic
919715100 1:200768236-200768258 TTTACCACATAGAGAAATGAAGG + Intronic
920996163 1:210994422-210994444 TATACAACATAAAAATATTTTGG + Intronic
921285907 1:213609172-213609194 TATACCACGTATAAATGTCTAGG + Intergenic
923953080 1:238982745-238982767 TATACCACCTAGAAGTTTATAGG + Intergenic
923981058 1:239324506-239324528 TACAAGACATAGAAATATTTTGG + Intergenic
923989374 1:239418447-239418469 CATACCACATACACAGATGTTGG - Intronic
924265584 1:242278444-242278466 GATTTCCCATAGAAATATGTTGG + Intronic
924926108 1:248682653-248682675 TATACTAAATAAAAATTTGTGGG + Intergenic
1063231862 10:4073171-4073193 AAGACCACATAAAAATATGTAGG + Intergenic
1063836061 10:10014095-10014117 TCTATCACATAAAATTATGTAGG + Intergenic
1064511234 10:16094438-16094460 TACAACACATTAAAATATGTGGG + Intergenic
1065283805 10:24167776-24167798 TATGCCACAGAGAAATTTATTGG + Intronic
1066719242 10:38320022-38320044 GATTTCCCATAGAAATATGTTGG - Intergenic
1067006068 10:42664878-42664900 CTTACTACATACAAATATGTTGG - Intergenic
1068510649 10:57961608-57961630 CTTACCACATAGAATTATGTAGG + Intergenic
1070995178 10:80772436-80772458 TATCCCATATAGAAAAATTTTGG + Intergenic
1073173702 10:101536354-101536376 TAACTCACACAGAAATATGTAGG - Intronic
1073595211 10:104792762-104792784 TATACAACCTACAAAAATGTAGG - Intronic
1076985088 11:230267-230289 AAGACAATATAGAAATATGTAGG - Intronic
1077345249 11:2045453-2045475 TATACCAAATAGAAAAATGGAGG - Intergenic
1078112935 11:8414094-8414116 TATACAACATCCAAATATCTAGG + Intronic
1082658350 11:55878610-55878632 TAAAAAACATAGAAGTATGTAGG - Intergenic
1083154942 11:60816730-60816752 TATAACATATACAAATCTGTGGG + Intergenic
1085171302 11:74452063-74452085 AATACCAAATAGAACTAAGTAGG - Intergenic
1086016631 11:82175713-82175735 TATACCACTGTGAAGTATGTTGG - Intergenic
1086019875 11:82214933-82214955 TGTAGCACTTAGAAATATTTTGG + Intergenic
1086279042 11:85164292-85164314 TATGCCACAGAGGAATATTTGGG + Intronic
1086768693 11:90732639-90732661 TATGTCACATAGACAAATGTCGG + Intergenic
1089888165 11:121850445-121850467 TATAACACATTAAAATATGGGGG - Intergenic
1090846030 11:130530763-130530785 TATAACAAATAGAAATGTATTGG + Intergenic
1091223312 11:133943649-133943671 TTTACCACATAGTAAAATGCAGG - Intronic
1092067895 12:5607282-5607304 TATGCCACACAGTAAAATGTTGG + Intronic
1094332208 12:29306209-29306231 TCAACTACATAGAAATATCTAGG - Intronic
1095746326 12:45662835-45662857 TATCCCCCATAGTAATATATAGG + Intergenic
1095868659 12:47001838-47001860 TATTTCACAGAGAAATTTGTTGG - Intergenic
1096014209 12:48253123-48253145 TATACCACATATATATCTGGAGG + Intergenic
1097365902 12:58712148-58712170 TATACCACATAAACTTTTGTGGG - Intronic
1097552586 12:61094074-61094096 GCTACCAAACAGAAATATGTAGG - Intergenic
1097919932 12:65060887-65060909 TTTACCACATCAAAAAATGTGGG - Intronic
