ID: 1155994960

View in Genome Browser
Species Human (GRCh38)
Location 18:32321436-32321458
Sequence GATAGAGGAGTTCCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155994960_1155994964 -8 Left 1155994960 18:32321436-32321458 CCTCCTGGGGGAACTCCTCTATC 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1155994964 18:32321451-32321473 CCTCTATCATCCTGGCTCCAAGG 0: 1
1: 0
2: 4
3: 17
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155994960 Original CRISPR GATAGAGGAGTTCCCCCAGG AGG (reversed) Intronic
901595809 1:10384542-10384564 GAGAGAGGAGTCCAGCCAGGAGG + Intergenic
903460520 1:23517407-23517429 GTTAGAGGAGGTATCCCAGGTGG - Intronic
908769722 1:67585028-67585050 GAGTGGGGATTTCCCCCAGGAGG + Intergenic
909724371 1:78816204-78816226 GAAAGTGGAGTTCCGCCAAGTGG - Intergenic
911936530 1:103982288-103982310 GTTAGAGCAGTGTCCCCAGGGGG + Intergenic
915297212 1:154929764-154929786 GAGAAAGGAGTTCCCCAGGGTGG - Intronic
916159207 1:161891491-161891513 GATAGTGAAGTACCCCCAAGTGG + Intronic
916435131 1:164771005-164771027 GGTAGAGGAGGCCTCCCAGGAGG - Intronic
917534407 1:175863967-175863989 GATAGAGGAGTCGCTCGAGGAGG + Intergenic
918269828 1:182887273-182887295 TATAGAGGAGTTTCCCGAGGTGG + Exonic
920150881 1:203906412-203906434 GATAGATGAGTTCCTCCAAAGGG + Intergenic
922864936 1:228851976-228851998 GAGAGATGAGCTCCTCCAGGAGG + Intergenic
1065298080 10:24295664-24295686 GAGGGAGAAGTTCCACCAGGAGG - Intronic
1069836807 10:71314456-71314478 GATAGAGAAGTTCCACGAGATGG + Intergenic
1074112428 10:110431984-110432006 GATGGAGGGATTCCCACAGGAGG + Intergenic
1075025498 10:118980419-118980441 GGTAGACGAGTTCCACCAGGAGG + Intergenic
1075889016 10:125929429-125929451 TTAAGAGAAGTTCCCCCAGGAGG - Intronic
1079413405 11:20210508-20210530 GCTGGAGGAGTGCACCCAGGAGG - Intergenic
1080779799 11:35419565-35419587 GTTAAAGGAGTTGCCCGAGGCGG - Intronic
1083717530 11:64586417-64586439 GAAGAAGGGGTTCCCCCAGGAGG - Intergenic
1086794886 11:91088067-91088089 AATAGAGGAGGTCCCTGAGGAGG + Intergenic
1091413383 12:258743-258765 GATAGCAGAGTTACCCCAGGGGG + Intronic
1091793917 12:3286680-3286702 GAGAGATGAGGTCCCCCTGGGGG - Intergenic
1099997704 12:89796839-89796861 GATAGAATGGTTCTCCCAGGTGG + Intergenic
1102425142 12:112838218-112838240 GACAGAGGAGTTCCCAGTGGGGG + Intronic
1107013857 13:35693774-35693796 AAGAGTGGATTTCCCCCAGGAGG - Intergenic
1110885361 13:80626713-80626735 GCCAAAGGAGTTCCCCCAGAAGG - Intergenic
1113301364 13:109025240-109025262 GATAGGCGAGTCCCTCCAGGTGG - Intronic
1118136796 14:63037510-63037532 AATAGAGGAGTTCCTCAATGGGG - Intronic
1119479480 14:74950681-74950703 GATAGATCAGTTTCCTCAGGTGG + Intronic
1123056582 14:105573848-105573870 CATAGAGGAGACCCCCAAGGCGG - Intergenic
1130470275 15:84219845-84219867 GAAAGAGGATTTCCCTCATGAGG - Intergenic
1130477763 15:84334412-84334434 GAAAGAGGATTTCCCTCATGAGG - Intergenic
1130494002 15:84453718-84453740 GAAAGAGGATTTCCCTCATGAGG + Intergenic
1130592564 15:85224473-85224495 GAAAGAGGATTTCCCTCATGAGG - Intergenic
1130825866 15:87545940-87545962 AATAGAGAATTTCCCCCAGCAGG + Intergenic
1132495190 16:259827-259849 GATACAGGAGATCCACCTGGCGG + Intronic
1132576887 16:668390-668412 GGGCGAGGAGTTCCCCGAGGAGG + Exonic
1136683956 16:31983408-31983430 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136784582 16:32926960-32926982 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136885201 16:33926846-33926868 CATGGAGGAGGTGCCCCAGGAGG + Intergenic
1140723346 16:77789781-77789803 CCTGGAGAAGTTCCCCCAGGGGG - Intronic
1203087241 16_KI270728v1_random:1190966-1190988 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1142552116 17:747265-747287 GACAGAGGACGACCCCCAGGAGG - Exonic
1143340438 17:6206832-6206854 GATAGAAGGGATCCTCCAGGAGG - Intergenic
1145841892 17:28002037-28002059 GATGGAGGAGCTGACCCAGGAGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147144881 17:38479111-38479133 CATGGAGGAGGTGCCCCAGGAGG - Intronic
1147678661 17:42224945-42224967 GATTCAGGAGGTCCCTCAGGAGG - Intronic
