ID: 1156008279

View in Genome Browser
Species Human (GRCh38)
Location 18:32469564-32469586
Sequence CAGAATAAACAGTTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 483}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156008279 Original CRISPR CAGAATAAACAGTTGGAGGA AGG Intronic
900871332 1:5305794-5305816 CAGAATAAAAAGGCTGAGGAAGG - Intergenic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
903746374 1:25589591-25589613 TAGAATAAAATGCTGGAGGAGGG + Intergenic
904041111 1:27585784-27585806 AAGAGTTAACAGTTGGAGGAAGG - Intronic
904354252 1:29928377-29928399 CAGAATAAAAAGGCAGAGGAAGG - Intergenic
904816930 1:33210783-33210805 CAAAATAAAGGGATGGAGGAAGG - Intergenic
906634823 1:47402412-47402434 TAGAATGAAGAGTTGGAGCAGGG + Intergenic
907327599 1:53650740-53650762 CAGACTAAAGAGATGGCGGAAGG + Intronic
907611638 1:55877029-55877051 AAGAATAAACATGTGTAGGAAGG - Intergenic
907626063 1:56030851-56030873 CACAATAAACCTTTGGAAGAAGG - Intergenic
908918260 1:69158043-69158065 CAGAAGAAACAGCTTCAGGAAGG - Intergenic
909194819 1:72605540-72605562 CCAAATAAACAGTAGCAGGAAGG - Intergenic
909454130 1:75831073-75831095 CACAATAAAGGGATGGAGGAAGG + Intronic
910202682 1:84715737-84715759 GAAAACAAACAGGTGGAGGAGGG - Intergenic
910204469 1:84734385-84734407 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
910295837 1:85644131-85644153 CAAAATAAAAGGATGGAGGAAGG + Intergenic
910709983 1:90169112-90169134 CAAAATAAAGGGATGGAGGAAGG + Intergenic
910895584 1:92066215-92066237 CAGAAAAAGCAGTTGGATGTGGG + Intergenic
911290261 1:96048941-96048963 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
911758743 1:101591408-101591430 CAGAGAAAACAGTTGAATGAAGG - Intergenic
912108380 1:106309504-106309526 CAGAAAAAGCAGTTGTAAGAGGG + Intergenic
912535429 1:110365291-110365313 CAGAAGAAAAAGGTGGGGGAGGG - Intronic
913024204 1:114819659-114819681 CAGAATATAGAGTTGGAAAAAGG - Intergenic
913344163 1:117791481-117791503 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
913467186 1:119155130-119155152 CAAAATAAAGGGATGGAGGAAGG - Intergenic
913942964 1:125125205-125125227 CAAAATAAAGGGATGGAGGAAGG + Intergenic
914350117 1:146833211-146833233 CAGAATATGCAGCTGGAGGTAGG - Intergenic
914685496 1:149975116-149975138 CAGAATAAACAGTTTATGCAAGG - Intronic
915643310 1:157246979-157247001 ATGAATAAACAGTTGTAGGCTGG - Intergenic
916755339 1:167763930-167763952 GAGAATAAACATTTGCAAGATGG + Intronic
917577439 1:176338760-176338782 TAGAATAAACACATGGGGGATGG + Intergenic
917960147 1:180136216-180136238 CAGAGTCAACATTTGGAAGAGGG + Intergenic
918027587 1:180767391-180767413 GAGAATAAACTGTTGAAGGATGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918673879 1:187257487-187257509 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
919411998 1:197257239-197257261 CAGAACAAAAAGGTGGAAGAAGG - Intergenic
920327900 1:205181210-205181232 AAGAAGATACTGTTGGAGGAAGG - Intronic
920691933 1:208153840-208153862 CAGAACAGACAGCTGGGGGAGGG + Intronic
921211568 1:212904062-212904084 CAGCAAAAACAGTTCAAGGAGGG + Intergenic