1099612896 12:84897391-84897413 TATACCAATTAGAAGTTTGTTGG - Intronic
1100932487 12:99626042-99626064 TACACCTCATAGAAAGATTTAGG - Intronic
1100954216 12:99888574-99888596 TGCACTGCATAGAAATATGTAGG + Intronic
1101269402 12:103127855-103127877 TAAACCACATAAAAATATAAAGG - Intergenic
1101817525 12:108157102-108157124 GAAACCACAGAGAAATATCTGGG - Intronic
1107839535 13:44441606-44441628 TATATTACATAGAAATGTGGAGG + Intronic
1108448532 13:50535219-50535241 TATATGACATAGAAAAATTTTGG + Intronic
1108545951 13:51493697-51493719 TATACAACATAGAAGTCTTTTGG - Intergenic
1110783546 13:79495553-79495575 TACACCACACAAAAATATTTAGG - Intronic
1110922059 13:81101232-81101254 AATACCACAGCGAAAAATGTTGG + Intergenic
1111127637 13:83931870-83931892 AATACCACCTAGAAATATAAAGG - Intergenic
1111271108 13:85886922-85886944 TAAACCACATAGAAGCAAGTGGG - Intergenic
1111490590 13:88968957-88968979 TAAACCCAATAGAGATATGTAGG + Intergenic
1111795353 13:92912195-92912217 TATACTACATAGTTATTTGTGGG - Intergenic
1113112920 13:106843654-106843676 TAAATCACATAAAAATATGAAGG + Intergenic
1113519394 13:110928723-110928745 TAAAACACATAGAAATACATTGG - Intergenic
1114037522 14:18644037-18644059 TAAACTACATAGAAATATCAAGG - Intergenic
1114121110 14:19671010-19671032 TAAACTACATAGAAATATCAAGG + Intergenic
1115121944 14:29947474-29947496 TATAACATATAAAAATTTGTGGG + Intronic
1115136968 14:30121812-30121834 TATATTACATATAAATATATTGG - Intronic
1116676905 14:47918449-47918471 TATACCATATATATATATGGTGG - Intergenic
1116706082 14:48303083-48303105 TATACCAAATGGCAAAATGTGGG + Intergenic
1116786668 14:49295775-49295797 TTTTCCTCATAGAAATAAGTTGG + Intergenic
1117649545 14:57888887-57888909 TATACCAAATATAAATAATTTGG + Intronic
1118351172 14:64973025-64973047 TATACCACAGAGAAATTTAGGGG - Intronic
1118691129 14:68341209-68341231 AATACATCATAGAAATATGAAGG + Intronic
1119467338 14:74869125-74869147 TAGTCCCCAAAGAAATATGTAGG - Intronic
1120603094 14:86537126-86537148 TATAACACATACATATATGATGG - Intergenic
1121918828 14:97861397-97861419 TATACCAGATAAAAATACCTTGG - Intergenic
1202914303 14_GL000194v1_random:150846-150868 TATACTATATCAAAATATGTGGG - Intergenic
1123954327 15:25318586-25318608 TATACCACATAACAAAATGGAGG - Intergenic
1126422834 15:48493006-48493028 TATCCCACCAAGGAATATGTGGG + Intronic
1126801179 15:52297979-52298001 TATACAAAATAGAATTATTTGGG - Intergenic
1131759672 15:95608010-95608032 CTAACCACACAGAAATATGTAGG + Intergenic
1132305061 15:100805635-100805657 TATAACATATAAAAATTTGTGGG + Intergenic
1133332489 16:4983316-4983338 TATTCCATATATAAATATATGGG - Intronic
1134863948 16:17587958-17587980 TATACCATTTAGAAGTATTTGGG + Intergenic
1137867149 16:51911110-51911132 TTTACGACCTAAAAATATGTTGG + Intergenic
1138808176 16:60117764-60117786 CATAGCATATAAAAATATGTAGG - Intergenic
