ID: 1155998608

View in Genome Browser
Species Human (GRCh38)
Location 18:32359069-32359091
Sequence ATTTCAAAACTGTATGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 313}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155998604_1155998608 28 Left 1155998604 18:32359018-32359040 CCATCCTCAGCTGTGCAGTTTAC 0: 1
1: 0
2: 0
3: 13
4: 215
Right 1155998608 18:32359069-32359091 ATTTCAAAACTGTATGTGGTAGG 0: 1
1: 0
2: 1
3: 25
4: 313
1155998605_1155998608 24 Left 1155998605 18:32359022-32359044 CCTCAGCTGTGCAGTTTACAACT 0: 1
1: 0
2: 1
3: 23
4: 187
Right 1155998608 18:32359069-32359091 ATTTCAAAACTGTATGTGGTAGG 0: 1
1: 0
2: 1
3: 25
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155998608 Original CRISPR ATTTCAAAACTGTATGTGGT AGG Intronic
904386971 1:30149275-30149297 ATTTTCACACTGTATGTGGCTGG + Intergenic
904596441 1:31649037-31649059 ATTTCAGAACTGGATCTAGTTGG - Intergenic
905337170 1:37252987-37253009 TTTTCACAACTCTATGAGGTTGG - Intergenic
906802175 1:48747836-48747858 TTTTCAAACATGTATGTGTTTGG + Intronic
907216091 1:52865247-52865269 ATTTTAAAAATGTGTGTTGTGGG - Intronic
907819201 1:57950554-57950576 ATTTCAAGACTCTATTTGATGGG - Intronic
909365605 1:74817897-74817919 ATTTTAACACTTTATGTGGTAGG + Intergenic
910075457 1:83272071-83272093 ATTTAAATACTGTATGTATTAGG - Intergenic
910179894 1:84470852-84470874 ACTTCAAACAAGTATGTGGTAGG - Intergenic
911231752 1:95369110-95369132 ATTTTAAAATTCTATTTGGTTGG - Intergenic
911382155 1:97128841-97128863 ATTTGAATACTGTATGTTGTAGG + Intronic
912225145 1:107724811-107724833 GTTGCAACACTGGATGTGGTGGG + Intronic
913122703 1:115756331-115756353 TTTTATAAACTGGATGTGGTAGG - Intronic
913674272 1:121126541-121126563 TTTTAAAAACTGTAAGTTGTAGG + Intergenic
914664492 1:149821591-149821613 TTTTAAAAACTGTAAGTTGTAGG + Intergenic
914671271 1:149872221-149872243 TTTTAAAAACTGTAAGTTGTAGG - Intronic
915541696 1:156571481-156571503 TTTTCAAATCTGTATTTGGAGGG - Intronic
916995348 1:170291289-170291311 ATTCCAAAACATTTTGTGGTTGG + Intergenic
917285970 1:173421896-173421918 ATATCAAAACTTTTTGTTGTTGG + Intergenic
917415290 1:174802904-174802926 ATTGCAATACTGCATGTGGCAGG - Intronic
917458582 1:175207511-175207533 TTTTCATAACTCTGTGTGGTAGG + Intergenic
917466013 1:175276716-175276738 GTTACAAAACTGCATGTGTTTGG + Intergenic
918356395 1:183709389-183709411 CTTTCACAGCTGTATGTGGAAGG + Intronic
918741344 1:188134687-188134709 ATTTTAAAACTGTTAGAGGTAGG - Intergenic
918917239 1:190659067-190659089 ATATCCACACTGTATGTGCTAGG - Intergenic
919110483 1:193213071-193213093 ATTTTAAATCTGAAAGTGGTTGG - Intronic
919346001 1:196379272-196379294 ATTTAAAAATTATATGTGGCAGG + Intronic
920651100 1:207838051-207838073 GATACAAAACTGTATGTAGTAGG + Intergenic
921587390 1:216964270-216964292 ATGTAAAAACTGCATGTGGAAGG + Intronic
922416817 1:225429413-225429435 ACTGCAAAACTCTATGAGGTAGG - Intergenic
923418452 1:233788602-233788624 TTTTTTAAACTGTATGAGGTAGG + Intergenic
924474801 1:244373656-244373678 ATTTTTAAATTATATGTGGTTGG - Intronic
924584419 1:245349197-245349219 CTTTCAAAACTCCATGTGCTTGG + Intronic
