ID: 1155999450

View in Genome Browser
Species Human (GRCh38)
Location 18:32368572-32368594
Sequence ATTTATAACCTCTAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155999447_1155999450 12 Left 1155999447 18:32368537-32368559 CCTTTTTCTACTCTGAATCACTG 0: 1
1: 0
2: 3
3: 33
4: 375
Right 1155999450 18:32368572-32368594 ATTTATAACCTCTAGATGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155999450 Original CRISPR ATTTATAACCTCTAGATGGC AGG Intronic
901315063 1:8301456-8301478 ATCAATAACCTATAGCTGGCTGG + Intergenic
908969080 1:69804583-69804605 ATATATTTCCTCTAGATAGCTGG - Intronic
909522188 1:76582322-76582344 ATTTATAACAACTTGGTGGCTGG + Intronic
911506200 1:98755475-98755497 AATTATGTCCTCTAGATGGATGG + Intronic
912087152 1:106022476-106022498 ATTAATCACCACTAGAGGGCAGG + Intergenic
912149234 1:106836724-106836746 ATATATAACCTATATATGGTGGG + Intergenic
913301911 1:117380102-117380124 AATTAGAACCTCTATATTGCTGG - Intronic
913940955 1:125104635-125104657 ATTTATGACCTTTAGATGATGGG - Intergenic
915717778 1:157960750-157960772 CTTTCTAACCTCTAGGTGGGAGG - Intergenic
917966153 1:180179918-180179940 ATTTATCACCTCTACATAACAGG - Intronic
919987203 1:202683862-202683884 ATTTCCAACCTCTAGAGTGCTGG + Intronic
920935763 1:210432960-210432982 ACTTTTAACCTCTCGATGGCAGG + Intronic
921778386 1:219130081-219130103 ATTTATTACATTTAGATTGCTGG - Intergenic
922458560 1:225796903-225796925 ATTTAAAAACTCTAAATGGCCGG - Intergenic
1063602442 10:7494542-7494564 GTTTATAATCTCTGGCTGGCAGG - Intergenic
1065370171 10:24976269-24976291 GTTTATTAACTCTAGATTGCAGG - Intergenic
1066215283 10:33280587-33280609 CTTTATCACTTCTTGATGGCTGG - Intronic
1069086465 10:64145477-64145499 ATATGTAACTTCCAGATGGCAGG - Intergenic
1070353611 10:75617303-75617325 ATTTACAACCTCTAAGTGGAAGG + Intronic
1070752141 10:78970355-78970377 ATTAATAAACTGTAGCTGGCCGG + Intergenic
1073893816 10:108130919-108130941 ATTTAGATCCTCTAGAAGACTGG - Intergenic
1074126395 10:110531744-110531766 ATATAAAACCTCAAGGTGGCAGG + Intergenic
1074350871 10:112735566-112735588 ATTAATAACTTGTGGATGGCTGG - Intronic
1076932240 10:133539477-133539499 ATTTAAAACCTCTCTCTGGCTGG - Intronic
1079381146 11:19938626-19938648 ATTTGTAACCTCTAGGTGTGAGG + Intronic
1080056113 11:27908511-27908533 ATTTATAACATTTAGAAGGCAGG - Intergenic
1085425877 11:76404247-76404269 ATTTATAAAATGGAGATGGCTGG - Exonic
1086395539 11:86411653-86411675 ATTTACAACATCCAGATGGAAGG - Intronic
1086491997 11:87364900-87364922 ATGTATAAACTCTAAATTGCAGG + Intergenic
1087269476 11:96096977-96096999 ATTAAAAACTTCTAGAAGGCAGG - Intronic
1087897357 11:103601440-103601462 ATTGATGTCCTCTAGGTGGCAGG - Intergenic
1087977741 11:104570441-104570463 AATTTTAACCTCTGGATGACTGG + Intergenic