921874427 1:220177927-220177949 CAGAATATACAGGTACAGGAAGG + Intronic
921922460 1:220685131-220685153 CAGCATAAACAGTTGAAGCATGG - Intergenic
922255086 1:223886791-223886813 CAGAGTAAACAGGTGGAGATGGG - Intergenic
922419597 1:225450573-225450595 CAGAAGAAACAGTTGCAGCCGGG - Intergenic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923627977 1:235629534-235629556 CAGAATGAACCCTTGAAGGAGGG - Intronic
923893821 1:238246295-238246317 CAGCAAAAACAGTTTGAAGAGGG + Intergenic
924033991 1:239917368-239917390 CAGAATAAAAACTTGGGGGTTGG - Intergenic
924053280 1:240098929-240098951 GAAAATATACAGTTGGATGAAGG + Intronic
924191028 1:241552787-241552809 AAGAAAAAACAGCTGAAGGAGGG - Intronic
924359587 1:243223549-243223571 CACCATAAGCAGTTGGAGGGCGG - Intronic
924417332 1:243870946-243870968 TAGAACAAAAAGCTGGAGGAAGG + Intergenic
1064904775 10:20333917-20333939 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1065077130 10:22091554-22091576 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1065400299 10:25292567-25292589 GGGAGTAAACAGTTGGAGAATGG + Intronic
1067555959 10:47271763-47271785 TAGAATAAACAGGCAGAGGAAGG + Intergenic
1067670423 10:48315821-48315843 GAGTATAAAAAGTTGGGGGAGGG - Intronic
1068520189 10:58069060-58069082 GAAAATAAACAGTTGGAGATGGG - Intergenic
1069194429 10:65531361-65531383 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070953193 10:80447117-80447139 GAGGATAAGCAGTTGCAGGAGGG - Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071420314 10:85489906-85489928 CAGAAAAAGAGGTTGGAGGAAGG + Intergenic
1071584013 10:86801691-86801713 CAGGTTAAACAGTTGAAAGAAGG - Intronic
1071820904 10:89279704-89279726 CAGAATTGACAGTGGAAGGAGGG + Intronic
1072767769 10:98109644-98109666 TAAAAGAAACAGTTGGAGGCTGG - Intergenic
1073784483 10:106873475-106873497 CAGAAAACACTGTTTGAGGAAGG + Intronic
1073919273 10:108440563-108440585 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1074212038 10:111344141-111344163 TAGAAGAAAAAGATGGAGGAAGG - Intergenic
1074655714 10:115585611-115585633 CAAAATAAAAGGATGGAGGAAGG - Intronic
1075038320 10:119087742-119087764 CAGACTACAGAGTGGGAGGAGGG - Intergenic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1077270035 11:1672000-1672022 CAAAATATACAGTATGAGGAGGG - Intergenic
1077364410 11:2155749-2155771 CAGAAACAATAGTGGGAGGAAGG + Intronic
1077382857 11:2253648-2253670 TAGCACAAACAGTGGGAGGAAGG + Intergenic
1077474645 11:2780555-2780577 CTGAGAAAACAGTTGGAGGCTGG - Intronic
1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG + Intergenic
1080646868 11:34193900-34193922 GAGAAGAGACAGTGGGAGGAGGG - Intronic
1080782881 11:35447501-35447523 CAAAATAAAAGGATGGAGGAAGG - Intronic
1080783906 11:35457251-35457273 TAGAATAAAAAGGTGCAGGAAGG + Intronic
1081148099 11:39589439-39589461 CAGAATGAAAAGTTGGTGTAGGG + Intergenic
1081418754 11:42847005-42847027 GAGAATAAATAGTTTGAGGGAGG + Intergenic
1081438345 11:43053478-43053500 AAAAATAAACATTTGGAGCAGGG - Intergenic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1082295281 11:50434086-50434108 CAGGATAAAAAGTAGAAGGAAGG + Intergenic