1139018297 16:62716805-62716827 TCTACCACTTATAATTATGTTGG + Intergenic
1139041455 16:63003929-63003951 CATCCAGCATAGAAATATGTAGG + Intergenic
1140607251 16:76553735-76553757 TAAACCACAGAGAATTATGGAGG - Intronic
1144995629 17:19266194-19266216 TATGCCACTTAAAATTATGTTGG - Intronic
1146550043 17:33772596-33772618 TATACCACATATGTATATATAGG - Intronic
1149153834 17:53602128-53602150 TATACCACATATATATATGATGG - Intergenic
1153908870 18:9688789-9688811 TATACCACATAGTACTATCTAGG - Intergenic
1154056616 18:11018809-11018831 TATACCTCAAAAAGATATGTGGG - Intronic
1155456227 18:26017223-26017245 TATAACACAAAGAGATATTTAGG - Exonic
1155581888 18:27318173-27318195 TATGCCACATAACAACATGTTGG - Intergenic
1155806607 18:30178058-30178080 TATACCACATTAACATCTGTTGG - Intergenic
1155994356 18:32314001-32314023 TATACCACATAGAAATATGTAGG + Intronic
1156857213 18:41795744-41795766 TCTACCATTTAGAAATATGAAGG + Intergenic
1157135989 18:45056172-45056194 TATACCACATAGAGTTCTGTTGG - Intronic
1158710518 18:59833373-59833395 TATAAAAAATAGAAATATGCGGG - Intergenic
1158934279 18:62350204-62350226 TAAACCACACAAAAATAGGTGGG - Intronic
1159297113 18:66506803-66506825 TATCACAAAGAGAAATATGTTGG + Intronic
1159399348 18:67910967-67910989 TATACCACATTGAAAAATGGCGG + Intergenic
1162004629 19:7769516-7769538 TATAGGACAAAGAAAGATGTGGG - Exonic
1167956111 19:53065377-53065399 TATACTGAATAGCAATATGTTGG + Intergenic
924998185 2:383076-383098 TATGGCACATAGATATATATGGG + Intergenic
925198134 2:1944356-1944378 TATACTACAAAAAAATAGGTGGG + Intronic
925377382 2:3397689-3397711 TAAACCACAAAGGATTATGTAGG + Intronic
925711231 2:6742888-6742910 AATAACACGTAGACATATGTGGG - Intergenic
927748867 2:25648224-25648246 TATATTACATAGAAATAAATGGG - Intronic
930406813 2:50968904-50968926 TAAACCAGATAGAAATTTATCGG - Intronic
930583047 2:53235327-53235349 TATATCAGATAGAAATGAGTTGG - Intergenic
931071796 2:58659893-58659915 TGTACAACATAGAATTCTGTAGG - Intergenic
931617129 2:64171019-64171041 TACACCACATAACAATATTTTGG + Intergenic
931988319 2:67762771-67762793 TATACCACTGAGACATAAGTAGG + Intergenic
932597586 2:73103698-73103720 CAAACCACACAGAAAGATGTGGG + Intronic
933131511 2:78678346-78678368 TATGCCATATAGAAATATCAAGG - Intergenic
935106446 2:100049165-100049187 TATAGCACAGAGAAATCTGGTGG + Intronic
935132538 2:100271334-100271356 CCCACCACAGAGAAATATGTTGG + Intergenic
937725567 2:125161056-125161078 TATACTGCATAGCAATATTTTGG + Intergenic
937978819 2:127599350-127599372 GCTAGCAAATAGAAATATGTTGG + Intronic
938273455 2:129995001-129995023 TAAACTACATAGAAATATCAAGG + Intergenic
938277772 2:130042253-130042275 TAAACTACATAGAAATATCAAGG + Intergenic
938328738 2:130433057-130433079 TAAACTACATAGAAATATCAAGG + Intergenic
938361207 2:130688435-130688457 TAAACTACATAGAAATATCAAGG - Intergenic
938437611 2:131295124-131295146 TAAACTACATAGAAATATCAAGG - Intronic