1091874469 12:3922252-3922274 ATTATTAACCTCTAGTTTGCTGG + Intergenic
1092930516 12:13311265-13311287 ATTTATAAGCAATAGAGGGCAGG - Intergenic
1098447117 12:70577206-70577228 ATTTCTTACCACTAGAGGGCAGG - Intronic
1099438066 12:82667192-82667214 CTTTAGAACCTCTTGATAGCAGG - Intergenic
1102795183 12:115683141-115683163 ATTTTTATTCTCTAGATGCCAGG - Intergenic
1107235419 13:38162790-38162812 TTTTTTAACCTCTTGAAGGCAGG - Intergenic
1111654817 13:91139316-91139338 ATCTCTACCCTCTAGATGCCAGG + Intergenic
1115732986 14:36291960-36291982 ATTTATTAAGTCTAGGTGGCAGG + Intergenic
1118248505 14:64135392-64135414 ATTTATACTCCCTAGATGCCTGG + Intronic
1120010731 14:79411176-79411198 GCTTATAAACTCAAGATGGCTGG + Intronic
1121252779 14:92512536-92512558 CTTTCTAACTTCTAGAAGGCAGG + Intergenic
1122180078 14:99948526-99948548 ATTTATAAAGACAAGATGGCTGG + Intergenic
1124486031 15:30117491-30117513 ATTTATAAACTCCCGATGGAAGG + Intergenic
1124517544 15:30379778-30379800 ATTTATAAACTCCCGATGGAAGG - Intronic
1124541106 15:30586477-30586499 ATTTATAAACTCCCGATGGAAGG + Intergenic
1124757552 15:32421110-32421132 ATTTATAAACTCCCGATGGAAGG - Intergenic
1124995525 15:34719872-34719894 ATCTGTAATCTCTAGCTGGCTGG + Intergenic
1130118109 15:81023202-81023224 GTTAATAAACTCAAGATGGCAGG + Intronic
1133497826 16:6336542-6336564 ATTTATAATCTAGAGAGGGCTGG + Intronic
1135625075 16:23987737-23987759 TTTTACAACCTCTAGACTGCGGG - Intronic
1137496237 16:48971484-48971506 GTTTATAACCTCTAGAATTCTGG - Intergenic
1138072151 16:54003145-54003167 TTTTATCAACTCTGGATGGCAGG + Intronic
1138970666 16:62139208-62139230 ATATGTATCCTTTAGATGGCTGG + Intergenic
1140132049 16:72171432-72171454 TGTTAAAACCTCCAGATGGCAGG + Intronic
1140731510 16:77860722-77860744 CTTTATAAAATCTAGAAGGCAGG + Intronic
1144024128 17:11262529-11262551 ATTATGAACCCCTAGATGGCAGG + Intronic
1145689261 17:26718809-26718831 ATTTATGATCTTTAGATGACGGG - Intergenic
1147839974 17:43364306-43364328 ATTTAAGTCCTCTAGATGGGAGG + Intergenic
1149337489 17:55651196-55651218 CTTTAAAACCTCTGGATAGCTGG - Intergenic
1150384482 17:64747568-64747590 ATTTCAAACTGCTAGATGGCCGG + Intergenic
1153434799 18:5057927-5057949 ATTTATATCCACAAGATGGCAGG - Intergenic
1153564729 18:6408368-6408390 ATTTATAAGCTCTTGCTGGTGGG - Intronic
1155277652 18:24204350-24204372 ATTTATAACATCTATACCGCTGG + Intronic
1155999450 18:32368572-32368594 ATTTATAACCTCTAGATGGCAGG + Intronic
1156754450 18:40504519-40504541 ATTGATATCCTCTAGAAGGTGGG - Intergenic
1161729122 19:5948152-5948174 ATAAATTCCCTCTAGATGGCTGG + Intronic
1162226692 19:9228567-9228589 ATTTATTACCTCTAAATAGAAGG - Intergenic
1165549942 19:36575307-36575329 AATTATAATTTCTAGATGACAGG + Intronic
1202668637 1_KI270709v1_random:26383-26405 ATTTATGATCTTTAGATGACGGG - Intergenic
