ID: 1156001737

View in Genome Browser
Species Human (GRCh38)
Location 18:32392587-32392609
Sequence CATGACCCCCTGAAGTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156001737 Original CRISPR CATGACCCCCTGAAGTTCTG AGG Intronic
901947812 1:12717800-12717822 CATGACCCCCTTGTGTTCTGTGG - Intronic
903622366 1:24707236-24707258 CTTGGCCTCCTGAAGTGCTGAGG - Intergenic
905583143 1:39097468-39097490 CTTGGCCTCCTAAAGTTCTGGGG - Intronic
905777026 1:40675007-40675029 CTTGACCTCTCGAAGTTCTGGGG - Intergenic
906324485 1:44836358-44836380 CTTGGCCTCCTGAAGTGCTGGGG - Intronic
907517176 1:55000108-55000130 AATGACCCTGTGAAGCTCTGTGG - Intronic
907598743 1:55745618-55745640 CATGGTCCCCTGCAGTCCTGGGG - Intergenic
909782103 1:79560528-79560550 AATGATCCGGTGAAGTTCTGTGG - Intergenic
911582196 1:99646510-99646532 CATGACCCTCTGTAACTCTGGGG + Intronic
911749420 1:101479622-101479644 CATGAACCCTGAAAGTTCTGAGG - Intergenic
911927609 1:103855374-103855396 AATGATCCTCTGAATTTCTGTGG - Intergenic
912315820 1:108667007-108667029 AATGACCCCCTGAAGTTGGTAGG - Intergenic
914744305 1:150490368-150490390 CTTGACCTCCTGAAGTGTTGGGG + Intronic
915293597 1:154903493-154903515 CTTGACCTCCTAAAGTGCTGGGG - Intergenic
915542112 1:156574057-156574079 GATGCCCCCCTGAAGATCTGAGG + Intergenic
921076712 1:211705807-211705829 CATGAATCCCTGGAGTGCTGAGG - Intergenic
922086316 1:222351309-222351331 AATGATCCCTTGAATTTCTGTGG - Intergenic
1064674861 10:17750470-17750492 CTTGACCTCCTAAAGTGCTGGGG + Intergenic
1066102597 10:32131280-32131302 CATCATCACCGGAAGTTCTGCGG + Intergenic
1068445416 10:57115840-57115862 CAGTACCCCCTGTGGTTCTGTGG + Intergenic
1068964957 10:62902609-62902631 CTTTACCCTCTGAGGTTCTGTGG - Intronic
1069535933 10:69253206-69253228 CATGACCCACTGGAGCTCTGGGG - Intronic
1069629654 10:69889869-69889891 CAGGAACCCCTGGAGTCCTGGGG - Intronic
1070341721 10:75504243-75504265 CTTGGCCTCCTGAAGTGCTGGGG + Intronic
1070687850 10:78502895-78502917 CATGCCCCACAGAAGTTCTCGGG - Intergenic
1073056281 10:100704987-100705009 CATGACCTCCCAAAGTGCTGGGG + Intergenic
1080081419 11:28222482-28222504 CCTGACCCCTTGCACTTCTGGGG + Intronic
1080713955 11:34779635-34779657 CATGACTCCTTGTATTTCTGAGG + Intergenic
1081006418 11:37749232-37749254 AATGACCCTTTGAATTTCTGTGG - Intergenic
1083512435 11:63223433-63223455 AATGACCCTTTGAATTTCTGTGG + Intronic
1083516302 11:63262072-63262094 CTTGACCCCTTGCACTTCTGGGG + Intronic
1084110193 11:67009255-67009277 CTTGGCCTCCTGAAGTGCTGGGG + Intronic
1085689744 11:78655427-78655449 CTTGGCCTCCTGAAGTGCTGGGG - Exonic
1090215293 11:124956926-124956948 GATGGCCCCCTGAAATTTTGGGG - Intronic
1090740320 11:129654132-129654154 CTTGTTCCCCTGAAGTTGTGGGG - Intergenic
1091764744 12:3112137-3112159 AATGAGCCTCTGAATTTCTGTGG + Intronic
1092670960 12:10859942-10859964 AATAATCCCCTGAATTTCTGTGG - Intronic
1094727508 12:33135334-33135356 CTTGACCTCCAAAAGTTCTGGGG + Intergenic
1095605056 12:44057276-44057298 CATGGTCCCGTGAATTTCTGGGG + Intronic
1096543581 12:52322132-52322154 CATGAGTCCCTGGAGCTCTGAGG - Intergenic
