ID: 1155995048

View in Genome Browser
Species Human (GRCh38)
Location 18:32322186-32322208
Sequence AGCCACTGGCTGAAACTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 348}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155995040_1155995048 22 Left 1155995040 18:32322141-32322163 CCTTGACCTCGCTCTGTTCCTGC 0: 1
1: 0
2: 3
3: 22
4: 395
Right 1155995048 18:32322186-32322208 AGCCACTGGCTGAAACTAAAAGG 0: 1
1: 0
2: 3
3: 26
4: 348
1155995045_1155995048 0 Left 1155995045 18:32322163-32322185 CCCATCTCTGGCTGAGGCTATTT 0: 1
1: 0
2: 1
3: 15
4: 144
Right 1155995048 18:32322186-32322208 AGCCACTGGCTGAAACTAAAAGG 0: 1
1: 0
2: 3
3: 26
4: 348
1155995046_1155995048 -1 Left 1155995046 18:32322164-32322186 CCATCTCTGGCTGAGGCTATTTA 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1155995048 18:32322186-32322208 AGCCACTGGCTGAAACTAAAAGG 0: 1
1: 0
2: 3
3: 26
4: 348
1155995041_1155995048 16 Left 1155995041 18:32322147-32322169 CCTCGCTCTGTTCCTGCCCATCT 0: 1
1: 0
2: 3
3: 66
4: 445
Right 1155995048 18:32322186-32322208 AGCCACTGGCTGAAACTAAAAGG 0: 1
1: 0
2: 3
3: 26
4: 348
1155995044_1155995048 4 Left 1155995044 18:32322159-32322181 CCTGCCCATCTCTGGCTGAGGCT 0: 1
1: 0
2: 3
3: 29
4: 287
Right 1155995048 18:32322186-32322208 AGCCACTGGCTGAAACTAAAAGG 0: 1
1: 0
2: 3
3: 26
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155995048 Original CRISPR AGCCACTGGCTGAAACTAAA AGG Intronic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
906051283 1:42875993-42876015 ACCCATTGGCTCAAAGTAAAGGG - Intergenic
906993809 1:50768070-50768092 ACCCACTGGCTAAAAGTAAAGGG + Intronic
907093344 1:51750824-51750846 AGCCACTTGCTGGAAATAAAGGG - Intronic
907095702 1:51778408-51778430 AGACACTGGTTAAAAGTAAAAGG + Intronic
910513169 1:88028562-88028584 ACCCACAGGCTCAAAGTAAAGGG - Intergenic
910812930 1:91256157-91256179 ACCCACAGGCTCAAAATAAAGGG + Intergenic
912139811 1:106710174-106710196 ACCCACAGGCTCAAAGTAAAAGG - Intergenic
915100681 1:153497126-153497148 AGGCACTGTCTGAAAACAAAGGG - Intergenic
915815959 1:158965010-158965032 ACCCATTGGCTCAAAATAAAAGG + Intronic
915817518 1:158985026-158985048 AGACACAGGCTTAAATTAAATGG - Intergenic
916063042 1:161115011-161115033 ATCCAATGTCTGAAAATAAATGG + Intronic
916677702 1:167077541-167077563 TGCCACTGGCAGAACCTAAATGG + Intronic
917277244 1:173343862-173343884 AGACACTAGCTGAAGCTAACTGG + Intergenic
917529588 1:175822819-175822841 AGCAAATGACTGAAACCAAAGGG + Intergenic
917673404 1:177296220-177296242 ACCCACAGGCTCAAAGTAAAGGG - Intergenic
918380198 1:183946039-183946061 AGCCACTGGCAGGGACAAAATGG + Intronic
918653993 1:187001412-187001434 AGCCACTGACTAAAAGAAAAGGG + Intergenic
918867293 1:189919151-189919173 ACCCACAGGCTGAAGGTAAATGG - Intergenic
919262603 1:195217127-195217149 ACCCACAGGCTCAAAATAAAGGG + Intergenic
919342002 1:196322414-196322436 AAACACAGGCTGAAACTAACCGG + Intronic
924429492 1:243984770-243984792 AGCCACCAGCTGAATCTAGAAGG - Intergenic
1064789257 10:18937414-18937436 AGACACAGGCTAAAAATAAAGGG - Intergenic
1067519874 10:46991296-46991318 ACCCACAGGCTCAAAGTAAAGGG - Intronic
1067642375 10:48060546-48060568 ACCCACAGGCTCAAAGTAAAGGG + Intergenic
1068285423 10:54927804-54927826 ACCCACAGGCTCAAAGTAAATGG - Intronic
1068832943 10:61518829-61518851 ACCCACAGGCTCAAAGTAAAGGG - Intergenic
1069805699 10:71123070-71123092 AGCCATAGGCTCAAAATAAAGGG - Intergenic
1069978693 10:72237038-72237060 AGCCACAGGCTGCAGGTAAATGG - Intergenic
1071022895 10:81080328-81080350 ACCCACAGGCTCAAAGTAAAGGG - Intergenic
