ID: 1156000355

View in Genome Browser
Species Human (GRCh38)
Location 18:32378058-32378080
Sequence GCGCGCGGGCGCTTTGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156000355 Original CRISPR GCGCGCGGGCGCTTTGGAGG AGG Intronic
903153501 1:21429267-21429289 GCGGGCGGGCGGCGTGGAGGTGG + Intergenic
903155610 1:21440445-21440467 GCGCGGGGGCGGGTGGGAGGTGG + Intronic
907451459 1:54548182-54548204 GCGGGCGGGAGCTGGGGAGGAGG + Intronic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
914743841 1:150486815-150486837 GCGCGGTGGCGGTTTGGTGGGGG + Intergenic
915325418 1:155079273-155079295 GCGCTCGGGCCGTGTGGAGGAGG + Intronic
922196509 1:223364276-223364298 GCGCGCGGGCGCCTCCGCGGGGG - Intergenic
1072283728 10:93893893-93893915 GCGCGCGGTCTCCTTGGGGGAGG + Intergenic
1081863534 11:46347546-46347568 GCGAGCGCGCGCCATGGAGGTGG + Intronic
1088901937 11:114124847-114124869 GCACGAGGGTGCTGTGGAGGAGG + Intronic
1089624621 11:119743227-119743249 GCGAGCGGGAGCTTTGAGGGAGG - Intergenic
1092564222 12:9648020-9648042 TCCCGCGGGCGCGTGGGAGGTGG + Intergenic
1113655612 13:112066672-112066694 GCGCGCGCGCGCTCAGGAAGCGG + Intergenic
1114037864 14:18646300-18646322 GCGAGCGAGCGCCTGGGAGGGGG - Intergenic
1114120757 14:19668728-19668750 GCGAGCGAGCGCCTGGGAGGGGG + Intergenic
1114270803 14:21098635-21098657 GGGTGCGGGCGGTTTGGAGACGG + Exonic
1116658282 14:47676296-47676318 GCGAGGGAGCGCTTTGGCGGGGG - Intergenic
1119386295 14:74259825-74259847 GAGAGCGGGCTCCTTGGAGGAGG + Intronic
1121439333 14:93939032-93939054 ACGCGCGCGCGCATGGGAGGCGG - Intronic
1121473360 14:94173991-94174013 GGGGGCGGGCGCTGGGGAGGGGG - Intronic
1124251040 15:28106723-28106745 GCGCGCGGGGGCCCTGGTGGCGG + Intergenic
1129761460 15:78131377-78131399 GCGCGCGGGGGTCTCGGAGGCGG + Exonic
1129761522 15:78131562-78131584 GCGCGCGGGGGTCTCGGAGGCGG + Intronic
1135342928 16:21664240-21664262 GCGCGCGGGGGCCTGGGCGGAGG + Intergenic
1137617624 16:49856689-49856711 GCGCGGGGGCGCTCAGGCGGCGG + Intronic
1139473740 16:67192215-67192237 GCGGGCGGGCGCGATGGCGGAGG + Exonic
1142240297 16:88941681-88941703 GGGTGCGGGCGCCGTGGAGGGGG + Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143591654 17:7888738-7888760 GCGCGCGCGTGCTTTTGAGAAGG + Intronic
1148431937 17:47649971-47649993 GCGCGCTGGTGCTCGGGAGGCGG - Exonic
1150619383 17:66797878-66797900 GCGCGGGTGACCTTTGGAGGTGG + Intronic
1151821982 17:76501461-76501483 GCGCGCGGGCGGCCGGGAGGCGG + Intronic
1152733986 17:81987761-81987783 GGGTTTGGGCGCTTTGGAGGAGG + Intronic
1156000355 18:32378058-32378080 GCGCGCGGGCGCTTTGGAGGAGG + Intronic
1158649498 18:59273222-59273244 GCGGGAGGGCGCTTTGGAGACGG + Exonic
1160204514 18:76822317-76822339 GGGCGCGGGCGCGGTGGGGGCGG - Intergenic
1161039191 19:2100904-2100926 GCTCACGGGCCCTTGGGAGGGGG - Intergenic
1162756981 19:12866434-12866456 GAGCGTGGCCTCTTTGGAGGCGG + Intronic
1163663930 19:18594422-18594444 GGGCCCGGGCGCTCTGGTGGTGG + Exonic
1163720466 19:18896063-18896085 GCGAGCGGGCGGTATGGCGGCGG - Exonic
1165803114 19:38565123-38565145 GGGCGCGGGCGCGGCGGAGGCGG + Exonic
1167643886 19:50695534-50695556 GCGCGGGAGGGCTCTGGAGGGGG - Intronic
925183915 2:1834232-1834254 GCCCGCGGGGGCTTTGTGGGAGG + Intronic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
931467686 2:62505885-62505907 GCGGGAGAGCGCCTTGGAGGAGG - Intronic
937127222 2:119482363-119482385 GCCTGTGGGGGCTTTGGAGGCGG + Intronic