1082574190 11:54782604-54782626 CAGAATAAAAACTAGAAGGAAGG + Intergenic
1082913276 11:58401856-58401878 AAGAACAAAAAGGTGGAGGAAGG - Intergenic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1085737609 11:79052814-79052836 CAGAATAGTCTGTGGGAGGAAGG - Intronic
1086274840 11:85114288-85114310 CAGAATAAACACTAGGGGAAAGG + Intronic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086784427 11:90949191-90949213 CAAAATGAACATTTGGAGGTAGG + Intergenic
1087078766 11:94150361-94150383 CAGTTTAAACAGGTGGAGAAGGG + Intronic
1087438832 11:98157613-98157635 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1089181442 11:116585870-116585892 CATAATAAAATGTTGGGGGATGG + Intergenic
1090071322 11:123546934-123546956 CAGAATGACCAGTAGGAGCAGGG + Intronic
1091533474 12:1383229-1383251 CAGAAGAAACAGGGAGAGGAGGG - Intronic
1092041496 12:5389156-5389178 CAGCACATTCAGTTGGAGGAAGG - Intergenic
1092695220 12:11164257-11164279 TAGAACAAAAAGCTGGAGGAAGG + Intronic
1095089849 12:38093598-38093620 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1095729198 12:45487689-45487711 TAGAACAAAAAGGTGGAGGAGGG - Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1096919386 12:55067917-55067939 CAGCAGCAACAGTTTGAGGAAGG + Intergenic
1097582456 12:61474442-61474464 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1098473331 12:70870423-70870445 CAGAATAAAGAGTAGCAGTAGGG - Intronic
1099220746 12:79911186-79911208 CTGAAAAAAGAGTGGGAGGATGG - Intronic
1099646490 12:85364016-85364038 GAGAATAAACACTTGTAGGAAGG - Intergenic
1099809144 12:87558452-87558474 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1100126977 12:91439046-91439068 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1100742258 12:97607081-97607103 CAAAATAGACGGATGGAGGAAGG - Intergenic
1100797577 12:98198485-98198507 CAGAACAAACAGGTGGGGGTAGG - Intergenic
1100921508 12:99493568-99493590 TGGAATAAACAGTAGGATGAGGG - Intronic
1100959757 12:99949392-99949414 CAGGATCAACATTTGGAGAATGG + Intronic
1101398416 12:104367858-104367880 TAGAAGAAAAAGGTGGAGGAAGG + Intergenic
1101795462 12:107969056-107969078 CACAATAAAGGGTAGGAGGAAGG + Intergenic
1102185297 12:110942967-110942989 CAAAATAAAGAGTTGGGGGCAGG + Intergenic
1102751490 12:115298514-115298536 ATGAATAATAAGTTGGAGGATGG - Intergenic
1103159446 12:118716184-118716206 CACAACACACAGTTGGAAGACGG + Intergenic
1103425656 12:120831041-120831063 CAGAACAAAAAGGCGGAGGAAGG + Intronic
1104193351 12:126505362-126505384 TAGATTAAATAGATGGAGGATGG + Intergenic
1104726715 12:131082154-131082176 CAGAAACAAAAGGTGGAGGAAGG - Intronic
1105212567 13:18265894-18265916 AAAAAAAAAAAGTTGGAGGATGG - Intergenic
1106279821 13:28256613-28256635 CACAATAAAAAGCTGCAGGAGGG - Intronic
1107489575 13:40868432-40868454 CAAAATAAATGGATGGAGGAAGG - Intergenic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1108009679 13:45992790-45992812 CAGAACAAAAAGGTGAAGGAAGG + Intronic
1108067000 13:46588460-46588482 TACAATAAAAAGCTGGAGGAAGG - Intronic