1102192798 12:111001756-111001778 CAGGATCCCATGAGGTTCTGGGG - Intergenic
1102671625 12:114624253-114624275 CTTGACCTCCTAAAGTGCTGGGG - Intergenic
1112731863 13:102371981-102372003 CAAGATTCCCTGAAGTTCTTGGG + Intronic
1113212217 13:107996643-107996665 AATGATCCCTTGAATTTCTGTGG + Intergenic
1113292613 13:108923180-108923202 CCTGAGCCCCTGAAGACCTGGGG + Intronic
1113409604 13:110073041-110073063 CATGTAGCCCTGAAATTCTGCGG - Intergenic
1114525961 14:23366810-23366832 CCTGCCCGCCTGCAGTTCTGGGG - Intergenic
1116566986 14:46460004-46460026 AATGATCCCTTGCAGTTCTGTGG - Intergenic
1116943865 14:50817677-50817699 AAACAGCCCCTGAAGTTCTGAGG - Intronic
1202883797 14_KI270722v1_random:85136-85158 AATGACCCCCAGGAGTGCTGAGG - Intergenic
1126440947 15:48687837-48687859 AATGATCCCTTGAATTTCTGTGG - Intergenic
1127944394 15:63735640-63735662 CATGACCCAGAGAAGTTATGAGG - Intronic
1128793808 15:70450658-70450680 CATGACCCCCTCTAGGTATGGGG - Intergenic
1130122963 15:81068152-81068174 CATGGCCTCCCAAAGTTCTGGGG + Intronic
1137325011 16:47425382-47425404 CCTGACCCCCTGCAGTTCCTGGG + Intronic
1137453936 16:48603789-48603811 CATGACCCCCTGGGTTTCAGAGG + Intronic
1140943554 16:79746667-79746689 CATGTACCCCTGAGGCTCTGGGG - Intergenic
1141010957 16:80398362-80398384 AATGATCCTCTGAATTTCTGAGG - Intergenic
1141664337 16:85458185-85458207 CTGGACCCCCTGCAGCTCTGGGG + Intergenic
1144319230 17:14097580-14097602 CATCACCCCATCAAGCTCTGGGG + Intronic
1149340568 17:55681739-55681761 CGTCACCCTCTGAAGATCTGGGG + Intergenic
1150635037 17:66906968-66906990 CATAACCCCCTGCAATTCAGAGG + Intergenic
1151022124 17:70629337-70629359 CCTGACCTCCTGCAGCTCTGAGG + Intergenic
1152166351 17:78710145-78710167 CATGACCCCCTGAGGTGGGGAGG + Intronic
1152832209 17:82504334-82504356 CAGGAGCTCCTGAAGGTCTGCGG + Intergenic
1154962787 18:21327017-21327039 CATGAAACCTTGAATTTCTGGGG + Intronic
1155865292 18:30957323-30957345 CACTACACCCTGTAGTTCTGTGG - Intergenic
1155905648 18:31447892-31447914 CCAGAGCCCCTGTAGTTCTGGGG - Exonic
1156001737 18:32392587-32392609 CATGACCCCCTGAAGTTCTGAGG + Intronic
1159957421 18:74529825-74529847 CATGACCATCTGTTGTTCTGAGG - Intergenic
1160066962 18:75584337-75584359 CATGACTCCCTTGAGTACTGAGG - Intergenic
1163190933 19:15676041-15676063 CCTGAGTCCCTGGAGTTCTGAGG + Intronic
1165164578 19:33842575-33842597 CCCCAGCCCCTGAAGTTCTGAGG - Intergenic
1167400289 19:49262481-49262503 CTTGAGCCCCAGAAGTTTTGAGG + Intergenic
1168579514 19:57542891-57542913 CATGATTACCTGAGGTTCTGAGG + Exonic
1202632943 1_KI270706v1_random:16615-16637 AATGACCCCCAGGAGTGCTGAGG - Intergenic
1202652931 1_KI270707v1_random:23435-23457 AATGACCCCCAGGAGTGCTGAGG + Intergenic
926207068 2:10841352-10841374 CATCCCCTCCTGAAGGTCTGGGG - Intergenic
928397960 2:30957588-30957610 CATCACCCCCAGAGGTTCTGAGG + Intronic
928805156 2:35141043-35141065 CTTGACCCCCAAAAGCTCTGGGG - Intergenic
928847519 2:35695399-35695421 CATGATCCTTTGAATTTCTGTGG + Intergenic
930728063 2:54700761-54700783 AATGACCCTTTGAATTTCTGGGG - Intergenic