939111201 2:138009575-138009597 CATACCCAATAGAAATATATTGG + Intronic
939777006 2:146400601-146400623 CATATCACCTAGAAATATGATGG + Intergenic
941728431 2:168889583-168889605 TATACCCGATTGGAATATGTGGG - Intronic
942156961 2:173139860-173139882 AATATAACATGGAAATATGTGGG - Intronic
942392819 2:175513747-175513769 AATAGCACATAGAAACTTGTTGG - Intergenic
942700854 2:178708269-178708291 AAAATCACATATAAATATGTGGG - Intronic
942933899 2:181530826-181530848 TATCCCATATATAAACATGTTGG + Intronic
944703662 2:202267202-202267224 TATTCTACATATATATATGTTGG + Intronic
946435849 2:219652809-219652831 TATAGCACATCAAAATTTGTGGG + Intergenic
946791591 2:223306077-223306099 TATACCAAATATAAATTAGTAGG - Intergenic
947344867 2:229180258-229180280 TATAACACTTAAAATTATGTAGG - Intronic
1169401842 20:5288590-5288612 CATACCACATATATATATGATGG + Intergenic
1171072235 20:22082845-22082867 TATATCACATAGGTATATATAGG + Intergenic
1172463594 20:35138234-35138256 TTAACACCATAGAAATATGTGGG - Intronic
1172899281 20:38322315-38322337 TGTATCACTTAGATATATGTGGG - Intronic
1174496890 20:50951902-50951924 CATACCAAATAGAAATAGTTTGG - Intronic
1174987974 20:55476640-55476662 TAAACCTGATAGAAATATTTTGG - Intergenic
1175435012 20:58940036-58940058 TCTACCACACAGAAATTTGAAGG - Intergenic
1176633658 21:9165521-9165543 TATACTATATCAAAATATGTGGG - Intergenic
1177342464 21:19823016-19823038 AATACCATAGACAAATATGTAGG + Intergenic
1177383257 21:20373124-20373146 TTTACAGCATGGAAATATGTGGG - Intergenic
1180461650 22:15571079-15571101 TAAACTACATAGAAATATCAAGG - Intergenic
1182171094 22:28230324-28230346 TATTCCACAGAGAGATCTGTTGG + Intronic
949444225 3:4116086-4116108 TCTACCTCATAAACATATGTGGG - Intronic
951178629 3:19632338-19632360 TCTACCAGGTATAAATATGTAGG + Intergenic
952097417 3:29970002-29970024 TATAGAAAATAAAAATATGTAGG - Intronic
952555629 3:34526975-34526997 TATAGAAAATAGAAATAAGTGGG - Intergenic
952682169 3:36106245-36106267 TATACATCATACAAATATATAGG - Intergenic
954544097 3:51417920-51417942 TATACCTCATAAAAGTATCTAGG + Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
957207842 3:77220857-77220879 TATACAACATAGCAATACTTAGG - Intronic
957460459 3:80511655-80511677 TATGCCACATAACAATATTTCGG + Intergenic
957478730 3:80761889-80761911 TAGACAACAAAGGAATATGTCGG + Intergenic
957970689 3:87378129-87378151 TATACGACATTAAAATATCTTGG + Intergenic
959753597 3:109868905-109868927 TATAGCTCAAAGACATATGTAGG + Intergenic
960140352 3:114146378-114146400 TAAACCACATAGTAACATGATGG - Intronic
960413143 3:117352504-117352526 AAAACCAAAAAGAAATATGTTGG + Intergenic
960860317 3:122146059-122146081 TATACCAAAATGAAAAATGTTGG - Intergenic
960860546 3:122148256-122148278 TCTACCACAAAGAAAAATGAGGG + Intergenic
963114615 3:141716161-141716183 TATAACATATCGAAATTTGTAGG - Intergenic