933000798 2:76920124-76920146 TTTTATCACCTGTAGATGCCAGG - Intronic
938275304 2:130015340-130015362 ATTTTTTACCTCTACATGGGAGG + Intergenic
938899402 2:135787097-135787119 ATATATTACATCTAGATAGCTGG - Intergenic
940612772 2:156011277-156011299 ATTTCTGATCTCTGGATGGCTGG - Intergenic
942921345 2:181376873-181376895 ATTAATAACCTTTACATGTCTGG + Intergenic
1172343333 20:34176878-34176900 ATTTAGAATCTCCAAATGGCAGG + Intergenic
1177153178 21:17475568-17475590 ATCTATAAAATCTAGATGCCTGG - Intergenic
1177742626 21:25172015-25172037 ATTTATAACCTATAGATAGCTGG - Intergenic
953312691 3:41894945-41894967 ATTTATAAACTCCCGATGGAAGG - Intronic
955422844 3:58756690-58756712 ATTTATTACCTCTAGAGGTGAGG - Intronic
956313863 3:67913003-67913025 ATTTATACCTTCTAGATCCCTGG - Intergenic
960435804 3:117625231-117625253 ATTTATAGCCTCTAGAATCCTGG - Intergenic
963643963 3:147890630-147890652 ATTAATACCCTCTAAATGTCAGG - Intergenic
972037721 4:34547769-34547791 ATTTAGAAGTTTTAGATGGCAGG - Intergenic
972204948 4:36760371-36760393 CTATGTAATCTCTAGATGGCAGG - Intergenic
974997647 4:69181440-69181462 ATTTCTAAGCTCTAGAAGGTTGG + Intronic
975002515 4:69242408-69242430 ATTTCTAAGCTCTAGAAGGTTGG + Intergenic
975007380 4:69307371-69307393 ATTTCTAAGCTCTAGAAGGTTGG - Intronic
975010620 4:69346390-69346412 ATTTCTAAGCTCTAGAAGGTTGG + Intronic
979313073 4:119227340-119227362 CTTTAAAACCTCTACAGGGCCGG + Intronic
980736707 4:136899681-136899703 AGATAAAACCTCCAGATGGCAGG + Intergenic
981172258 4:141637920-141637942 CCTTATAACCTCTACATGGCAGG - Intronic
981911231 4:149983907-149983929 ATTTGAAATATCTAGATGGCTGG - Intergenic
984252857 4:177355199-177355221 ATTTATAACATATAAATGGAGGG + Intronic
986226779 5:5823303-5823325 TTTTAAAACCTCTGGAAGGCTGG - Intergenic
986934299 5:12864099-12864121 ATTTATATCATGAAGATGGCTGG - Intergenic
987018014 5:13840004-13840026 ATTTCTAACATCTAAATGACAGG + Intronic
987618522 5:20307612-20307634 ATTTTTACCCTCCAGATGGTAGG - Intronic
989338319 5:40345894-40345916 TATTATAAACTCTAGAGGGCAGG - Intergenic
991611870 5:68457886-68457908 ACTTCTACCCTCTAGATGCCAGG + Intergenic
991705296 5:69352243-69352265 CATTATAACCCCTAGAAGGCAGG + Intronic
992593509 5:78321464-78321486 ATTTATCACCTATAAATGCCAGG - Intergenic
992772578 5:80062004-80062026 ATTTATAAAATCTAGAAGGGAGG + Intronic
994066365 5:95546901-95546923 ACTTTTAACCTCTAGTTAGCAGG - Intronic
1002515813 5:179757630-179757652 ATTTAGAACCTGAAGATGGCTGG - Intronic
1003553175 6:7117082-7117104 ATTTATACCCTGTAGATTTCTGG - Intronic
1006711698 6:36078942-36078964 TTTTAAAAACTCTAGATGCCTGG + Intronic
1008790301 6:55223673-55223695 TTTTTCAACCTCTATATGGCGGG + Intronic
1009716725 6:67406830-67406852 ATTTCTGTCCTCTGGATGGCAGG - Intergenic