1063635964 10:7782755-7782777 ATTTAAAAACTGTATGCCTTTGG - Intronic
1063735251 10:8746523-8746545 ATTTCACAATTGGATGTGTTGGG + Intergenic
1063791751 10:9457153-9457175 GTTTCACAACAGTATATGGTGGG - Intergenic
1064333012 10:14411426-14411448 ATTTCAAAACTATATGTACCAGG - Intronic
1064527537 10:16273473-16273495 AGTTTAAAACTGAATGTGGCTGG + Intergenic
1064751521 10:18535319-18535341 ATTACAAATCTGTAGGAGGTTGG + Intronic
1065375523 10:25036779-25036801 AGATCAATACTCTATGTGGTAGG - Intronic
1067918783 10:50430756-50430778 AATTTCAAACTGAATGTGGTAGG - Intronic
1071542427 10:86498963-86498985 ATTTAAAAACTCTTTGTGGTTGG - Intronic
1072400861 10:95098353-95098375 ATTTCAAAATTATCTGTGGGTGG + Intergenic
1072882607 10:99242958-99242980 ATTTCAAAACCTTAGGTTGTAGG - Intergenic
1074158063 10:110815486-110815508 TTTTAAAAAGTGTATGTGCTTGG + Intronic
1076102821 10:127796857-127796879 CTTTAAACACTGTGTGTGGTGGG - Intergenic
1079177539 11:18156929-18156951 AATTCAAAAATGTATGTGACTGG - Intronic
1079652858 11:22951582-22951604 ATTTTGACCCTGTATGTGGTTGG - Intergenic
1079766237 11:24396616-24396638 ATTTCAAAACTGTAAGCAGAGGG - Intergenic
1080139153 11:28894085-28894107 ATTTTAAAGCTGTGTGTGGGAGG - Intergenic
1080526598 11:33128038-33128060 ATTTAGAAACTGTATGTCATTGG + Intronic
1080660448 11:34292043-34292065 ATTTCAAAAATATATGGGCTAGG - Intronic
1081058168 11:38437160-38437182 ATTTCCAAATTCTAAGTGGTAGG + Intergenic
1086358875 11:86036799-86036821 TTTTTAAAACTGTATGTGTGAGG + Intronic
1086642753 11:89179979-89180001 ATTTCAAAACTGCAGATTGTGGG - Intronic
1087531896 11:99393439-99393461 TTCTCACAACTGTATATGGTAGG + Intronic
1087833130 11:102841571-102841593 AGTTCATAACTGTATGTTTTGGG - Intronic
1087975292 11:104537980-104538002 ATTACATATCTGTATTTGGTTGG - Intergenic
1088061907 11:105663732-105663754 CTTTCAAAACTTTATATGGCTGG + Intronic
1092500701 12:9043639-9043661 ATTACAAAAGAGCATGTGGTTGG - Intergenic
1096306074 12:50477108-50477130 AATTCCAAACTGTATTTTGTTGG - Exonic
1096668804 12:53185497-53185519 ATTACCAAACTGTATGAGTTTGG - Intronic
1097447730 12:59693530-59693552 TTTTCAACAATTTATGTGGTGGG - Intronic
1098154115 12:67579525-67579547 ATTTGAAAGCTGGATGTGGTTGG - Intergenic
1098430432 12:70413690-70413712 ACTTCAAAAAATTATGTGGTGGG - Intronic
1098702893 12:73651843-73651865 ATTTGAAATTTGTATATGGTGGG - Intergenic
1098939904 12:76522362-76522384 ATTTCAAAATGGGATTTGGTAGG - Intronic
1099092814 12:78335073-78335095 TTTTCACAACTGTTTGAGGTAGG - Intergenic
1099339871 12:81416236-81416258 TTTTCAAAAGTGTTAGTGGTAGG + Intronic
1099348496 12:81534346-81534368 ATTTCTCAATTTTATGTGGTGGG - Intronic
1100852962 12:98732684-98732706 ATTACAAAAGTGTTTGTGGTTGG + Exonic
1101262039 12:103043389-103043411 ATTTAAAAACTGTATGTATGTGG + Intergenic
1101612763 12:106306155-106306177 ATTTCAAAACTGCAAGAGGTTGG + Intronic
1102617231 12:114165304-114165326 ATTTAAATACAGTATGTGGAAGG + Intergenic
1102803206 12:115755662-115755684 AATTCAAAGCTGTATGTCCTTGG + Intergenic
1102902703 12:116650799-116650821 ATTTAAAAACATTATGTGGAAGG - Intergenic
1103119113 12:118365879-118365901 ATTTAAAAACTGTATGTATACGG + Intronic