1071611564 10:87036602-87036624 ACCCACTGGATCAAAATAAAGGG - Intergenic
1072831834 10:98666057-98666079 ATCCACAGGCTCAAAGTAAAGGG + Intronic
1073911301 10:108348135-108348157 TACCACTGGATGATACTAAAAGG + Intergenic
1074013973 10:109514236-109514258 ATCCACGGGCTTAAAATAAAAGG - Intergenic
1074924566 10:118054653-118054675 AGCTACTGCCTGAAACTAGGCGG - Intergenic
1077349446 11:2085695-2085717 AGCCCCTGGATGAAATTACATGG - Intergenic
1077382862 11:2253810-2253832 AGCCAATAGTGGAAACTAAATGG + Intergenic
1077892143 11:6426660-6426682 AGGCACTGCCAGAAACAAAAGGG - Intergenic
1078031530 11:7756720-7756742 AGAAAGTGGGTGAAACTAAAAGG - Intergenic
1078889716 11:15543585-15543607 AGGTACTGGCTGACACTAAAGGG + Intergenic
1079976332 11:27096086-27096108 AACCTCTGGCTGAAAGGAAAGGG + Intronic
1080208122 11:29754858-29754880 TTCCACTGGCTGAACCTAACAGG + Intergenic
1081181070 11:39986313-39986335 AGACAAAGGCTGAAAATAAAGGG + Intergenic
1082694190 11:56339364-56339386 ACCCACAGGCTCAAAGTAAAGGG + Intergenic
1083567309 11:63730289-63730311 AGACACAGGTTGAAAGTAAATGG + Intronic
1085812985 11:79702564-79702586 ACCCACAGGCTCAAAATAAAGGG + Intergenic
1087791921 11:102414971-102414993 ACCCACGGGCTCAAAATAAAGGG + Intronic
1089808594 11:121113696-121113718 AGCCAATGGCTGCACCTCAAGGG + Exonic
1089819796 11:121213980-121214002 ACCCACAGGCTCAAAGTAAAGGG + Intergenic
1089993955 11:122887123-122887145 AGCCACTATCTGAACCCAAATGG - Intronic
1091572265 12:1697962-1697984 AGCCACTGGCTGACATTAAAGGG - Intronic
1092512606 12:9172609-9172631 AGACACAGGCTCAAAATAAAGGG + Intronic
1092765443 12:11848985-11849007 AGCTAATGGCTGAAATTCAAAGG - Intronic
1093323250 12:17740272-17740294 AGCCACTAGCTGGCACTAAGAGG + Intergenic
1095129612 12:38523638-38523660 GGCCACTGGTTGAATGTAAATGG + Intergenic
1095571438 12:43686734-43686756 ACCCACAGGATGAAAATAAATGG + Intergenic
1095799273 12:46255408-46255430 GGACATTGGCTAAAACTAAAGGG - Intronic
1096116202 12:49056882-49056904 AGCCACTATCTGGAAATAAAGGG - Intronic
1096883508 12:54693426-54693448 AGCCACAGGGTGAATGTAAAGGG + Intergenic
1097448557 12:59707366-59707388 ACCCTCTGGCTGGATCTAAAAGG + Intronic
1097491763 12:60280345-60280367 AGCCACTTACTGTAACTGAAAGG - Intergenic
1097917559 12:65036851-65036873 ACCCACAGGCTCAAAGTAAAGGG - Intergenic
1098591354 12:72217244-72217266 AGCTACTAGCTGAAATTGAATGG - Intronic
1099467268 12:83003286-83003308 ACCCACAGGCTCAAAGTAAAGGG - Intronic
1100506304 12:95224172-95224194 TCCCACTGGCCGAACCTAAATGG - Intronic
1101309857 12:103566906-103566928 ACCCACAGGCTCAAAGTAAAGGG + Intergenic
1101310492 12:103574418-103574440 AGTCACTGGCATAAACCAAAAGG - Intergenic
1101718909 12:107334340-107334362 GGCTTCTGGCTGTAACTAAAAGG + Intronic
1102800886 12:115732722-115732744 AGCCAATGGCTGAAAGTTCAGGG + Intergenic
1102829912 12:115988471-115988493 AAGCACTGGCTGAAGATAAAAGG - Intronic
1104492338 12:129205288-129205310 ATCCATTGGCTCAAAATAAAGGG + Intronic
1105008437 12:132737763-132737785 AGACTCTGTCTGAAACTAAGAGG - Intronic
1105402080 13:20104970-20104992 AGCCGGTGGCAGAAACTGAAAGG + Intergenic
1105743838 13:23357614-23357636 AGACACAGTTTGAAACTAAAAGG + Intronic
1105880745 13:24604616-24604638 ATCCACAGGCTGAAAGTAAAGGG - Intergenic
1106100367 13:26690107-26690129 AGCCACTGGCTGAAAAAGAGTGG + Intergenic
1106648412 13:31662456-31662478 ACCCACAGGCTCAAAGTAAAGGG - Intergenic
1107484829 13:40815745-40815767 ATCCACAGGCTGAAAGTAAAGGG + Intergenic
1107566939 13:41614521-41614543 AGCAACTGACTGAAAAGAAATGG - Intronic