1148340090 17:46868118-46868140 GATAGAGTGGTGGCCCCAGGAGG + Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1152590288 17:81208397-81208419 GCTAGAGGATGTCCCCCCGGAGG + Intronic
1152881967 17:82822854-82822876 GATTGATGAGTTCACACAGGAGG + Intronic
1155994960 18:32321436-32321458 GATAGAGGAGTTCCCCCAGGAGG - Intronic
1156317770 18:35986815-35986837 TATAGAGGAATTTGCCCAGGTGG + Intronic
1156460511 18:37319029-37319051 CGGAGAGGAGATCCCCCAGGCGG - Intronic
1162102434 19:8347786-8347808 GTTTAAGGAGTTCCTCCAGGGGG + Intronic
1168465511 19:56598194-56598216 GGTAGAGGACTTCTCCAAGGAGG + Intronic
927973674 2:27322164-27322186 GATAAAGGCATTGCCCCAGGAGG - Intronic
932143165 2:69297227-69297249 GATACACGAGTTCCACCAGAAGG + Intergenic
933983898 2:87574957-87574979 GATAGCAGAGTTCCCACTGGAGG - Intergenic
935007142 2:99089799-99089821 GATAGAGGAAGACCCTCAGGTGG - Intronic
936309957 2:111375837-111375859 GATAGCAGAGTTCCCACTGGAGG + Intergenic
938124957 2:128664737-128664759 GACAGAGGAGTGCACACAGGAGG + Intergenic
938307322 2:130264835-130264857 GACAGAGGGGATCCCCAAGGTGG + Intergenic
942067378 2:172284404-172284426 GACTGAGGAATTTCCCCAGGGGG + Intergenic
944912652 2:204325564-204325586 GACAGAGGATATCCCCTAGGGGG + Intergenic
946302739 2:218834048-218834070 GATAGAAGGGTACCCCTAGGAGG + Intergenic
947026453 2:225743148-225743170 AATAGAGGAGATAACCCAGGTGG - Intergenic
947571494 2:231239021-231239043 CATATGGAAGTTCCCCCAGGTGG + Intronic
1169150194 20:3283434-3283456 GTTCTAAGAGTTCCCCCAGGGGG + Intronic
1173753595 20:45495879-45495901 GATAGAGGAAATCCCACATGGGG - Intergenic
1179023289 21:37658344-37658366 GACAGAGAAATTCCCCCACGTGG - Intronic
1180028254 21:45181255-45181277 GATAGAGGTGACCCCTCAGGGGG - Intronic
1180900881 22:19371238-19371260 TAGAGAGGAGTCCCCCCAGGAGG - Intronic
1182349475 22:29691184-29691206 GGGAGTGGAGTCCCCCCAGGAGG - Intronic
1183511222 22:38236175-38236197 GATGGAGGAGTTCCTCCCAGAGG - Intronic
1184910651 22:47531748-47531770 GACAGAGAAGTTCCCACAGGAGG + Intergenic
950287899 3:11759459-11759481 GTTGAAGGAGTTCCCTCAGGAGG - Intergenic
952165171 3:30740093-30740115 GATAGAGGGGCTCCCACAAGGGG + Intronic
953180292 3:40588625-40588647 GTTAGAGGACTGCCCTCAGGTGG - Intergenic
954861037 3:53690591-53690613 GATAGAGAAGATCCCCCCGCAGG - Intronic
955060594 3:55488851-55488873 GAATGAGGAGGTCCCCCATGAGG - Intronic
955175613 3:56611169-56611191 GATAGAGAAGGACCACCAGGTGG + Intronic
960194150 3:114744464-114744486 GATAGAGGGCTTCCGACAGGAGG - Intronic
962607540 3:137045047-137045069 GATAGAGGAATTCCCCGGAGGGG + Intergenic
967769548 3:193319547-193319569 GATAGAGGTGTTGCCCAACGTGG - Intronic
976967679 4:91064794-91064816 AATAGAGCAGTTACCACAGGAGG - Intronic
978590219 4:110316546-110316568 GAAAGAGGAGTTCCTGCAGAGGG + Intergenic
981242938 4:142500280-142500302 GATAGAGTAGCTCCATCAGGTGG + Intronic
981548522 4:145918863-145918885 CATAGAGGATTTGCACCAGGAGG - Intronic
988618075 5:32794371-32794393 GAGATAGGTGTTCCCCCAGTGGG + Intergenic
990902557 5:60768801-60768823 GAGAGAGAAGATCTCCCAGGGGG - Intronic
1004152928 6:13137932-13137954 GATAGAGCAGTTTCCCCTGAAGG + Intronic
1007290200 6:40780034-40780056 GATAAAGGAATTCAGCCAGGAGG - Intergenic
1010351452 6:74879849-74879871 GAGAGAAGAGTTACCCCTGGGGG + Intergenic
1017576538 6:155811249-155811271 GCTGGAGGAGCTCCACCAGGTGG - Intergenic
1019943346 7:4308293-4308315 GATGGAGGCGTTTCCGCAGGTGG - Intergenic
1035141640 7:156768629-156768651 GAAATAGGGTTTCCCCCAGGAGG + Intronic
1037270237 8:17119572-17119594 GATAGAGGTGTTTCCCAAAGTGG + Intronic
1045179575 8:99765622-99765644 GATGCAGAAGTGCCCCCAGGGGG + Intronic
1053350332 9:37409754-37409776 GACAGAAGACTTCCCCCAGGAGG + Intergenic
1057111856 9:92479491-92479513 GAAACAGGAGTTCCTCCTGGTGG + Intronic
1060910288 9:127344297-127344319 GAAAGAGGAGGCCCGCCAGGCGG + Exonic
1188389922 X:29607536-29607558 GAATGAGAAGTGCCCCCAGGAGG - Intronic
1196943189 X:120797964-120797986 GCCAGAGCATTTCCCCCAGGAGG + Intergenic