1103360401 12:120350320-120350342 ATTTAAGAACTGTGTGTGCTGGG - Intronic
1103650884 12:122431553-122431575 ATCTTAAAAATGTTTGTGGTTGG - Intergenic
1104443357 12:128813349-128813371 AATTCAAAACTGCAAATGGTGGG - Intronic
1105546457 13:21354418-21354440 ATTTTAAAGCTCTTTGTGGTAGG + Intergenic
1107268469 13:38585673-38585695 ATTTAAGAACTGCATGCGGTAGG - Intergenic
1108029353 13:46212389-46212411 ATTTCTAAACAGTATGAGTTGGG + Intronic
1109442626 13:62394902-62394924 AATTCAACACTGTGGGTGGTGGG + Intergenic
1111147348 13:84201169-84201191 ACGTGAAAACTGTCTGTGGTTGG + Intergenic
1111649984 13:91077625-91077647 ATCTCTCAAATGTATGTGGTTGG - Intergenic
1111730334 13:92067431-92067453 ATTTCCAAGCTGTATGTTTTAGG + Intronic
1114141933 14:19922093-19922115 ATTTGAAAACCGTATGGGATAGG - Intergenic
1114350065 14:21840393-21840415 ATGTCAAAACAGTATTTGTTTGG - Intergenic
1114679124 14:24469257-24469279 TTTTCAGAACTGTCTGTGTTTGG - Intergenic
1114685242 14:24523752-24523774 ATGTCAAAACTTTTTATGGTAGG + Intergenic
1115012355 14:28564691-28564713 ATTGGAAAACAGTATGTGGCTGG + Intergenic
1115071246 14:29324369-29324391 AATAAAAAACTGGATGTGGTTGG + Intergenic
1115601966 14:34963713-34963735 CTACCAAAACTGTATCTGGTAGG + Intergenic
1115801917 14:37004253-37004275 ATTTCAAAATAGAATTTGGTGGG - Intronic
1116782188 14:49248794-49248816 ATTTAAAAACTGGATGTGGAAGG + Intergenic
1117090968 14:52249902-52249924 ATTTCAAAACTATAAGTTTTGGG + Intergenic
1117403057 14:55375275-55375297 ATTTCCAAACTGGTTGTTGTTGG + Intronic
1118313731 14:64711210-64711232 GTTTCAAAACAGTGTGGGGTAGG - Intronic
1119060304 14:71467576-71467598 TTTTCAAAAAAGTATGTGATTGG + Intronic
1119181250 14:72606678-72606700 ATTTCAACACGGAATTTGGTGGG - Intergenic
1120638471 14:86980705-86980727 AGTTCAAACCTGTTGGTGGTGGG + Intergenic
1121366960 14:93321735-93321757 ATTTCTAAACTGTATGATCTTGG + Intronic
1121663895 14:95657443-95657465 CTTTTAAAACTGTATGTGGGTGG + Intergenic
1126286812 15:47022454-47022476 ATTTCAAAATGATATTTGGTGGG - Intergenic
1126376496 15:48002073-48002095 ATTTTAAAAATATATGTGCTTGG - Intergenic
1128612105 15:69082290-69082312 TTTTCAAAACTGTGTGTAGAAGG - Intergenic
1128667929 15:69552355-69552377 AGATCATAACTGGATGTGGTCGG - Intergenic
1129546065 15:76396605-76396627 ATTTCAAGATTGTTTGTTGTTGG + Intronic
1129731934 15:77937309-77937331 ATTTCAACACTAGATGTGGATGG - Intergenic
1130343562 15:83020638-83020660 ATTTCAAAATGATATATGGTGGG + Intronic
1130680098 15:85989167-85989189 ACATCAGAACTGTCTGTGGTGGG - Intergenic
1130775086 15:86970718-86970740 ATATGGAAACTGAATGTGGTAGG - Intronic
1137918592 16:52461249-52461271 ATTTTAAAACAGGATGTGGTTGG - Intronic
1140018995 16:71218593-71218615 ATGTTAAAACTGTTAGTGGTAGG - Intronic
1142469456 17:155286-155308 CTTTAAAAATTGTATGTGGCAGG - Intronic
1144119823 17:12141030-12141052 ATTTCATAGCTATGTGTGGTTGG + Intronic
1144243592 17:13339404-13339426 TTTGCAATATTGTATGTGGTAGG - Intergenic
1144378459 17:14669021-14669043 TTTTCAAAGCTTTATGAGGTAGG + Intergenic
1144410458 17:14995467-14995489 GTTACAAAACTAAATGTGGTAGG + Intergenic