970630658 4:17939919-17939941 TATAGTACATATACATATGTAGG - Intronic
971540389 4:27808925-27808947 TATACTAAGTAGAAATATCTAGG + Intergenic
972114625 4:35615577-35615599 TATACCACCGAGATCTATGTTGG + Intergenic
972454847 4:39243976-39243998 TATACCAAAAAGACATATGAGGG + Intronic
972547467 4:40094043-40094065 TATACCATATCAAAATTTGTAGG - Intronic
974995550 4:69154516-69154538 TATACTACATAGAAGTATAGAGG - Intronic
975438665 4:74384244-74384266 TATAGCACTTAGAAAATTGTAGG + Intronic
977481767 4:97587349-97587371 TATAACACAAAGAAACCTGTTGG - Intronic
978606959 4:110491301-110491323 GATAATACATAGAAAAATGTAGG + Intronic
980813898 4:137918261-137918283 TATATCACTTAGGAAAATGTGGG + Intergenic
981757074 4:148152231-148152253 AATTCCACATAATAATATGTGGG - Intronic
982400443 4:154961263-154961285 CATAGCACATAAAAACATGTTGG + Intergenic
982501070 4:156155719-156155741 GAAATCAAATAGAAATATGTGGG + Intergenic
983197636 4:164825275-164825297 ACTACTACATAGAAATATGTGGG + Intergenic
983370786 4:166855466-166855488 TGTACTACATGGAAAAATGTTGG - Intronic
983519631 4:168694166-168694188 TAAACTATATAGAAGTATGTAGG + Intronic
984162283 4:176267904-176267926 CATCCCACATTGAAAAATGTAGG + Intronic
984566965 4:181342826-181342848 TATACCACAATGACATATTTGGG + Intergenic
984732790 4:183083986-183084008 TGTATCATTTAGAAATATGTGGG + Intergenic
985180836 4:187260099-187260121 TATCCCAAATATGAATATGTAGG + Intergenic
985331129 4:188835947-188835969 TATACCAGAGTGAAATTTGTGGG + Intergenic
986859740 5:11912451-11912473 TCTACAACCTAGAAATATGCGGG + Intergenic
987511288 5:18843398-18843420 AATAACACATTGAAAAATGTAGG + Intergenic
987795345 5:22620842-22620864 TTTATCACCTAGAAATATTTTGG - Intronic
988255932 5:28820070-28820092 TTTAACACATAGAAATCAGTGGG - Intergenic
988332720 5:29863547-29863569 AATACCCCATGGAAATTTGTTGG + Intergenic
988613897 5:32754782-32754804 TATTCCACATAGAGATATCTGGG - Intronic
989219945 5:38946821-38946843 TATACCATCTAGAGATCTGTGGG + Intronic
989990918 5:50764900-50764922 TATATCCCATAGACATATTTTGG - Intronic
990436537 5:55797715-55797737 TAGATCACATAGAAATATAGGGG - Intronic
990486451 5:56263805-56263827 AGTACCACATACATATATGTAGG + Intergenic
990898182 5:60722303-60722325 TATACCATATATATATATATGGG - Intergenic
991143724 5:63276840-63276862 CAAACCACATAAAAATATATAGG - Intergenic
992059037 5:73023738-73023760 TTTAACACACAGAAATATGTTGG + Intronic
995419034 5:111941884-111941906 TATAACACATAGACATGTCTAGG - Intronic
996803505 5:127429364-127429386 TATACAACCTATAAATATGTTGG + Intronic
996808590 5:127487320-127487342 TTTACCAAATAGAAATTTGAAGG - Intergenic
997274200 5:132569933-132569955 TATAGCATGTAAAAATATGTGGG + Intronic
997489995 5:134266656-134266678 TATATGAAATATAAATATGTAGG + Intergenic
1000492385 5:161930337-161930359 TATACCTCATATAAGTATATGGG - Intergenic