1108148822 13:47509297-47509319 CATAATAAACATTTGTAGGAAGG - Intergenic
1108255726 13:48609282-48609304 AAAATTAAACAGTTGGGGGAGGG - Intergenic
1108443675 13:50483894-50483916 CAGAATAAACAATTGATGAAGGG + Intronic
1109042672 13:57359564-57359586 AAGGATAAATAGTTGGAGCATGG + Intergenic
1109993571 13:70091298-70091320 GAGAAAAAAGAGTTGGAGGAAGG - Intronic
1110999256 13:82157324-82157346 TAGAAGAAAAAGGTGGAGGAAGG - Intergenic
1111373797 13:87352485-87352507 CAGAATAAACAGCCAAAGGATGG - Intergenic
1111556344 13:89885899-89885921 AAGAATAAACAGCAGGAGAAAGG - Intergenic
1111806597 13:93045843-93045865 CAGAATAAAGAATGGGATGAGGG + Intergenic
1112184804 13:97117368-97117390 CAGAAGACAGAGTTGCAGGAAGG + Intergenic
1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG + Intronic
1113233653 13:108243323-108243345 CAAAGTAAACACTTGGAAGATGG + Intergenic
1113399168 13:109975592-109975614 CAGAATTAGCAGTTGGTGGTGGG + Intergenic
1114303453 14:21399060-21399082 GTGAACAAACAGTTGGAGGATGG + Intronic
1114574864 14:23703025-23703047 CAGCAAGGACAGTTGGAGGAAGG + Intergenic
1114712828 14:24795444-24795466 AAGAAAAAACAGCTGGAAGAGGG + Intergenic
1114725740 14:24934646-24934668 AAGACTAAACAATTGTAGGAAGG + Intronic
1114751750 14:25211845-25211867 CAGGAAAAAAAGTTGGAAGAGGG - Intergenic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1115006701 14:28494329-28494351 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1115125904 14:29993529-29993551 TAGAACAAAAAGTTGAAGGAAGG - Intronic
1115463937 14:33693115-33693137 GTGAATGAACAGTTGAAGGATGG - Intronic
1115742503 14:36403341-36403363 CAGAACAAAAAGGTGAAGGAGGG + Intergenic
1116350875 14:43861036-43861058 AAGAAGAAACATTTGGAGAAGGG + Intergenic
1116467937 14:45254596-45254618 AAGGAAAAACAGTTGGAGGTAGG + Intergenic
1116521152 14:45848660-45848682 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116995075 14:51314837-51314859 TATAATAAACAGTGGGAGGGAGG + Intergenic
1117442643 14:55774277-55774299 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1120084096 14:80249544-80249566 CACAATAAAGGGATGGAGGAAGG - Intronic
1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG + Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122181133 14:99955624-99955646 CAGAACAAAAAGGTAGAGGAAGG + Intergenic
1123986460 15:25650572-25650594 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1125078682 15:35651184-35651206 CACAATTAACAATTGTAGGATGG - Intergenic
1127472261 15:59300807-59300829 CATAACAAACTCTTGGAGGAGGG + Intronic
1128756423 15:70186629-70186651 CAAAATCAACATTTGGATGATGG - Intergenic
1129147512 15:73662271-73662293 CAAAATTAACAGATGAAGGATGG - Intergenic
1129673495 15:77620108-77620130 CAGAATGAACAGTGCCAGGATGG - Intronic
1130080030 15:80724782-80724804 CAGAATGAATAATAGGAGGAGGG - Intronic
1131693130 15:94847405-94847427 CAGGATAATCAGATGTAGGAGGG - Intergenic
1132043068 15:98541480-98541502 CAGATTAAAGATCTGGAGGATGG - Intergenic