1146718495 17:35106295-35106317 ATTTCCAAACAGTCTGTAGTAGG + Intronic
1148431323 17:47646186-47646208 TTTTCAAAATTGTATGGGTTGGG + Intergenic
1148837416 17:50472713-50472735 ATTTCCAAAATGTATACGGTGGG + Intronic
1152991443 18:367085-367107 CTTTCAAAACTCCATGTGATAGG + Intronic
1155148411 18:23103241-23103263 GTTTCATAACTCTATGTGCTTGG + Intergenic
1155903510 18:31420553-31420575 CTTTAAAAACTGTCTGTGTTGGG - Intergenic
1155998608 18:32359069-32359091 ATTTCAAAACTGTATGTGGTAGG + Intronic
1156673145 18:39494774-39494796 ATTTCAAAACTGTGTGTGCATGG - Intergenic
1156837424 18:41571064-41571086 ATATCCAAACTGTATTTGGGAGG - Intergenic
1156970513 18:43148738-43148760 ATTTCAAAATTCTTTTTGGTAGG - Intergenic
1156979541 18:43268372-43268394 ATTTTAAAAATGTTTGTTGTTGG + Exonic
1157232483 18:45931531-45931553 ATTTTAAAAATATATGTGCTTGG + Intronic
1157704754 18:49795589-49795611 ATTTCAAAACTCTATTTTGGTGG - Intronic
1159403622 18:67971217-67971239 ATTTCAAAAGTGTATTTGTCAGG - Intergenic
1159861930 18:73659904-73659926 ATTTCAAACTTTTATGTGCTGGG + Intergenic
1160214779 18:76918969-76918991 ACTTTAAAAATATATGTGGTTGG - Intronic
1160945185 19:1638925-1638947 GTTTCAAAACTGTCTTTGGTCGG - Intronic
1160984084 19:1829510-1829532 ATTTCAAAACTTTTTGTAGCTGG + Intronic
1164379081 19:27716983-27717005 ATTTTAAGACTGCATGGGGTTGG + Intergenic
1165585644 19:36913256-36913278 ATTTTTAAATTGTATGTGTTTGG - Intronic
1166628118 19:44379483-44379505 ACTTAAAATCTTTATGTGGTTGG - Intronic
1168416383 19:56171774-56171796 ATTTAAAAAATGTTTGTGATAGG - Intergenic
925977011 2:9148798-9148820 ATTTTATAACCCTATGTGGTTGG + Intergenic
926098826 2:10100387-10100409 ATCTCAAAAATATATGTGGGGGG - Intergenic
926546705 2:14250559-14250581 AATTCAAAACTGCATTTAGTAGG - Intergenic
926951711 2:18250427-18250449 ATTTCTAAAGTGTATTTGTTTGG - Intronic
928875204 2:36030327-36030349 ATTTCAACAATTTATCTGGTGGG + Intergenic
929130598 2:38565891-38565913 CTTTCAAAACTGTGTGTGAAGGG - Intronic
930125072 2:47789367-47789389 ATTTCAAAACTGATAATGGTTGG + Intronic
930492705 2:52095682-52095704 GCCTCAAAAGTGTATGTGGTAGG + Intergenic
930578624 2:53183045-53183067 ATATCAAACCTGTATGTAGGTGG - Intergenic
930912363 2:56644472-56644494 ATATCAAAAGTGTATGTGGCAGG - Intergenic
931938551 2:67226174-67226196 ATGTCAAAACTGTTGGTGGGCGG - Intergenic
931983275 2:67716983-67717005 ATTTATAAACTGTGTGTGCTGGG + Intergenic
932334348 2:70921462-70921484 ATTTCCTGACTGTCTGTGGTCGG - Intronic
933518769 2:83343866-83343888 TTTTGAAAAATGTATATGGTTGG + Intergenic
935214285 2:100963905-100963927 TTTTCACAACTGGATGAGGTAGG - Intronic
936995212 2:118406898-118406920 ATATCAAAAATGTTTGGGGTGGG - Intergenic
937559229 2:123200675-123200697 ATTTCAAAAATGTAAGTGCTGGG + Intergenic
938545477 2:132325665-132325687 ACTTAAAATCTTTATGTGGTTGG + Intergenic
939522556 2:143248612-143248634 CATTCACAACTGTATGAGGTAGG - Intronic
939719111 2:145625161-145625183 TTTTCTAAACAGTATGTGTTGGG + Intergenic
939932379 2:148252004-148252026 ATTTCCAAACTGTCTCTGGCAGG - Intronic
940038450 2:149333566-149333588 TTTTAAAAACTGCATGAGGTAGG - Intronic