1012900340 6:104997726-104997748 ATTTATAATCTGCACATGGCCGG + Intronic
1014664999 6:124226964-124226986 ATTTATAACCTCTATCTCACAGG + Intronic
1015668373 6:135657926-135657948 TTTTATAATCTCTAGTTGGGAGG + Intergenic
1017624477 6:156334292-156334314 AATTATAACCTCTAGAAGCTTGG + Intergenic
1022556527 7:31303512-31303534 AATTTTAAACTCTAGATGGTTGG + Intergenic
1025155534 7:56602801-56602823 ATAAATAACCTCTTCATGGCTGG + Intergenic
1026264104 7:68781651-68781673 AAGCATAACCTCTGGATGGCTGG - Intergenic
1026593477 7:71715238-71715260 ATTTAAAAGCTCTGGATGGCCGG + Intergenic
1027681724 7:81231302-81231324 CTTTATATCTTCTAGATGGCAGG + Intergenic
1027880500 7:83829342-83829364 GTTTATAAACTCTTGATGTCTGG + Intergenic
1033063888 7:138134442-138134464 ATTAAAAACCTAAAGATGGCTGG + Intergenic
1033638848 7:143240752-143240774 ACTTAGAGCCACTAGATGGCGGG + Intergenic
1034319994 7:150171300-150171322 ATTTATAACAGCAAGATCGCTGG + Intergenic
1034505908 7:151490734-151490756 ATTAATAATTTCTAGATGGCAGG + Intronic
1034772754 7:153795923-153795945 ATTTATAACAGCAAGATCGCTGG - Intergenic
1034929546 7:155150685-155150707 GATTATAAGCTCTATATGGCAGG + Intergenic
1037582485 8:20253841-20253863 ATTTATCACCTCGGGAGGGCTGG - Intronic
1038451231 8:27640265-27640287 ATTTATTATCTCTACAGGGCAGG - Intronic
1039073705 8:33669748-33669770 ATTTATAAACTCTAGTTGGTGGG + Intergenic
1042582055 8:70290757-70290779 ATTTATAACATCTAGATACAAGG - Intronic
1043052569 8:75402186-75402208 TTTTATGCCCACTAGATGGCAGG + Intergenic
1044151843 8:88787875-88787897 GTTTATTACCTACAGATGGCTGG - Intergenic
1045590593 8:103590580-103590602 AATTGTAACATCTAGATGGTGGG - Intronic
1046111889 8:109735426-109735448 CATAATAACCACTAGATGGCAGG + Intergenic
1048246226 8:132804276-132804298 ATTTATAACTTCTTGATAGCAGG + Intronic
1057983471 9:99685729-99685751 ATTTATAACCTTTATCTGACTGG + Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1186502833 X:10065841-10065863 AACTATGGCCTCTAGATGGCAGG - Intronic
1186915844 X:14219501-14219523 ATTTATAACATCTTAATGGAAGG + Intergenic
1189441963 X:41045357-41045379 ATGAATAACCTCCAGCTGGCCGG + Intergenic
1190011405 X:46788370-46788392 TTTTAAAACCTCTGCATGGCGGG + Intergenic
1192194830 X:69021286-69021308 ATTTATAACCTGTAGCAGGAGGG - Intergenic
1194136089 X:90144155-90144177 ATTTATAAGCTCTAGAGATCTGG + Intergenic
1195442291 X:104912197-104912219 ATTTCTAACACCTAGAAGGCTGG + Intronic
1196595375 X:117539760-117539782 ATTAATAACCACTGGATGGATGG + Intergenic
1196993153 X:121349996-121350018 AATTATAACCTTTAGATTGATGG + Intergenic
1197559813 X:128005565-128005587 ATTTATAAGCTCTATAATGCAGG + Intergenic
1198897375 X:141470598-141470620 GTGTACAACCTCTACATGGCAGG + Intergenic
1200481847 Y:3714233-3714255 ATTTATAAGCTCTAGAGATCTGG + Intergenic