1133659999 16:7907083-7907105 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1133695160 16:8256252-8256274 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1133702154 16:8318743-8318765 CAGAATAGAGGGTGGGAGGAGGG - Intergenic
1135269485 16:21056634-21056656 AACAATAAATGGTTGGAGGAAGG + Intronic
1135529686 16:23242337-23242359 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1136770939 16:32840540-32840562 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1138040696 16:53661930-53661952 CCAAATAAACAGTTTGAGAAAGG - Intronic
1138086987 16:54142395-54142417 TAAAATAGAGAGTTGGAGGAGGG + Intergenic
1138745444 16:59357891-59357913 CAGATTTAACAGTAGGGGGAAGG + Intergenic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1138943869 16:61823589-61823611 CAGAAAAAAACATTGGAGGAAGG + Intronic
1139072893 16:63404371-63404393 TAGAATAAAGACTAGGAGGAGGG - Intergenic
1139502490 16:67378646-67378668 AAAATTCAACAGTTGGAGGAAGG + Exonic
1139723694 16:68878390-68878412 CAAAATAAAAAGTTGGGGGGAGG - Intronic
1139983923 16:70882320-70882342 CAGAATATGCAGCTGGAGGTAGG + Intronic
1140016898 16:71196360-71196382 TAGAACAAAAAGTTGGAGGAAGG + Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1203073362 16_KI270728v1_random:1102653-1102675 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1143182458 17:4991981-4992003 CAGAATATATTGTTGGGGGATGG - Intronic
1143426549 17:6844166-6844188 TAGAAGAAACCTTTGGAGGAGGG + Intergenic
1145070535 17:19801820-19801842 CAGCACAGACAGTTGGACGAAGG - Exonic
1146624819 17:34427203-34427225 CAGAATAAGCAGCTGGTAGATGG + Intergenic
1148032408 17:44630411-44630433 CATAATAAAGACTTTGAGGAGGG - Intergenic
1149729025 17:58925992-58926014 CACAATTCCCAGTTGGAGGAGGG - Intronic
1150972664 17:70046938-70046960 CAGAAAAAACATTTAAAGGAAGG + Intergenic
1153441484 18:5124273-5124295 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1153656568 18:7288117-7288139 CAGAATACAGGGTTGGAGTAGGG + Intergenic
1155125027 18:22865836-22865858 AAGCATAAACAGTAGGAGGCAGG - Intronic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156281436 18:35643084-35643106 CAGAAGAAACCTTTTGAGGAGGG + Intronic
1156594905 18:38537563-38537585 CAGAATAATCAGTTAAATGAAGG - Intergenic
1157701493 18:49763838-49763860 CTGAATAACCAGCTGGAGGCAGG - Intergenic
1158008082 18:52695983-52696005 CAGAATAAAAACTTTGAGTATGG - Intronic
1158101202 18:53832235-53832257 CAAAATAAACGGATGGAGGAAGG - Intergenic
1159618422 18:70609106-70609128 CAGAATCCACAGTAGGAGCAAGG + Intergenic
1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG + Intergenic
1160470189 18:79124823-79124845 CACAGTTAGCAGTTGGAGGAAGG + Intronic
1161667483 19:5586037-5586059 CAGAACCGGCAGTTGGAGGAGGG + Intergenic
1161802167 19:6422342-6422364 CAAAAGAGACAGTTGGAAGATGG - Exonic
1164779029 19:30877868-30877890 GAGAACAGAAAGTTGGAGGAGGG + Intergenic
1164808441 19:31137334-31137356 TAGAACAAAAAGGTGGAGGACGG + Intergenic
1165480336 19:36059818-36059840 CAGCGTAAACACCTGGAGGAGGG + Intronic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167572828 19:50300450-50300472 CACAATAAAAAGTTTGAGGCCGG + Intronic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1202670541 1_KI270709v1_random:46058-46080 CAAAATAAAGGGATGGAGGAAGG + Intergenic