940211880 2:151263432-151263454 ATTTTAAAACAGAATGAGGTAGG + Intergenic
941036954 2:160579318-160579340 ATTTCCAAACTGGGTTTGGTTGG - Intergenic
942183544 2:173402978-173403000 TTTTAAAAACTGCCTGTGGTTGG + Intergenic
942356621 2:175120459-175120481 ATTTCAATACTGTAAGTAGAGGG + Intronic
943597039 2:189870817-189870839 AACTCAAAACTGTGTGTGGTAGG - Intronic
943959176 2:194239108-194239130 ATTTCAAAAGAGAATGTTGTAGG - Intergenic
944127273 2:196308376-196308398 ATTTTAAAAATATATGTAGTTGG + Intronic
944134966 2:196389244-196389266 GTTGCAAAACTGTCTGTGGCAGG + Intronic
944175852 2:196828759-196828781 ATGTCAAAAGGCTATGTGGTAGG + Intergenic
946523080 2:220487739-220487761 ATTTAAAAATTAAATGTGGTTGG + Intergenic
1169056030 20:2621711-2621733 ATTTCAAAATTGCTTGAGGTTGG + Intronic
1169059496 20:2651522-2651544 ATGTCAAACCTAAATGTGGTTGG - Intergenic
1169296798 20:4406991-4407013 CCTTCAAAACTGTATACGGTTGG - Intergenic
1170324746 20:15144266-15144288 ATGTAAAAACTGCAAGTGGTTGG + Intronic
1170698857 20:18685183-18685205 TTATCAAAACTGTTTGTGGCTGG - Intronic
1171018903 20:21566389-21566411 ATTTTAAAAATGTATGTGGCTGG - Intergenic
1171162492 20:22940803-22940825 TTTTTAAAAATGTATGTTGTGGG + Intergenic
1171222114 20:23407932-23407954 ATTTTAAAACTGTGGGTGGGAGG + Intronic
1171408753 20:24931882-24931904 ATTTCAAAACTGGTGGTTGTAGG - Intergenic
1171423611 20:25035193-25035215 ATTTTAAAAATGCATATGGTCGG - Intronic
1171579544 20:26385338-26385360 ATTTCAAATCTGTTTGTAGAGGG - Intergenic
1171874334 20:30558421-30558443 ACTTAAAATCTTTATGTGGTTGG + Intergenic
1172546065 20:35762629-35762651 ATTTCAAATCTGTAAGTGTAGGG - Intergenic
1172816123 20:37688005-37688027 GTTTCAAAACTGTCAGAGGTGGG - Intergenic
1173028069 20:39327773-39327795 AGCTTAAAACTGTTTGTGGTCGG - Intergenic
1173761306 20:45562918-45562940 ATTTCAAAAATGCAAGAGGTGGG + Intronic
1174234683 20:49079728-49079750 ATGTAAAATCTGTATGTGGAAGG - Intronic
1174942022 20:54939830-54939852 CTTTTGAAACTGTATGGGGTGGG + Intergenic
1175019995 20:55835808-55835830 ATTTAATAACTGTATGGGTTTGG - Intergenic
1178333493 21:31722235-31722257 ATATCAAATCTGCATGTGTTGGG - Intronic
1180192320 21:46171584-46171606 ATTTGAAAAGTGTCTGGGGTGGG - Intronic
1181881380 22:25982974-25982996 ATTTCAAAACTCTAAGTGTTCGG + Intronic
1182573189 22:31254422-31254444 ATTTCCAAACTGAAAATGGTAGG - Intronic
949928822 3:9062085-9062107 ATATCAAAACTCTCTGTGGGGGG - Intronic
952334701 3:32393635-32393657 ATTTTAAAACCTTGTGTGGTTGG + Intronic
953696107 3:45160816-45160838 ATTTCAAAAATATTTGTTGTTGG + Intergenic
956140445 3:66141392-66141414 ATTTGAAAACTTTCTTTGGTAGG - Intronic
956176202 3:66475502-66475524 ATTTCAGGACTGAGTGTGGTGGG - Intronic
956603139 3:71044751-71044773 GTTTAAAAAATGTATGTTGTGGG + Intronic
957516104 3:81252994-81253016 TCTTAATAACTGTATGTGGTAGG - Intergenic
957625971 3:82652098-82652120 ATTGTAAGACTGAATGTGGTAGG + Intergenic
959335863 3:105064605-105064627 ATTTCATATCTGTATATGGAAGG + Intergenic
959638160 3:108599636-108599658 ATTTCAACACTGAATGAGGGGGG - Intronic
962485286 3:135836425-135836447 TTTTCAAAATTGTTTGTGTTGGG - Intergenic