931475849 2:62586777-62586799 CCTGACCCCTTGCACTTCTGGGG + Intergenic
933601301 2:84334049-84334071 AATGATCCTTTGAAGTTCTGTGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934948647 2:98560814-98560836 GAAGACCCCCTGAGCTTCTGTGG - Intronic
935368356 2:102318543-102318565 CATGAGAACCTGAAGTTCAGGGG + Intronic
935698121 2:105787318-105787340 CTTCACCACCTGAATTTCTGGGG - Intronic
941274606 2:163475150-163475172 CATTACACGCTGCAGTTCTGGGG - Intergenic
941790966 2:169551543-169551565 CTTGGCCTCCTGAAGTGCTGGGG - Intronic
942256068 2:174099403-174099425 CTTGGCCTCCTGAAGTGCTGGGG + Intronic
943332916 2:186581535-186581557 CATGACCCCATACATTTCTGTGG + Intergenic
943429888 2:187785990-187786012 AATGACCTTCTGAACTTCTGTGG - Intergenic
943751603 2:191515066-191515088 TATCACCCCAGGAAGTTCTGTGG - Intergenic
944097024 2:195979794-195979816 AATGATCCTCTGAATTTCTGTGG - Intronic
944890457 2:204111737-204111759 CTTGGCCCCCTGAAGTTTTAGGG - Intergenic
947935196 2:233998201-233998223 CAGGAGCCCCTGAGGTCCTGTGG - Intronic
1170293001 20:14791655-14791677 CATGATCCCCTCAAGTTCCACGG + Intronic
1172216194 20:33237580-33237602 AGTGACCCCCTGGTGTTCTGGGG + Intronic
1173046510 20:39517760-39517782 CATGGCCTCCCGAAGTGCTGGGG + Intergenic
1174112475 20:48205935-48205957 CTTGAGCCCCTGGAGGTCTGGGG + Intergenic
1175210704 20:57352264-57352286 CATCACCCCAAGAAGTTCGGAGG + Intronic
1176599220 21:8776216-8776238 AATGACCCCCAGGAGTGCTGAGG - Intergenic
1176645166 21:9342495-9342517 AATGACCCCCAGGAGTGCTGAGG - Intergenic
1176859126 21:13995391-13995413 CCTGACCCCTTGCACTTCTGGGG + Intergenic
1178350543 21:31870273-31870295 CAAGACCCCATCAAGTCCTGGGG - Intergenic
1180326684 22:11435835-11435857 AATGACCCCCAGGAGTGCTGAGG - Intergenic
1180367788 22:11956739-11956761 AATGACCCCCAGGAGTGCTGAGG + Intergenic
1180378306 22:12114595-12114617 AATGACCCCCAGGAGTGCTGAGG - Intergenic
1180419208 22:12798684-12798706 AATGACCCCCAGGAGTGCTGAGG + Intergenic
1182207584 22:28644571-28644593 CTTGGCCTCCTGAAGTGCTGGGG - Intronic
1184467237 22:44676130-44676152 CTTGACCTCCTAAAGTGCTGGGG - Intronic
950542814 3:13622268-13622290 CAGGACCCCCAGAAGCTCCGTGG + Intronic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
952015257 3:28949125-28949147 CATGAGGCACTGAAATTCTGTGG + Intergenic
952301037 3:32105081-32105103 CTCGACCTCCTGAAGTGCTGGGG + Intergenic
953742885 3:45552309-45552331 AATGCATCCCTGAAGTTCTGAGG + Intergenic
957095155 3:75771549-75771571 AATGACCCCCAGGAGTGCTGAGG + Intronic
965260721 3:166481543-166481565 CATGATCCCCTGAATTTCTGTGG - Intergenic
1202741726 3_GL000221v1_random:62573-62595 AATGACCCCCAGGAGTGCTGAGG + Intergenic
970491022 4:16573692-16573714 CATTAAGCCCTGACGTTCTGAGG - Intronic
971838204 4:31797073-31797095 AATGACCCTTTGAATTTCTGGGG + Intergenic
973362582 4:49178589-49178611 AATGACCCCCAGGAGTGCTGAGG - Intergenic
973398520 4:49618264-49618286 AATGACCCCCAGGAGTGCTGAGG + Intergenic
974090267 4:57303319-57303341 CCTGACCCCCTGTGCTTCTGGGG + Intergenic
975369202 4:73564866-73564888 TATGACCCTTTGAATTTCTGTGG + Intergenic