925319538 2:2951627-2951649 CAGAATAACCAATGGGTGGATGG - Intergenic
925434713 2:3826968-3826990 CTTAATAAACAATTGGAGGGAGG - Intronic
925579939 2:5400189-5400211 TAGAAAAAAAAGGTGGAGGAAGG - Intergenic
925717675 2:6799510-6799532 CAGTAAAAACACTTAGAGGATGG + Intergenic
925960214 2:9006854-9006876 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
926676193 2:15622895-15622917 AAAAATAGAGAGTTGGAGGATGG + Intronic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
926888404 2:17618355-17618377 CAGAATTTAAAGATGGAGGAGGG - Intronic
927023706 2:19043712-19043734 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
928264517 2:29800437-29800459 CACATAAAACAGTTGGAAGAAGG + Intronic
928302677 2:30140467-30140489 GAGAATAAAAAGTTTGAGGCCGG + Intergenic
928964289 2:36961903-36961925 CAGAAGGAACAGCTGGGGGAAGG - Intronic
931783014 2:65596155-65596177 GAGAACAGAGAGTTGGAGGAAGG - Intergenic
932289736 2:70566730-70566752 TAGAATTAAAAGGTGGAGGAAGG + Intergenic
932301190 2:70668012-70668034 TAGAACAAAAAGGTGGAGGAAGG + Intronic
933200573 2:79443389-79443411 CAGAAAAAAAAAGTGGAGGAAGG - Intronic
933236645 2:79871556-79871578 CAGAACAAAAAGGTGGAGGAAGG - Intronic
934998875 2:98991338-98991360 CAAAATAAAGGGATGGAGGAAGG + Intergenic
934999870 2:99002769-99002791 CAAAATAAAGGGATGGAGGAAGG + Intronic
935053897 2:99548815-99548837 CACAAGCAACAATTGGAGGATGG + Intronic
936775124 2:115963873-115963895 CAAAATAAAGGGATGGAGGAAGG - Intergenic
937524838 2:122755549-122755571 CAGAATAAAGAGTTCGGAGAGGG + Intergenic
937828432 2:126393091-126393113 AAGAATAAAAAGGTGTAGGAAGG + Intergenic
937937040 2:127254452-127254474 CAGAACAAAAGGATGGAGGAAGG - Intergenic
938689447 2:133774142-133774164 CAGGCTAATCAGCTGGAGGAGGG - Intergenic
939692543 2:145283009-145283031 CTGAATGGGCAGTTGGAGGATGG + Intergenic
940164821 2:150759552-150759574 CAGTATCAAAAGTTGTAGGATGG + Intergenic
940548706 2:155123852-155123874 CAGAACGAAAAGTTAGAGGAAGG + Intergenic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
941515720 2:166473867-166473889 TAGAATAAACAGTTGGAAAAAGG + Exonic
942270173 2:174266498-174266520 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
942411962 2:175718849-175718871 CAAAATAAAGGGATGGAGGAAGG + Intergenic
942497159 2:176551880-176551902 TAGAAGAAAAAGATGGAGGAAGG + Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
944036472 2:195300467-195300489 ATGAATAAACTCTTGGAGGAAGG + Intergenic
944403240 2:199352687-199352709 CAGAAGAACTAGGTGGAGGAGGG + Intronic
946725764 2:222659835-222659857 GAGAATAAAAAGGGGGAGGAAGG - Intergenic
947248064 2:228072066-228072088 TAGAATAAAAAAGTGGAGGAAGG + Intronic
947279573 2:228434985-228435007 CAGAATGAACAGGTTGATGAAGG - Intergenic
948110066 2:235447843-235447865 AAGATTAAACTGTTGGAAGATGG + Intergenic
1169417853 20:5432967-5432989 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1169750137 20:8983337-8983359 TAGGAAAAAGAGTTGGAGGATGG - Intergenic