962621082 3:137179689-137179711 TTTTGAAAACTGTATGTAGTTGG + Intergenic
962880767 3:139574300-139574322 ATTTCAAGTCTCTATGTGGATGG + Intronic
963452347 3:145498749-145498771 TTTTCATATCTGTATATGGTAGG + Intergenic
964162069 3:153657564-153657586 AATACAGAACTGTAAGTGGTTGG - Intergenic
964373863 3:156030209-156030231 ATTTTAAAGCTGTCTGTGGCCGG - Intergenic
964555371 3:157931372-157931394 TTTCCAATATTGTATGTGGTGGG - Intergenic
965378965 3:167964118-167964140 ATTCACAAAATGTATGTGGTGGG + Intergenic
965695761 3:171406730-171406752 CTTTCAAAACTGTGTTTGCTGGG - Intronic
966992841 3:185251994-185252016 ACTTCACAACTTTATGAGGTAGG + Intronic
967475712 3:189914989-189915011 CTTGCAAAACTGAATGTGGGTGG - Intergenic
971064156 4:23008699-23008721 ATTTCAAAACTTTTTATGTTTGG - Intergenic
971544547 4:27869194-27869216 AATTTAAAAGTGTATGTGGGAGG - Intergenic
973027285 4:45288523-45288545 ATTTCATAACTGTATTTGTCAGG - Intergenic
973340001 4:48994099-48994121 CTTTCACAACTTTATGAGGTAGG - Intronic
974242997 4:59275629-59275651 ATTTTGAAACTGTATCTGTTTGG - Intergenic
978071497 4:104477877-104477899 ATTACATAACTGTATGTCTTTGG + Intronic
978896084 4:113889426-113889448 ATTATAAAACTGTATCAGGTGGG + Intergenic
979488936 4:121301961-121301983 ATTTAAAAAATGTATGAGGCTGG + Intergenic
979495299 4:121376615-121376637 ATCTTAAAACTGGTTGTGGTGGG - Intronic
981877393 4:149563937-149563959 AATTTAAAACTGTTTGTGGAAGG - Intergenic
983038939 4:162901550-162901572 ACTTCAGAGCTGTCTGTGGTGGG + Intergenic
983916246 4:173294911-173294933 CTTTCAACACTGATTGTGGTTGG + Intronic
984211819 4:176859182-176859204 ATTTCAAAAGTGACTGAGGTTGG + Intergenic
985048816 4:185969858-185969880 ATTGCACAAGTGAATGTGGTGGG + Intergenic
985347428 4:189021387-189021409 ATTCCACTACTTTATGTGGTAGG + Intergenic
985853166 5:2403670-2403692 ACTTCAAAACTGTAAGAAGTGGG - Intergenic
987917343 5:24231210-24231232 AGTTTAAAACTGTCTGTGATGGG + Intergenic
988095170 5:26597978-26598000 ATTTAAGATTTGTATGTGGTAGG + Intergenic
988169984 5:27640859-27640881 ATTCCCAAATTGTATGAGGTGGG - Intergenic
988372215 5:30385797-30385819 ATTTCAAAAGTTTATGTGAAGGG + Intergenic
989800933 5:45538188-45538210 ATTTCTAAATTGTATATGATAGG - Intronic
990848377 5:60171945-60171967 ATTTCAAATATGTATGTTTTAGG + Intronic
992250843 5:74874612-74874634 ATTTCAATACTGTCTGTAATGGG + Intergenic
993334370 5:86639201-86639223 ATTTTAAAACTGTTTCTGATGGG + Intergenic
994253528 5:97565435-97565457 ATTTCAGAATTTTATGTTGTTGG + Intergenic
996562945 5:124850391-124850413 ATTTCTAATCTGTATGAGTTGGG + Intergenic
996837961 5:127814964-127814986 TTTTCAAGACAGTATGTGTTGGG + Intergenic
997673147 5:135693026-135693048 ATTTCAAAAGTGTTTGTGTTTGG + Intergenic
997881205 5:137591989-137592011 ATTTGCAAACTGTATCTGATGGG + Intronic
1003405231 6:5822345-5822367 ATTTTAAAGCTCTTTGTGGTAGG - Intergenic
1003730844 6:8821992-8822014 ATTTTAAAGGAGTATGTGGTCGG + Intergenic
1003966524 6:11257279-11257301 CTGTCAAAACTGAAGGTGGTGGG - Intronic
1004883512 6:20031373-20031395 ATTTGGAAACTTTGTGTGGTAGG + Intergenic
1005308891 6:24540110-24540132 ATTGTAAAACAGTATGTGGCTGG - Intergenic