1108032153 13:46243533-46243555 AGACACAGGCTGAAAATGAAGGG + Intronic
1108252342 13:48579659-48579681 TGGCACTGGCTGACACAAAATGG - Intergenic
1109740296 13:66544853-66544875 AGAAACTGGCTGAAACCATATGG - Intronic
1109745897 13:66622384-66622406 AGCCACTGGGTGAAGCTAGCTGG + Intronic
1109869752 13:68319203-68319225 AGCCACAGGCTCAAAGGAAAGGG - Intergenic
1110341876 13:74402087-74402109 AGAAACTGGCTAAAACAAAAGGG + Intergenic
1111116287 13:83781961-83781983 ACCCACAGGCTCAAAGTAAAGGG + Intergenic
1111250216 13:85591749-85591771 AGCCATTGGCTGAAGTCAAATGG - Intergenic
1111663770 13:91242719-91242741 AACCTAAGGCTGAAACTAAAAGG - Intergenic
1111770080 13:92585407-92585429 AGGCATTGGCTGAAACAAAGGGG - Intronic
1114989292 14:28267242-28267264 ACCCACAGGCTCAAAATAAAGGG + Intergenic
1115792092 14:36891563-36891585 ACACAATGGCAGAAACTAAAAGG + Intronic
1116536652 14:46040219-46040241 ACCCACAGGCTCAAAGTAAAGGG - Intergenic
1117009512 14:51455971-51455993 ACCCACTGCCTGAAAATAACAGG - Intergenic
1117034957 14:51718734-51718756 AGGAACTGGCTGAAACACAAAGG - Intronic
1118069033 14:62224764-62224786 AGCCAGTGGCTGATACCAAGAGG + Intergenic
1118114789 14:62762655-62762677 ATCCACAGGCTCAAAGTAAAGGG + Intronic
1118831256 14:69435411-69435433 TGGCACTGGCTAAAAATAAAAGG - Intronic
1119312242 14:73658002-73658024 AGCCACTGGAAGAAAATACAGGG - Intronic
1119790700 14:77347220-77347242 AGCCACTGGCTAGAAGCAAAAGG + Intronic
1119899748 14:78249537-78249559 AGCCAGTGACTGCAAGTAAAGGG - Intronic
1123407697 15:20031855-20031877 ATCCACAGGCTCAAAGTAAAAGG + Intergenic
1124245514 15:28068193-28068215 ACCCACAGGCTCAAAATAAAAGG - Intronic
1125823426 15:42654361-42654383 AGACACAGGTTGAAAGTAAAAGG + Intronic
1126535405 15:49756737-49756759 AGCCACTGGAGGAAACAGAATGG + Intergenic
1126856969 15:52848062-52848084 AGCTATTGTCTGGAACTAAAGGG - Intergenic
1127097244 15:55525211-55525233 ACCCACAGGCTCAAAGTAAAGGG - Intergenic
1128597743 15:68966823-68966845 ATCCACAGGCTCAAAGTAAAAGG - Intronic
1129568835 15:76656179-76656201 AGCCACAGGTTCAAAGTAAAGGG + Intronic
1130855929 15:87840055-87840077 AGCCACTGGGGAAAACCAAACGG + Intergenic
1131589954 15:93738305-93738327 AAACACAGGCTGAAAATAAAGGG - Intergenic
1131641023 15:94294060-94294082 AGCAACTGGATGAATCTCAAAGG + Intronic
1131802186 15:96082460-96082482 AGCCACAGGCTCACACTCAAGGG + Intergenic
1132774218 16:1582971-1582993 AGCCTCTGTCTGAAACTTCAAGG - Intronic
1135837920 16:25844443-25844465 AACCACTAGCAGAAATTAAAAGG - Intronic
1139169426 16:64613434-64613456 ACACACAGGCTCAAACTAAAGGG - Intergenic
1141920655 16:87133438-87133460 AGCCACTTGCGGAAACTAAAAGG + Intronic
1143135195 17:4709021-4709043 ATCCACTGGGTGAAGCCAAATGG - Intergenic
1143336656 17:6176515-6176537 AGCCAGTGGCTGAGACTGATAGG + Intergenic
1143740763 17:8952336-8952358 ATCCACCAGCTGTAACTAAATGG - Intronic
1147187572 17:38720910-38720932 AGCCAATGGCTGGCACTAAGTGG - Intronic
1149153908 17:53603354-53603376 ACCCACAGGCTCAAAGTAAAGGG - Intergenic
1150000664 17:61436457-61436479 ACACACAGGCTGAAAGTAAAGGG - Intergenic
1150227677 17:63532640-63532662 ACCCTCTGGTTGAAACTAAATGG + Intronic
1152481998 17:80560550-80560572 AGCCAGTAGCTGAAACAGAATGG + Intronic
1153582170 18:6584472-6584494 ACCCACAGGCTCAAAGTAAAAGG + Intronic
1155086654 18:22465546-22465568 AGTCACTTGCTGAATCTGAAAGG + Intergenic
1155675885 18:28428107-28428129 ACCCACAGGCTCAAAGTAAAAGG - Intergenic
1155676705 18:28438700-28438722 ATCCATAGGCTCAAACTAAAGGG - Intergenic