1170429384 20:16262631-16262653 CAGAAAAACCAGTCAGAGGATGG + Intergenic
1170576595 20:17667392-17667414 CAGAATAAACCAGTGGAAGATGG - Intronic
1170659284 20:18320758-18320780 AAGATTAATCAGTGGGAGGAGGG + Intergenic
1171014353 20:21526292-21526314 CAGAATAAAAATTGGGAAGATGG - Intergenic
1171078286 20:22151459-22151481 CAGAACAAAAAGATGGAGGAAGG - Intergenic
1171128664 20:22627767-22627789 CAGAACAAACTGGTGGTGGAAGG + Intergenic
1171904160 20:30886743-30886765 CAAAATAAAGTGATGGAGGAAGG - Intergenic
1173916679 20:46713285-46713307 CAGAAAAAACAAGTGGAGAAGGG + Intronic
1175599506 20:60261507-60261529 CAGAAGCAACAGTTGCAGGCCGG - Intergenic
1175663131 20:60834832-60834854 GAGGAAAAACAGTTGCAGGAGGG - Intergenic
1177644234 21:23881699-23881721 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1177798747 21:25806706-25806728 TAGAATAAAAAGGTGGAGGAAGG + Intergenic
1177806056 21:25875777-25875799 CAGAATGAACAGGAAGAGGAAGG + Intergenic
1177923339 21:27182610-27182632 CAGAACAAAAAGGTGGAGGGAGG - Intergenic
1178318410 21:31586194-31586216 AAGAAAGAACAGTTGGTGGAAGG - Intergenic
1178977387 21:37231613-37231635 CAGAATAAAGAATTAGAGGAAGG + Intronic
1179410845 21:41162009-41162031 CAGCATAAACATTTTCAGGAAGG - Intergenic
1180815381 22:18786208-18786230 AAAAAAAAAAAGTTGGAGGATGG - Intergenic
1181201571 22:21220545-21220567 AAAAAAAAAAAGTTGGAGGATGG - Intronic
1181332065 22:22100494-22100516 CAGAAGAAAGAGTCAGAGGAAGG - Intergenic
1181625949 22:24122214-24122236 CAAAATTAAAAGTTGGAGGGAGG + Intronic
1181700181 22:24616417-24616439 AAAAAAAAAAAGTTGGAGGATGG + Intronic
1184832151 22:46995743-46995765 CAGAATCCGCAGGTGGAGGAAGG - Intronic
1203225343 22_KI270731v1_random:74886-74908 AAAAAAAAAAAGTTGGAGGATGG + Intergenic
1203265485 22_KI270734v1_random:11898-11920 AAAAAAAAAAAGTTGGAGGATGG - Intergenic
949712434 3:6887114-6887136 CAGTTTAAACAGTGGGAGAAAGG - Intronic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
950401749 3:12774333-12774355 CAGAACCAAAAGGTGGAGGAAGG - Intergenic
951086502 3:18518228-18518250 CAAAATAAAGGGATGGAGGAAGG + Intergenic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951391146 3:22105691-22105713 TAGAACAAAAAGGTGGAGGAAGG - Intronic
953895734 3:46798692-46798714 CAGAACAAAAATGTGGAGGAAGG + Intronic
955444556 3:58995733-58995755 CAGAATAAAATGGTGGAGTAAGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956971532 3:74532008-74532030 CAGAAAAAACAGGAGAAGGAGGG + Intergenic
957264170 3:77939911-77939933 CAGAATGATGAGTTGGAGGAAGG + Intergenic
957414803 3:79887708-79887730 GAGAACAAACAGATGTAGGAAGG - Intergenic
958253155 3:91293403-91293425 CAAAATAAAGGGATGGAGGAAGG + Intergenic
959245982 3:103868602-103868624 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
960566020 3:119132335-119132357 CAAAATAAAGGGATGGAGGAAGG + Intronic
960833345 3:121875593-121875615 CAAAATTAACAGTTAGAGCAGGG + Intronic
961332419 3:126150500-126150522 AAGAATATTCAGCTGGAGGATGG - Exonic
961957523 3:130819280-130819302 TATAATAAGAAGTTGGAGGAAGG - Intergenic
962165857 3:133047022-133047044 CAAAATAGACAATTAGAGGATGG + Intronic