1000800003 5:165714030-165714052 AAAACCACATTAAAATATGTTGG + Intergenic
1003232152 6:4264111-4264133 TATACAACATAGTATTATGCAGG + Intergenic
1004937469 6:20521811-20521833 TATATCAAATAGACATTTGTTGG - Intergenic
1007268581 6:40617709-40617731 TACACCACATCAAAATCTGTGGG - Intergenic
1007907257 6:45474349-45474371 TATAAAACATAAAAATATGGTGG - Intronic
1009303679 6:62060806-62060828 TATACTAAGTAGAAAAATGTGGG + Intronic
1009638319 6:66296046-66296068 TCTTCAACATAGAAATTTGTGGG + Intergenic
1009954623 6:70438487-70438509 TATGCAACATAGATATATGCTGG - Intronic
1010643282 6:78356812-78356834 TAGACCACATAGAAATGTGTGGG + Intergenic
1011329267 6:86185481-86185503 TACACAACATAGAAAGATGCTGG - Intergenic
1011419948 6:87160772-87160794 GATGGCACTTAGAAATATGTGGG + Intronic
1012113871 6:95268657-95268679 TATATCATATAGAAATGTGTAGG - Intergenic
1012135811 6:95554379-95554401 ATTACCAAATAGAAATTTGTGGG - Intergenic
1012919264 6:105204230-105204252 TCTACCACAAAGAAAAATCTAGG + Intergenic
1014024166 6:116625669-116625691 TCTAGCACATAAAAATTTGTTGG - Intronic
1015065669 6:129023686-129023708 TAAACCAGATAGAAACATGGCGG - Intronic
1015854962 6:137614165-137614187 TACTCCACATAGTAGTATGTGGG - Intergenic
1016540817 6:145161821-145161843 TATTATACATGGAAATATGTTGG + Intergenic
1017238949 6:152146263-152146285 TAGTTCACATAGAAATATATGGG - Intronic
1017858730 6:158375774-158375796 TATATAATACAGAAATATGTAGG + Intronic
1018269764 6:162064606-162064628 CAAAGCACATAGATATATGTAGG - Intronic
1021659194 7:22902240-22902262 TAGAACACATAAAAATATATGGG + Intergenic
1022746467 7:33177896-33177918 TAGACCATATAAAAATATGCTGG - Intronic
1023787207 7:43719719-43719741 AATACTATATTGAAATATGTGGG - Intronic
1024486432 7:49925503-49925525 AATCCCACATAGACATATGGAGG - Intronic
1024509839 7:50195417-50195439 TACAACACATTGAAGTATGTGGG + Intergenic
1027953146 7:84845764-84845786 TTTACCCCACAGAAATATGGTGG + Intergenic
1028500845 7:91517650-91517672 TTAACCACATGGAAATGTGTAGG + Intergenic
1033182145 7:139190763-139190785 TATAAAACATAGAAAGATGTGGG - Exonic
1033311018 7:140261909-140261931 GATACCACATAAGAATATATGGG + Intergenic
1033576719 7:142692322-142692344 TGTCCCACATAGAATTTTGTAGG + Intergenic
1034212498 7:149376245-149376267 TATACCACAAAGAAAGCTATAGG - Intergenic
1034738297 7:153449404-153449426 TAAATCAAATAAAAATATGTGGG + Intergenic
1034952141 7:155305879-155305901 AATACCACATAGAAAAAGCTAGG - Intronic
1042867312 8:73367312-73367334 TATGTCACATACAATTATGTTGG + Intergenic
1042884361 8:73531424-73531446 TAAACCAGATAAAAATATGTAGG + Intronic
1043222895 8:77688832-77688854 TATACCAAATAGCTATATTTTGG - Intergenic
1045133180 8:99181172-99181194 CATACCAGTTAGCAATATGTAGG + Intronic
1045400846 8:101816226-101816248 TATACCACAGTGAAATATTTTGG - Intronic
1045848762 8:106668441-106668463 TATTCCACATAGACACATGTGGG - Intronic