1155995048 18:32322186-32322208 AGCCACTGGCTGAAACTAAAAGG + Intronic
1157568044 18:48693330-48693352 AACCACTGCCTCAGACTAAAAGG - Intronic
1157935804 18:51871895-51871917 ACCCACAGGCTCAAAGTAAAGGG - Intergenic
1159816356 18:73078657-73078679 AGCCACAGGCAGAAACCACAAGG - Intergenic
1161874538 19:6897701-6897723 ACCCACAGGCTCAAAGTAAAGGG - Intronic
1164496993 19:28775133-28775155 ACCCACAGGCTCAAAATAAATGG + Intergenic
1164738079 19:30556724-30556746 AGCTACTGGCTGAATCAACAGGG + Intronic
1166908200 19:46130223-46130245 ACCCACAGGCTCAAAATAAAGGG - Intergenic
1168188379 19:54717167-54717189 ACCCACAGGCTCAAAGTAAAAGG + Intergenic
925447268 2:3938739-3938761 ACACACTGGCTCAAAATAAAGGG - Intergenic
925954784 2:8952839-8952861 ATCCACAGGCTCAAAGTAAAGGG - Intronic
926496132 2:13591117-13591139 ACCCATAGGCTCAAACTAAAGGG - Intergenic
927348402 2:22075284-22075306 ACCCACTGGCTGTAATAAAAAGG + Intergenic
927584909 2:24293972-24293994 AGTGACTGGCTGAAATTAAAAGG + Intronic
927617266 2:24611784-24611806 ACCCACGGGCTCAAAGTAAAGGG - Intronic
928488590 2:31757685-31757707 AGACACAGGCTCAAAATAAAGGG - Intergenic
928734373 2:34268923-34268945 AGCCATTGGTTTAAAATAAAGGG - Intergenic
928799504 2:35069773-35069795 ACCCACAGGCTGAAAGTAAAGGG + Intergenic
930897881 2:56466403-56466425 ACCCACAGGCTCAAAGTAAAGGG + Intergenic
930936034 2:56952665-56952687 AGCCACAGGCTAAAAATAAAGGG - Intergenic
932113577 2:69024138-69024160 AGCCACTGGCTGTGAGTGAATGG + Intronic
932899739 2:75683717-75683739 ACACACTGGCTCAAAATAAAGGG + Intronic
934892254 2:98080831-98080853 AGGCACTGGGTTAAACTTAAAGG + Intergenic
935465896 2:103397747-103397769 AGACACTGGCTGAAAAAAATAGG + Intergenic
935500111 2:103829081-103829103 AGCCACAGGCTAAAAGTAAAGGG - Intergenic
936048427 2:109204153-109204175 AGTTAATGGCTGAATCTAAATGG - Intronic
936391049 2:112073962-112073984 ACCCACAGGCTCAAAATAAAGGG - Intronic
936416650 2:112320870-112320892 AGCCACAAGCTAAAACAAAAAGG - Intronic
937397401 2:121549211-121549233 ACCCATAGGCTCAAACTAAATGG + Intronic
938019163 2:127892045-127892067 TCCCACTGGCGGAATCTAAAAGG + Intergenic
939168932 2:138671420-138671442 AGCCATTGGCAAGAACTAAACGG - Exonic
939789672 2:146556227-146556249 CTCCACTGGCTGAAAGCAAATGG + Intergenic
940708119 2:157128920-157128942 ACCCACAGGCTCAAAATAAAGGG + Intergenic
941055147 2:160778756-160778778 ACCCATTGGCTCAAAGTAAAAGG + Intergenic
942010591 2:171759070-171759092 AGACACAGGCTCAAAATAAAGGG - Intergenic
948235592 2:236387531-236387553 ACACACAGGCTGAAAATAAAAGG - Intronic
1169500512 20:6156051-6156073 ATCCACAGGCTCAAAGTAAAAGG - Intergenic
1170090490 20:12584643-12584665 AGCCATAGGCTCAAAATAAAAGG + Intergenic
1170510447 20:17071057-17071079 AGCCAATGGCTGATAGTAACAGG - Intergenic
1170733035 20:18990424-18990446 AGCCAGTGCCTGAAGCCAAAGGG + Intergenic
1171977585 20:31605358-31605380 GGCGACTGGCTGAAACAGAATGG - Exonic
1172613186 20:36266696-36266718 AGCCACTGCCTGAAAAGAAGGGG - Intronic
1172645898 20:36469342-36469364 AGCCACAGGCCCAAACTACAGGG - Intronic
1173441591 20:43082112-43082134 AGACACAGGTTGAAAATAAAGGG - Intronic
1173986080 20:47262590-47262612 AGCCCTTTGCTGAAAATAAATGG - Intronic
1174752357 20:53124093-53124115 AAACACTGGCTGACGCTAAAAGG - Intronic
1174817697 20:53700997-53701019 AACCACTGGGGGAAACTAGATGG - Intergenic
1175323674 20:58107643-58107665 AGCCACTGGATGATTCCAAATGG - Intergenic
1177207136 21:18023194-18023216 AGCAACTGGCTGACACTAGCTGG + Intronic
1177253880 21:18634285-18634307 ATCCATTGGCTCAAAATAAAGGG + Intergenic