938063328 2:128268410-128268432 GCGGGCGGGCGGCGTGGAGGTGG - Exonic
943669976 2:190649463-190649485 CCACGCGGGCACTTTGGGGGCGG + Intronic
948560473 2:238848203-238848225 CCGGGCGGGCGCCATGGAGGAGG + Exonic
948576654 2:238956043-238956065 GCTCGCAGGAGCTCTGGAGGCGG + Intergenic
948875008 2:240821356-240821378 GCGTGCGAGCGCCTTGCAGGTGG + Intergenic
1169262572 20:4149123-4149145 GCGCTCGGGCGCTCGGGCGGGGG + Intronic
1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG + Intergenic
1174128727 20:48327068-48327090 GACCGCGGGAGCTTGGGAGGAGG + Intergenic
1176005860 20:62861917-62861939 GCGTGCGGGCGGTTGGGCGGGGG - Intergenic
1179663422 21:42893059-42893081 GCGCCTGGGCGCTGTGGCGGGGG - Intronic
1180057939 21:45368661-45368683 GCGAGAGGACGGTTTGGAGGTGG + Intergenic
1180095628 21:45554341-45554363 GGGCGCGGGGGATTGGGAGGGGG - Intergenic
1180461991 22:15573342-15573364 GCGAGCGAGCGCCTGGGAGGGGG - Intergenic
1180831068 22:18906383-18906405 CTACGCGGGCGCCTTGGAGGAGG + Exonic
1183642642 22:39101606-39101628 GGGCGGGGGCGGGTTGGAGGAGG + Intronic
1183642672 22:39101668-39101690 GGGCGGGGGCGGGTTGGAGGAGG + Intronic
1203281155 22_KI270734v1_random:131654-131676 CTACGCGGGCGCCTTGGAGGAGG + Intergenic
950487335 3:13281507-13281529 GCTGGGGGGCTCTTTGGAGGAGG - Intergenic
951080435 3:18445187-18445209 CCGGGCGGGCGCTGGGGAGGCGG - Intronic
969115381 4:4867626-4867648 GCGGGAGGGCGCTGTGGGGGAGG - Intergenic
969446330 4:7246771-7246793 GTGAGCGTGCGCTTTGGATGTGG + Intronic
969716639 4:8871235-8871257 GCGCACGGTGGCTATGGAGGCGG - Exonic
973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG + Intergenic
974047129 4:56907836-56907858 GCGCGCGCGGGCGTCGGAGGGGG + Intergenic
992080308 5:73230443-73230465 GCCCGCGGTCGCTTTGCTGGCGG + Intergenic
993901162 5:93584945-93584967 GCGCGCGGGCGCGCTGGGAGGGG - Exonic
995512297 5:112921719-112921741 GCGGGCGGGCGCGTTGACGGAGG - Intronic
997943513 5:138179368-138179390 GCCCGCCGGTGCTGTGGAGGTGG - Intronic
1012245812 6:96924579-96924601 GCGCGCGGGCTAGCTGGAGGCGG + Intergenic
1012872903 6:104693061-104693083 GCGCGCGCGCGCTGGGGTGGGGG + Intergenic
1014913185 6:127118120-127118142 GCGCGCCGGCGCTGGGGATGGGG + Intergenic
1019562534 7:1665780-1665802 GGGCGCGGGCGCAGTGGTGGCGG - Intergenic
1021217981 7:17940561-17940583 GCGCGCCGGCGCTATGGAGACGG - Intergenic
1022400165 7:30028750-30028772 GGCCGCGGGCGCCATGGAGGGGG + Exonic
1027198241 7:76046348-76046370 GCGCGCGCGCGCTTTTGAGCCGG + Intronic
1029662219 7:101970358-101970380 GCCCGGGGGTGCGTTGGAGGGGG + Intronic
1039473084 8:37826071-37826093 GCGGGTGGGGGCTTTTGAGGGGG + Intronic
1049936452 9:505027-505049 GCGCTCGGCCGGTCTGGAGGAGG + Intronic
1056220260 9:84444962-84444984 GAGCACGGGCTCCTTGGAGGAGG - Intergenic
1060599589 9:124869153-124869175 GCGCGCGGAGGCGGTGGAGGAGG + Exonic
1060879276 9:127106621-127106643 GAGAGCAGGCGCTTTGGAGTAGG - Intronic
1061158328 9:128878863-128878885 CCTCGCGGGAGCCTTGGAGGAGG + Intronic
1062586711 9:137252892-137252914 GCGAGCGGGGGCTCTGCAGGCGG - Exonic
1185505470 X:630140-630162 GGACGCGGGCGCTTGGGAGGCGG - Intronic
1189114709 X:38330704-38330726 GCTAGGGGGCTCTTTGGAGGAGG - Intronic
1189137107 X:38561485-38561507 GCGGGCGGGCGCGCGGGAGGGGG - Exonic
1189325190 X:40107412-40107434 GAGCGCGCGCGCTTGGGTGGGGG - Intronic
1190177640 X:48164781-48164803 GCCCACGGGCACTTGGGAGGGGG + Intergenic