1005526976 6:26660370-26660392 ATTTAAAAACTGTTTTTTGTTGG - Intergenic
1009859371 6:69306730-69306752 ATTCCTAATTTGTATGTGGTGGG + Intronic
1010634777 6:78244452-78244474 ATTTTAAAACTGTATCTATTTGG - Intergenic
1011088181 6:83566436-83566458 ATTTCAACAGGGTAGGTGGTAGG + Intronic
1011433377 6:87312210-87312232 ACTTAAAAACTGGAGGTGGTCGG + Intronic
1012128781 6:95465112-95465134 GTCTCCAAAATGTATGTGGTAGG - Intergenic
1012459294 6:99442920-99442942 ATTTGAAAATTGTATGGGCTGGG + Intronic
1013103505 6:107007400-107007422 ATATGAAAACTGTATGTAGGAGG + Intergenic
1014908422 6:127059265-127059287 ATATCAAAACTGAAGGGGGTTGG + Intergenic
1015102174 6:129494404-129494426 TTTTCATAACTCTATGTTGTAGG - Intronic
1016505789 6:144777633-144777655 ATTTTGAAACTTTATGTGATAGG + Intronic
1017163290 6:151385850-151385872 ATTTTAAAACTGTATTTTGAAGG + Intronic
1017239747 6:152154503-152154525 AATACAAAAATGTATGTGGAAGG + Intronic
1018212342 6:161494540-161494562 ATTTCAAATCTGTTTGTGCAAGG + Intronic
1018276199 6:162134085-162134107 TTTACAAAACTCTATATGGTAGG + Intronic
1018829509 6:167432559-167432581 ATTTCAAAGCTGCATCTGGCGGG - Intergenic
1020533097 7:9359201-9359223 AAATCAAAACTGTATGTGTCAGG - Intergenic
1021491439 7:21223556-21223578 ATTTCTAAAATGTATGTGGGAGG - Intergenic
1023650345 7:42363201-42363223 ATTCAAAAATTGTATGTGGCTGG + Intergenic
1024446538 7:49486310-49486332 ATTTTAAAATTGTATTTGATAGG + Intergenic
1026476835 7:70743768-70743790 ATTTCAAATCTGTCAGTGCTGGG - Intronic
1027293177 7:76736948-76736970 ATTTAAATACTGTATGTATTAGG - Intergenic
1027360117 7:77399751-77399773 GTTTTAAAACTGTACTTGGTGGG - Intronic
1027735477 7:81927453-81927475 ATTTCTCAATTATATGTGGTAGG - Intergenic
1028082820 7:86599518-86599540 GTTTCAAAACTGCATCAGGTCGG - Intergenic
1028615329 7:92759510-92759532 TTTTAAAAAATGTGTGTGGTGGG + Intronic
1028642590 7:93059774-93059796 AAAACAAAACTGTATGTTGTAGG - Intergenic
1028726769 7:94096846-94096868 AAATCAAAACTGTATTGGGTTGG + Intergenic
1028949810 7:96621684-96621706 ATTTCAATAATGTATGTATTCGG - Intronic
1029123563 7:98283291-98283313 ATTTCAAAAGTGTGTGTGTAAGG + Intronic
1029236978 7:99128675-99128697 CTTTCTAAACTGAATGTGCTGGG + Intronic
1030160535 7:106504114-106504136 ATTTTAAAAATGTGGGTGGTGGG + Intergenic
1030303569 7:107998345-107998367 ATCTGAAAATGGTATGTGGTTGG - Exonic
1031198286 7:118644472-118644494 CTTTCAAAAGATTATGTGGTAGG + Intergenic
1031210668 7:118822504-118822526 ATTTCAAAGATGTCTGAGGTAGG + Intergenic
1031306115 7:120130014-120130036 ATTTCAAAAATGAATGTGCTGGG + Intergenic
1032256210 7:130299111-130299133 ATTTCACAATTGTGTCTGGTTGG - Intronic
1032598250 7:133264259-133264281 CTTGAAAAACTGTATGTGTTGGG + Intronic
1035761375 8:2071407-2071429 ATTTCAAAAATATGTGTGGTAGG - Intronic
1037013980 8:13879979-13880001 ATTTTAAAAATATATGTAGTTGG + Intergenic
1037074397 8:14695716-14695738 CTTTGAAAACTGTATATTGTTGG - Intronic
1037548651 8:19948542-19948564 ATTTTAACACTGTACCTGGTTGG + Intronic
1038188736 8:25299359-25299381 AATTCAAAACAGTGTGTGGGAGG + Intronic
1038755659 8:30338488-30338510 ATTTCAAAATTTTATCTGGCTGG - Intergenic