1178745808 21:35249138-35249160 GGCCACTGGCTGGATGTAAACGG + Intronic
1179041467 21:37806142-37806164 AGCAACTGGCTGATAAAAAATGG + Intronic
1179050966 21:37888316-37888338 AACCACAGGCTGAAGCTAATTGG + Intronic
1180254620 21:46616710-46616732 ACCCACTGGCTCAAAATAAAGGG - Intergenic
1183523755 22:38311566-38311588 AGCCACTGGCTGGAGGTCAAAGG - Intronic
1185311384 22:50157357-50157379 AGCCACTGGCAATAACTAAAAGG - Intronic
949704284 3:6798094-6798116 ACCCACTGGATGTAACAAAAAGG + Intronic
949798815 3:7880356-7880378 AGCCATAGGCTCAAACTAAAGGG + Intergenic
951526990 3:23662942-23662964 AGCTATTGGCTCAAACTTAATGG + Intergenic
952066209 3:29574429-29574451 ACCCACAGACTGAAAATAAAGGG - Intronic
953012298 3:39038947-39038969 AGGTATTGGCTGAAAGTAAAAGG - Intergenic
953309200 3:41860587-41860609 ACACACAGGCTGAAAATAAAGGG - Intronic
953513565 3:43567956-43567978 ACCCACAGGCTCAAAATAAAAGG + Intronic
955502699 3:59600835-59600857 AGCCACTGGCTGAGACTAGAAGG + Intergenic
958667730 3:97161695-97161717 AACCACTGGCAGAAAAAAAAAGG + Intronic
958763067 3:98331160-98331182 ACCCACAGGCTCAAATTAAAAGG + Intergenic
958799364 3:98737762-98737784 ATCCAAAGGCTGAAAGTAAAGGG + Intronic
958861020 3:99445538-99445560 ACCCACAGGCTCAAACTAAGTGG - Intergenic
959998853 3:112709356-112709378 ACCCACAGGCTCAAAATAAAGGG - Intergenic
960012011 3:112843826-112843848 ACACACAGGCTGAAAGTAAAGGG + Intronic
960561353 3:119087026-119087048 ACCCACAGGCTCAAAGTAAAAGG + Intronic
963368828 3:144371204-144371226 ACCCATTGGCTCAAAGTAAAGGG + Intergenic
963952916 3:151222115-151222137 AGGAACTGGCTGAAACAAAGGGG - Intronic
964884959 3:161471446-161471468 GGCCATTGGCAGAAACCAAAGGG + Intergenic
964901764 3:161668709-161668731 ACCTATTGGCTGAAAGTAAAGGG - Intergenic
964921883 3:161907175-161907197 AGATACTTGCTGAAACAAAAAGG - Intergenic
964991391 3:162817137-162817159 ACCCACAGGCTCAAAGTAAAGGG - Intergenic
965283260 3:166781988-166782010 ACCCACAGGCTCAAAGTAAAGGG - Intergenic
965963246 3:174454026-174454048 ACCCACAGGCTTAAAATAAAGGG + Intronic
966902463 3:184496707-184496729 AAACACTGGCTGAAAATCAACGG - Intronic
968493524 4:903230-903252 AGCCACTGGCTGCATGTAAAAGG - Intronic
968828814 4:2920704-2920726 ATGCACTGGCTCAAAATAAAGGG - Intronic
970633895 4:17985630-17985652 ACCCATAGGCTGAAAATAAAAGG - Intronic
971114071 4:23622662-23622684 ACCCACTGGCTCAAAGTAAAGGG + Intergenic
971794182 4:31204968-31204990 AGCCACAGGCATAAACTCAATGG - Intergenic
971905111 4:32716149-32716171 AGCCACTGGGTGAAACCAGCTGG - Intergenic
972010466 4:34174017-34174039 ACCCACAGGCTCAAAGTAAAAGG - Intergenic
972491993 4:39596455-39596477 AGCAACAGCCTAAAACTAAATGG + Intronic
973231045 4:47838643-47838665 ACCTACAGGCTGAACCTAAAAGG + Intergenic
973595392 4:52483443-52483465 AGAAACAGGCAGAAACTAAAAGG - Intergenic
973608930 4:52615308-52615330 AGACACAGGTTGAAAGTAAATGG + Intronic
974513338 4:62874039-62874061 ACACACAGGCTGAAAATAAAGGG + Intergenic
974768892 4:66384834-66384856 ACACACTGGCTCAAAATAAAGGG + Intergenic
975952646 4:79792501-79792523 AAACACAGGCTGAAAATAAAGGG - Intergenic
976161446 4:82203988-82204010 AGACACAGACTGAAAATAAAGGG + Intergenic
976366577 4:84239627-84239649 AGGAACTGGCTGAAGCTCAATGG - Intergenic
976375047 4:84336947-84336969 AACCACAGGCTCAAAGTAAAGGG - Intergenic
976492794 4:85691705-85691727 ACCCACAGGCTCAAAGTAAAGGG - Intronic
977948210 4:102938148-102938170 ACCCATTGGCTCAAAGTAAAAGG + Intronic
979119910 4:116884508-116884530 ACACACTGGCTTAAAATAAAGGG + Intergenic
979874216 4:125866853-125866875 ACCCACAGGCTCAAAATAAATGG + Intergenic