975528706 4:75378407-75378429 CATGACCCCTTGTGCTTCTGGGG - Intergenic
977886260 4:102255487-102255509 CATGACCACCAGAAGCTCTGGGG + Intronic
980758686 4:137199335-137199357 GATGGTCCCCTGAAGTTCTCTGG + Intergenic
981086613 4:140689971-140689993 CTTGGCCTCCTGAAGTGCTGGGG + Intronic
983713179 4:170745114-170745136 CATGACCTCCCAAAGTGCTGAGG + Intergenic
1202759927 4_GL000008v2_random:100061-100083 AATGACCCCCAGGAGTGCTGAGG - Intergenic
986211324 5:5675786-5675808 CATGACCCACAGAGGCTCTGAGG + Intergenic
988198907 5:28046213-28046235 TTTGACCCCCTGAAGTTTTATGG + Intergenic
989749642 5:44877631-44877653 GATGACCCCCTCAAGTTTTCTGG + Intergenic
992491769 5:77251398-77251420 CAAGTCCTCTTGAAGTTCTGGGG + Intronic
992997894 5:82350205-82350227 AGTGAGCCCCTGAAGGTCTGAGG - Intronic
994217172 5:97150930-97150952 CTTGGCCTCCTGAAGTGCTGGGG - Intronic
995322314 5:110850027-110850049 TATGACCCTTTGAATTTCTGTGG + Intergenic
997260073 5:132459229-132459251 CATGACTGCCTGGAGCTCTGGGG - Intronic
997362639 5:133305051-133305073 TAAGACCTCCTGATGTTCTGGGG - Intronic
998447484 5:142210007-142210029 CTTGGCCTCCTGAAGTGCTGGGG - Intergenic
999439360 5:151589642-151589664 CTTGGCCCCCTAAAGTGCTGGGG - Intergenic
999739512 5:154539387-154539409 CTTGACCTCCTAAAGTGCTGGGG - Intergenic
1002276399 5:178107019-178107041 CATGGGCTCCTGAAGGTCTGAGG + Intergenic
1002783971 6:387150-387172 CGAGACCCCCTGAGATTCTGGGG - Intergenic
1002827433 6:786018-786040 CCTGCCTCCCTGAAGTCCTGGGG - Intergenic
1003769224 6:9278903-9278925 AATGACCCTTTGAATTTCTGTGG - Intergenic
1005952425 6:30641832-30641854 CATGGCCCCCTGGTATTCTGGGG - Intronic
1007832858 6:44652168-44652190 GAAGGCGCCCTGAAGTTCTGGGG - Intergenic
1009323782 6:62324332-62324354 CTGGACAGCCTGAAGTTCTGAGG - Intergenic
1009695269 6:67095610-67095632 CCTGACCCCTTGCACTTCTGGGG - Intergenic
1011290787 6:85774535-85774557 AATGATCCCTTGAATTTCTGTGG + Intergenic
1012338763 6:98092108-98092130 CTTGACCTCCTAAAGTTCTGGGG - Intergenic
1014039190 6:116804773-116804795 ATTCACCCCCTGAAGATCTGGGG - Intronic
1014252538 6:119129258-119129280 CAGGACCTCCTGAGGATCTGTGG + Intronic
1017351496 6:153448092-153448114 CATGACCCCCTGAACCTGTTTGG + Intergenic
1017469937 6:154729749-154729771 CATGACCCCAGAAAGTTCTATGG + Intergenic
1017765799 6:157606157-157606179 CATGAGCCCCTTAAGATCTGAGG + Intronic
1022413594 7:30158951-30158973 CAAGACTCCCATAAGTTCTGTGG - Exonic
1022843423 7:34187083-34187105 CATGAGGACCTGAAGGTCTGAGG + Intergenic
1024331138 7:48156449-48156471 CAGGACACTCTGAAGTTCAGAGG + Intergenic
1024479870 7:49852254-49852276 CATGACCCCCTGATGCTCCAGGG - Intronic
1027582213 7:80012322-80012344 CATGACCCTTTGTATTTCTGTGG + Intergenic
1028808902 7:95061482-95061504 CTTGGCCTCCTGAAGTGCTGGGG - Intronic
1030451554 7:109719319-109719341 CCTGACCCCTTGCACTTCTGGGG - Intergenic
1031959223 7:127973886-127973908 CCTGACCACCTGAACCTCTGTGG + Intronic
1034556318 7:151852565-151852587 CATGCCCCCCTACAGGTCTGTGG - Intronic
1035084229 7:156243362-156243384 AATGATCCCTTGAATTTCTGTGG + Intergenic
1035560061 8:597733-597755 CATAACCCTCAGAAGTTCTGAGG - Intergenic