1046129033 8:109944688-109944710 TATTCCATGCAGAAATATGTAGG + Intergenic
1046587170 8:116161592-116161614 TATACCACATAAAAAGATTTTGG + Intergenic
1048034873 8:130667951-130667973 GAAATCACATAGAAATATGGAGG + Intergenic
1051969723 9:22873720-22873742 TATACCATAAACAAATATCTGGG + Intergenic
1052051640 9:23855176-23855198 TATACCACATAGGAAGAAGCAGG - Intergenic
1052508701 9:29386421-29386443 TCTTCCAAATAGAAATATCTGGG - Intergenic
1052761119 9:32592344-32592366 AAAAACACATAAAAATATGTGGG + Intergenic
1052789483 9:32861553-32861575 TCTATCACATAGGAATCTGTAGG - Intergenic
1052793395 9:32899573-32899595 AAGGCCACTTAGAAATATGTGGG + Intergenic
1052890217 9:33692234-33692256 TGTCCCACATAGAATTCTGTAGG + Intergenic
1057613810 9:96570272-96570294 CATAAAACATAGAAATATGTAGG + Intronic
1058560049 9:106218280-106218302 TAAACTACATAGAAATAACTGGG + Intergenic
1058777231 9:108296065-108296087 TATGCCACAGAGAAATATAGAGG - Intergenic
1058933174 9:109742679-109742701 TATACCACATAAACCTATGCTGG + Intronic
1059557344 9:115294538-115294560 CAGACCCCATAGAAATAGGTGGG - Intronic
1059659965 9:116390959-116390981 CCTACCACACAGAAGTATGTTGG - Intronic
1060099979 9:120831598-120831620 TATCCCCCATAGAATTATGATGG + Intronic
1203756497 Un_GL000218v1:133150-133172 TATACTATATCAAAATATGTGGG - Intergenic
1203417857 Un_KI270362v1:1311-1333 AATATCACAAAGAAATTTGTGGG + Intergenic
1185982424 X:4794316-4794338 TATAGCACGTAGAAATCTGCAGG + Intergenic
1187444726 X:19351194-19351216 TAGACCACAGTGAAATATGTGGG - Intronic
1187779446 X:22802059-22802081 TATAGCACATAGAAATACAATGG + Intergenic
1188862947 X:35279136-35279158 TATACCCCATACATATATATAGG + Intergenic
1189132307 X:38512787-38512809 TATAGCACATACAATTATGTAGG - Intronic
1189649637 X:43175735-43175757 TATAGCAAATAGAAATGTATTGG + Intergenic
1189925064 X:45944623-45944645 GATACAACATATAAATCTGTGGG - Intergenic
1190550472 X:51574708-51574730 TGATCCACACAGAAATATGTTGG - Intergenic
1190690355 X:52908529-52908551 AATACCAAATAAATATATGTAGG + Exonic
1190695628 X:52947263-52947285 AATACCAAATAAATATATGTAGG - Exonic
1191698101 X:64010025-64010047 TATACCTAATGGATATATGTTGG - Intergenic
1194628023 X:96248602-96248624 TATACCTCATACCAATATTTTGG + Intergenic
1194878303 X:99218295-99218317 TATAAGAAATAGAAATTTGTTGG + Intergenic
1195478123 X:105310629-105310651 TACAGCACATAAAAATTTGTGGG - Intronic
1198589838 X:138165678-138165700 TATAACATATATATATATGTTGG - Intergenic
1199037377 X:143068189-143068211 TTTGCCACATTGAAATATGGTGG + Intergenic
1200903937 Y:8461992-8462014 TATATCACAAATTAATATGTGGG - Intergenic
1202255310 Y:22914489-22914511 TATATCACAAATTAATATGTGGG - Intergenic
1202408301 Y:24548238-24548260 TATATCACAAATTAATATGTGGG - Intergenic
1202462481 Y:25121842-25121864 TATATCACAAATTAATATGTGGG + Intergenic