979888168 4:126058549-126058571 AGCCACTGACTGAACCTTCAGGG + Intergenic
980023668 4:127738968-127738990 ACCCACAGGCTCAAAGTAAAGGG - Intronic
983131489 4:164024859-164024881 AACCACAGGCTCAAAGTAAAGGG + Intronic
983334424 4:166374353-166374375 ACACATTGGCTGAAAATAAAGGG - Intergenic
983665581 4:170177965-170177987 ACACATAGGCTGAAACTAAAGGG - Intergenic
984408886 4:179370328-179370350 AGCCTCTGGCTGAAACACAAAGG - Intergenic
985526607 5:406228-406250 AGCCACTGGCTGGAAGGAAGGGG - Intronic
986319652 5:6619306-6619328 TGCCACTTACTGAAACAAAATGG + Intronic
986653085 5:9983789-9983811 AGCCTAGGGCTGAATCTAAATGG + Intergenic
986714035 5:10509548-10509570 AGCCAGTGAATGAAACGAAAAGG + Intronic
987697181 5:21347276-21347298 AGCCACTGGCCCAAAATAAGGGG - Intergenic
987796048 5:22627860-22627882 ACCCACAGGCTAAAAGTAAAAGG + Intronic
987939642 5:24516664-24516686 ATCCAATGGCTGAATCTAGAAGG - Intronic
988755053 5:34239415-34239437 AGCCACTGGCCCAAAATAAGGGG + Intergenic
988936233 5:36085504-36085526 AGCCATAGGCTCAAAATAAAGGG + Intergenic
989216552 5:38910000-38910022 ACCCACAGGCTCAAAGTAAAGGG + Intronic
990023981 5:51162506-51162528 ACCCATTGGCTCAAAATAAAGGG + Intergenic
990366330 5:55074509-55074531 AGCCAGTGTCTGACACTAACAGG + Intergenic
990853996 5:60242110-60242132 ACACACAGACTGAAACTAAAAGG + Intronic
991212282 5:64119444-64119466 AGCCATTGGATGAAACATAATGG - Intergenic
991743270 5:69705101-69705123 AGCCACTGGCCCAAAATAAGGGG + Intergenic
991754426 5:69850102-69850124 AGCCACTGGCCCAAAATAAGGGG - Intergenic
991794843 5:70284837-70284859 AGCCACTGGCCCAAAATAAGGGG + Intergenic
991804045 5:70406853-70406875 AGCCACTGGCCCAAAATAAGGGG - Intergenic
991822657 5:70580412-70580434 AGCCACTGGCCCAAAATAAGGGG + Intergenic
991833754 5:70725250-70725272 AGCCACTGGCCCAAAATAAGGGG - Intergenic
991887220 5:71284375-71284397 AGCCACTGGCCCAAAATAAGGGG + Intergenic
992899457 5:81278900-81278922 ACACACTGGCTCAAAATAAAGGG + Intergenic
992926608 5:81594114-81594136 ACACACTGGCTCAAAATAAAGGG + Intronic
993043890 5:82845920-82845942 ACACACTGGCTCAAAATAAAGGG - Intergenic
993429834 5:87818436-87818458 ACCCACAGGCTCAAAGTAAAGGG - Intergenic
994178249 5:96735402-96735424 AGAGACTGGCAGAAACTAAATGG - Intronic
995039502 5:107571715-107571737 ACCCACTGGCAGGAACCAAAGGG + Intronic
999013708 5:148072430-148072452 AGGCACTGACGGAAACTAAGAGG + Intronic
1000569789 5:162897508-162897530 ATCCACAGGCTCAAAGTAAAGGG + Intergenic
1001979229 5:176026987-176027009 ATCCACAGGCTCAAAGTAAAGGG - Intronic
1002238187 5:177816774-177816796 ATCCACAGGCTCAAAGTAAAGGG + Intergenic
1002380307 5:178823049-178823071 ATCCACAGGCTCAAAGTAAAGGG - Intergenic
1004739083 6:18439420-18439442 AGCCACTGACTGAAGGTAGAAGG + Intronic
1005155266 6:22797958-22797980 ACCCACAGGCTCAAAATAAAGGG - Intergenic
1005349150 6:24917364-24917386 CGCCATAGGCTGAAAGTAAATGG + Intronic
1005553677 6:26951126-26951148 AGCCACTGGCCCAAAATAAGGGG + Intergenic
1005758173 6:28944062-28944084 AGCAACAGGCTCAAACCAAACGG - Intronic
1007276188 6:40675801-40675823 AGCCACTGGCTGCACAGAAAAGG - Intergenic
1007650553 6:43417829-43417851 GGAAACTGGGTGAAACTAAAGGG + Intergenic
1008211648 6:48731491-48731513 ACCCATTGGCTCAAAATAAAGGG + Intergenic
1009057538 6:58355127-58355149 AGCCACTGGCAAGAAATAAAAGG - Intergenic
1010018550 6:71133615-71133637 AGACACAGGCTGAAAGTAAATGG + Intergenic
1010022993 6:71182812-71182834 ATCCACAGGCTCAAAGTAAAGGG + Intergenic
1010061910 6:71633073-71633095 ACACACAGACTGAAACTAAAGGG - Intergenic