1040779734 8:51093723-51093745 ATTACAAATGTGTATGTGATTGG + Intergenic
1043459370 8:80444100-80444122 ATTTCAAACATGTATGACGTGGG + Intergenic
1043541817 8:81272179-81272201 AATTAAAAACTGTATGTCTTGGG + Intergenic
1044256976 8:90075084-90075106 ATTTCTAAACTGTATTTGTGTGG + Intronic
1045766186 8:105673429-105673451 ATTTCAGAATTTTATGTGATAGG - Intronic
1047050312 8:121104282-121104304 ACATTAAAACTGTATGTGGGTGG + Intergenic
1047230034 8:122989282-122989304 AATTCAAAACTCTATGATGTAGG - Intergenic
1047442763 8:124893164-124893186 ATTTCAACATTGGATTTGGTGGG + Intergenic
1051138051 9:13946229-13946251 AGTTCACAACTGTAAGTTGTTGG - Intergenic
1051147194 9:14039967-14039989 ATTTCAATATTTTATGTTGTAGG + Intergenic
1051799509 9:20916529-20916551 ATTTCAAATGTGAATTTGGTGGG + Intronic
1052050999 9:23849950-23849972 TTTTCAAAACTGCTTGTGCTGGG + Intergenic
1052372882 9:27685704-27685726 ATTTCACAACTTGGTGTGGTTGG + Intergenic
1052437599 9:28448562-28448584 TTTTGAAAACTGTATGTTCTTGG - Intronic
1052444218 9:28538978-28539000 GTCTCAAAAATGTATGTGGATGG + Intronic
1053040346 9:34865264-34865286 ATTTGAAAACTTCATGGGGTTGG + Intergenic
1055555829 9:77472525-77472547 ATTTCAAAAATGTATTTCTTAGG - Intronic
1055593784 9:77845101-77845123 ATTTCAATACTGTAACTCGTTGG + Intronic
1056982699 9:91330815-91330837 ATTTTCAAACTTTATGTAGTTGG - Intronic
1058783990 9:108367718-108367740 AATTCAAAACTGTATCTGCGTGG - Intergenic
1059101386 9:111475432-111475454 AATTCAAAACAGAATGTGGTGGG + Intronic
1061076709 9:128345753-128345775 TTTTGAAAACAGTATGAGGTAGG - Intronic
1186110496 X:6250023-6250045 ATTTCCAAAGTGTATGTACTTGG + Intergenic
1186247358 X:7628525-7628547 ACTTCAAAACTTTAGGTGGCAGG + Intergenic
1187327636 X:18306673-18306695 ATTTAAAAAATATATCTGGTAGG + Intronic
1187427360 X:19190499-19190521 ATTTCAAAACTGGGTGAGTTAGG - Intergenic
1187782646 X:22845547-22845569 ATTGCAAACATGTATGTGCTTGG - Intergenic
1189756799 X:44280347-44280369 CATTTAAAAATGTATGTGGTAGG - Intronic
1191941520 X:66486014-66486036 GTTCTAAAACTGTATGTGCTTGG - Intergenic
1192765985 X:74140186-74140208 ATTTCAAATTTGTTTGTGGCAGG - Intergenic
1193912684 X:87325279-87325301 ATTTCAAAACTGAAGGAGGTGGG + Intergenic
1195260441 X:103126354-103126376 ATTTCAGAACTGTAGAAGGTTGG - Intergenic
1195460968 X:105123720-105123742 TATTCAAAGCTGTATGTGCTAGG + Intronic
1197020333 X:121679920-121679942 ATTTTAAAACTGTACGTGGTAGG - Intergenic
1197475680 X:126922026-126922048 ATTTCAAATATGTACGTGATTGG + Intergenic
1197744134 X:129919641-129919663 TTGGCAAAACTGTATGAGGTTGG - Intronic
1198387184 X:136140516-136140538 ATTTCTAAACTGAATGGCGTGGG + Intergenic
1198603112 X:138306560-138306582 ATTTTATAAATGAATGTGGTTGG - Intergenic
1198924612 X:141774517-141774539 ATTTCAAAACAGTAAGTGTTCGG - Intergenic
1199964099 X:152804590-152804612 ATTTTAAAACTGCCTGTGTTTGG - Intergenic
1200166911 X:154042402-154042424 TTTTTTAACCTGTATGTGGTGGG - Intronic
1200866085 Y:8045161-8045183 TTTTCAACCCTGTATATGGTGGG + Intergenic
1200949660 Y:8883216-8883238 ATTTCAAAAGAGTAAGTGGTGGG - Intergenic
1201740610 Y:17320808-17320830 ATTTCAAAACTTTGTGTGCAAGG - Intergenic