1037773844 8:21819704-21819726 GAAGACCACCAGAAGTTCTGTGG - Intergenic
1038329435 8:26596491-26596513 CATGACTCCCGGCAGGTCTGTGG - Intronic
1038584657 8:28778037-28778059 CCTGACCCCCTGACTGTCTGTGG - Intronic
1039196361 8:35035901-35035923 CAAGACCACCTGAAGTTTTCAGG + Intergenic
1039914861 8:41852315-41852337 CATGTTCCCCTGAAGCTCTCAGG - Intronic
1040316522 8:46263754-46263776 AATGACTTCCTGAATTTCTGAGG - Intergenic
1040333494 8:46404356-46404378 CATGTCTCCCTGAGTTTCTGTGG - Intergenic
1040548173 8:48418181-48418203 CTTGACCTCCTAAAGTGCTGGGG + Intergenic
1042244476 8:66696829-66696851 CATGACCCCAGGAAGTCATGTGG + Intronic
1042846801 8:73176659-73176681 CTTGACCTCCCGAAGTGCTGGGG - Intergenic
1045217782 8:100165713-100165735 CATGGAACCCTGAGGTTCTGTGG - Intronic
1047818279 8:128489096-128489118 CATGATCCTATGAAGATCTGTGG - Intergenic
1047889468 8:129291762-129291784 CATGACCGCCTGTATTTGTGAGG - Intergenic
1049308896 8:141922972-141922994 CATGATGCCCTGAACTTGTGAGG + Intergenic
1049476438 8:142799186-142799208 CCTGGCCCCCTGAGGGTCTGGGG - Intergenic
1050577871 9:7017186-7017208 CTTGGCCTCCTGAAGTGCTGGGG + Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053103243 9:35389299-35389321 CTTGATCCCCTGAAGTTATTAGG - Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053903750 9:42820817-42820839 CATGGGCCTCTGAAGTACTGTGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054813522 9:69453710-69453732 CATAACCCCCTGACGGTCTGGGG + Intronic
1055326892 9:75139785-75139807 AATGATCCTCTGAATTTCTGTGG - Intronic
1055515901 9:77032600-77032622 CAGGTGCCCCTGAGGTTCTGAGG + Intergenic
1059587730 9:115624054-115624076 AGTGATCCACTGAAGTTCTGTGG - Intergenic
1061386822 9:130295417-130295439 CCTGACCCCATGGTGTTCTGAGG + Intronic
1062084574 9:134642067-134642089 CATGACCTCCTAAAGTGGTGCGG + Exonic
1062085766 9:134647258-134647280 AATGACCCCATGAGGTTCCGTGG - Intronic
1062589912 9:137269301-137269323 CATGACCTCCTGGGCTTCTGCGG + Intronic
1203540700 Un_KI270743v1:84955-84977 AATGACCCCCAGGAGTGCTGAGG - Intergenic
1185748892 X:2594567-2594589 CATGAGCCCTGGAATTTCTGTGG + Intergenic
1188840988 X:35017118-35017140 CATGCCTCCCTGAAGTCCTGTGG + Intergenic
1190532138 X:51389465-51389487 AATGATCCTCTGAATTTCTGAGG - Intergenic
1190807955 X:53856873-53856895 AATGACCCATTGAATTTCTGTGG + Intergenic
1192654707 X:72980891-72980913 CCTGACCCCTTGCACTTCTGGGG - Intergenic
1193650658 X:84127164-84127186 AATGACCCTTTGAATTTCTGTGG - Intronic
1195312632 X:103647263-103647285 AATGATCCCTTGAATTTCTGTGG - Intergenic
1195543298 X:106087379-106087401 AAGTACCCCCTGTAGTTCTGTGG - Intergenic
1197656988 X:129127279-129127301 CTTGGCCTCCTGAAGTGCTGGGG + Intergenic
1199048635 X:143208166-143208188 AATGATTCCATGAAGTTCTGTGG - Intergenic
1200142716 X:153909908-153909930 CACGACCCCCTCCAGGTCTGGGG + Exonic
1200706492 Y:6447287-6447309 CAGGATCCCCTGAGGCTCTGTGG + Intergenic
1201027620 Y:9717421-9717443 CAGGATCCCCTGAGGCTCTGTGG - Intergenic
1201385068 Y:13431085-13431107 AATGATCCCTTGAATTTCTGTGG - Intronic