1011360973 6:86524719-86524741 ACCCACTGGCTCAAAGTAAAAGG - Intergenic
1012668873 6:102015305-102015327 AGTAACTGGCTCAAAATAAAGGG - Intronic
1013393522 6:109711634-109711656 ACCCACAGGCTCAAAATAAAGGG - Intronic
1014369061 6:120582456-120582478 ACACACAGGCTCAAACTAAAAGG - Intergenic
1014841204 6:126222695-126222717 ATCCACAGGCTCAAAGTAAAGGG - Intergenic
1014852532 6:126359799-126359821 ACCCACAGGCTCAAAATAAAGGG - Intergenic
1016075105 6:139786742-139786764 ACCCATAGGCTGAAAGTAAAGGG - Intergenic
1016569367 6:145495357-145495379 ATCCACAGGCTTAAAATAAAAGG - Intergenic
1017664227 6:156703715-156703737 AGACACTGGCTGAAAAAAAATGG + Intergenic
1018319628 6:162593685-162593707 GGCAACTGGCTCAAACTCAAGGG + Intronic
1018665202 6:166128865-166128887 AGACACTGGTTGAAAGTAAAAGG + Intergenic
1020735800 7:11948063-11948085 ACCCACAGGCTCAAAATAAAGGG - Intergenic
1021203386 7:17752001-17752023 AGACACAGACTGAAAATAAAGGG - Intergenic
1021210081 7:17839542-17839564 CACCACAGGCTGAAAGTAAAAGG - Intronic
1024824957 7:53380568-53380590 TGCCTCTTGCTGTAACTAAAAGG - Intergenic
1026068550 7:67097265-67097287 AGCCACTGCATGAAACCAGAGGG - Intronic
1026708362 7:72715047-72715069 AGCCACTGCATGAAACCAGAGGG + Intronic
1028388976 7:90293454-90293476 GGCCATTGGCTAAAATTAAAGGG - Intronic
1028677054 7:93477192-93477214 ACCCAGATGCTGAAACTAAATGG - Intronic
1030847934 7:114445029-114445051 AGCCACTGGCTCTAAAAAAATGG - Intronic
1031039563 7:116825161-116825183 ATCCATTGGCTCAAAATAAAGGG - Intronic
1031641052 7:124163955-124163977 ACCCACAGGCTCAAAGTAAAGGG + Intergenic
1031912929 7:127536513-127536535 AGCCAATGGCTGAAAGCAAATGG - Intergenic
1032768708 7:135025714-135025736 ATCCACAGGCTCAAAGTAAAGGG + Intronic
1034279667 7:149844318-149844340 AGCCCCTGGCTGAGAAGAAACGG + Intronic
1035270357 7:157716100-157716122 AGCCTGTGGCTGAACCCAAAGGG - Intronic
1035299006 7:157885125-157885147 GGCCACTGGCTCAAGCAAAAGGG + Intronic
1036497015 8:9278783-9278805 ACCCACAGGGAGAAACTAAAAGG - Intergenic
1039102472 8:33955922-33955944 ACCCATTGGCTCAAAATAAAGGG - Intergenic
1039349020 8:36740843-36740865 AACCAATGGCTTAAACAAAAGGG + Intergenic
1039667419 8:39549565-39549587 ACACACTGGCTGAAAGTGAAGGG - Intergenic
1040412876 8:47172207-47172229 ATCCACAGGCTCAAAGTAAAGGG - Intergenic
1040483098 8:47844170-47844192 ACCCACAGGCTCAAAGTAAAAGG + Intronic
1040862179 8:52010503-52010525 TGCCACTGGCTGTAAAAAAATGG + Intergenic
1042578055 8:70243479-70243501 AGCCACTGTATGAAACAATATGG - Intronic
1043761416 8:84073704-84073726 AACCACAGGCTCAAAGTAAAGGG - Intergenic
1045699057 8:104845477-104845499 ACCCACGGGCTAAAAGTAAAGGG - Intronic
1046073251 8:109284066-109284088 ACCCACAGGCTCAAAGTAAAGGG + Intronic
1046151405 8:110231180-110231202 AACCTCTGGCTGAAAGTTAAGGG + Intergenic
1046454736 8:114442889-114442911 ACCCACAGGCTCAAAGTAAAGGG + Intergenic
1046735747 8:117775147-117775169 AGCCATAGGCTCAAAATAAATGG + Intergenic
1047872772 8:129103491-129103513 AGCCTCTGGCTGAGACCAACTGG - Intergenic
1048041666 8:130735428-130735450 ATCCACAGGCTCAAAATAAAGGG + Intergenic
1049067007 8:140324176-140324198 AGACACAGACTGAAAATAAAAGG + Intronic
1049312679 8:141941727-141941749 AGACAATGGCTGAAAGTAAAGGG + Intergenic
1050679742 9:8096740-8096762 AGAAAATGGCTGAAACTTAAGGG - Intergenic
1050923854 9:11239464-11239486 AGCCACAGGCTCAAAGTAAAGGG - Intergenic
1052063560 9:23989641-23989663 ACACACTGACTGAAAATAAAGGG + Intergenic
1052250520 9:26392252-26392274 ACCCACAGGCTTAAAATAAAGGG - Intergenic
1052250716 9:26394171-26394193 AGCCAGTGGCTGACCCTGAAGGG - Intergenic
1052782479 9:32795555-32795577 AGAAACTGGCTGAAACAAAGGGG + Intergenic
1054904654 9:70403966-70403988 TCCCACTGGCGGAAACTCAAGGG + Intronic
1055207396 9:73749528-73749550 ACCCACAGGCTCAAAGTAAAGGG - Intergenic
1055814077 9:80185215-80185237 ATCCACTGGGTGAAGCCAAATGG - Intergenic
1056220494 9:84446634-84446656 TGCCACTGGCTGTAGCCAAAGGG - Intergenic
1056394326 9:86167853-86167875 AGCCTCTGGCCGAGACCAAAAGG + Intergenic
1057474617 9:95388094-95388116 AACCACTCGTTGAACCTAAATGG + Intergenic
1058029494 9:100179412-100179434 ACACACAGGCTGAAAATAAAGGG + Intronic
1058266231 9:102902049-102902071 ACACACAGGCTGAAAATAAAGGG + Intergenic
1059893666 9:118834659-118834681 AGCCATTGGGTCAAATTAAATGG + Intergenic
1060761036 9:126249040-126249062 AGGCACTAGCTGGAAGTAAAAGG - Intergenic
1186458062 X:9726374-9726396 AGCTACTTGCTGAAACCATATGG - Intronic
1186741402 X:12522185-12522207 TGCCACTGGCTGGGACAAAATGG - Intronic
1188091594 X:25970972-25970994 ACCCACAGGCTCAAAGTAAATGG + Intergenic
1188103287 X:26117232-26117254 TGAAGCTGGCTGAAACTAAATGG - Intergenic
1188869500 X:35357088-35357110 ACCCACAGGCTTAAAATAAAGGG - Intergenic
1189873246 X:45405987-45406009 ACCCACAGGCTCAAAGTAAAGGG + Intergenic
1190450654 X:50577389-50577411 AGCCAATTGCTGAAAGTAAGAGG + Intergenic
1190604777 X:52129395-52129417 ACCCACAGGCTCAAAGTAAAGGG + Intergenic
1191147205 X:57179395-57179417 ACCCATTGGCTCAAAATAAAGGG + Intergenic
1191706522 X:64099820-64099842 AGGCACTGGGTGAATCTATAGGG + Intergenic
1192027738 X:67472955-67472977 ACACACAGGCTGAAAATAAAAGG - Intergenic
1192261201 X:69506596-69506618 ACCCACTGGCAGAAGCCAAAGGG - Intronic
1192627770 X:72747936-72747958 ACCCACAGGCTCAAAGTAAAAGG + Intergenic
1192653938 X:72972873-72972895 ACCCACAGGCTCAAAGTAAAAGG - Intergenic
1192700534 X:73466258-73466280 ATACACAGGCTGAAAATAAAAGG - Intergenic
1192866137 X:75134107-75134129 ACCCACAGGCTCAAAGTAAAGGG + Intronic
1192926755 X:75761950-75761972 ACACACTGGCTCAAAATAAAGGG + Intergenic
1192934623 X:75846591-75846613 ACCCACAGGCTCAAAATAAAGGG - Intergenic
1193217612 X:78883034-78883056 AACCATTGGCTTAAAATAAAGGG - Intergenic
1193294358 X:79817117-79817139 ACCCACAGGCTCAAAATAAAGGG - Intergenic
1193330527 X:80231324-80231346 ACCCACAGGCTCAAAGTAAACGG - Intergenic
1193533282 X:82682473-82682495 AGACACTGGGGGAAGCTAAAAGG + Intergenic
1193686972 X:84589146-84589168 ACCCATTTGCTGAAAATAAACGG + Intergenic
1193725959 X:85039767-85039789 ATCCACAGGCTCAAATTAAATGG - Intronic
1193883613 X:86958367-86958389 ACCCACAGGCTCAAAATAAAGGG - Intergenic
1193961248 X:87927095-87927117 ATCCATAGGCTCAAACTAAAGGG + Intergenic
1194431710 X:93815534-93815556 ACACATTGGCTGAAAATAAAGGG + Intergenic
1194586776 X:95744866-95744888 ACCCACTGGCTCAAAATAAAGGG + Intergenic
1195029474 X:100912392-100912414 AGCCACTGTTTGGGACTAAAAGG - Intergenic
1195289891 X:103422414-103422436 ACACACAGGCTGAAAATAAAGGG - Intergenic
1195455265 X:105061900-105061922 AGACACAGACTGAAAATAAAGGG - Intronic
1196537140 X:116860235-116860257 AGACACAGACTGAAAATAAAGGG - Intergenic
1197388006 X:125824783-125824805 ACCCACAGGCTCAAAGTAAAAGG - Intergenic
1198077709 X:133210497-133210519 AGGCACAGGCTGAAAGTAACAGG + Intergenic
1198758766 X:140009560-140009582 ACCCACAGGCTCAAAATAAAGGG + Intergenic
1199099103 X:143778152-143778174 ACCCACAGGCTCAAAGTAAATGG - Intergenic
1199245782 X:145601971-145601993 ACCCACAGGCTCAAAATAAAGGG + Intergenic
1201971097 Y:19796241-19796263 AACCACAGGCTCAAAATAAAGGG - Intergenic