962699889 3:137987389-137987411 CTAAATAAACAGTGGGAGAAAGG + Intergenic
963226329 3:142866232-142866254 TAGAACAAAAAGGTGGAGGAAGG + Intronic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
963564655 3:146913429-146913451 CAAAATAAACAGTTTGATAATGG + Intergenic
964508913 3:157427943-157427965 TAGAACAAAAAGGTGGAGGAAGG + Intronic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
964701503 3:159572970-159572992 CAAAATAAAAGGATGGAGGAAGG - Intronic
966439273 3:179925993-179926015 CAGGAGAAACATTTGGAGGGGGG - Intronic
967329329 3:188275025-188275047 AAGAAATAACAGTTGGAGAAGGG - Intronic
967523347 3:190462235-190462257 TAGAACAAAAAGTTGGAGAAAGG - Intergenic
967885210 3:194328965-194328987 AAAAATGATCAGTTGGAGGAAGG - Intergenic
968695658 4:2024957-2024979 CAGGATAAACAGTGGCAGCATGG + Intronic
969948062 4:10805227-10805249 CAGAACAGAAAGGTGGAGGAAGG + Intergenic
970052755 4:11933753-11933775 TAGAACAAATAGGTGGAGGAGGG + Intergenic
970406094 4:15765796-15765818 CAGGATAAAGACTTGGGGGAAGG - Intergenic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
970843660 4:20509300-20509322 TAGACTGAACAGTTGAAGGAAGG + Intronic
971061479 4:22976842-22976864 TAGAATATACAGGAGGAGGAAGG + Intergenic
971629712 4:28974731-28974753 CAGAAGAAAAAGGTGAAGGAAGG - Intergenic
972228357 4:37041431-37041453 CAGAATAAAAAATTAGAGTAAGG + Intergenic
973079006 4:45966175-45966197 CAAAAAAATCAGTTGGGGGAGGG - Intergenic
973251033 4:48060031-48060053 CAAAATAAAGGGATGGAGGAAGG + Intergenic
973787780 4:54349629-54349651 CAGAATAAACAGTAGGAACATGG + Intergenic
973898597 4:55443034-55443056 CAGAATAGACTGTTGGGGGAGGG - Intronic
974151188 4:58011275-58011297 CAAAATAAAGGGATGGAGGAAGG + Intergenic
974612878 4:64239517-64239539 CAAAATAAAGGGATGGAGGAAGG - Intergenic
975503418 4:75112133-75112155 CAAAATAAAGGGATGGAGGAAGG + Intergenic
976026132 4:80689826-80689848 CAAAATAAAAGGATGGAGGAAGG + Intronic
976278734 4:83305677-83305699 CACCAGATACAGTTGGAGGAAGG + Intronic
976759442 4:88532460-88532482 TAGAATAAAAAGGTGGAGGAAGG - Intronic
977598185 4:98907053-98907075 CTGAATAAATACTTGGAGAATGG - Intronic
977793566 4:101135370-101135392 CAGAATAAACTGTTGCACTAAGG - Intronic
977932015 4:102759979-102760001 CAGCAAAAGCAGTTGGAGGATGG + Intronic
977954877 4:103015624-103015646 CAAAATAGTCATTTGGAGGATGG - Intronic
978690172 4:111498823-111498845 CAAAATAAAAACTTGGGGGAAGG - Intergenic
979562141 4:122112237-122112259 CAAAATAAAAGGATGGAGGAAGG + Intergenic
980402754 4:132313873-132313895 TAAAATAAAAAGGTGGAGGAAGG - Intergenic
980480548 4:133381471-133381493 CAGAATAAAAAGTCAGAGAAGGG + Intergenic
980807622 4:137833811-137833833 TAGAATAAAAAGGTGGAGAAAGG - Intergenic
980907596 4:138963311-138963333 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
981870031 4:149474851-149474873 AAGAAGAAACAGTTGGTGAATGG + Intergenic
982344248 4:154339243-154339265 AAGAACAAAAAGGTGGAGGAAGG - Intronic
982486687 4:155974949-155974971 AATAAATAACAGTTGGAGGATGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
984051739 4:174872888-174872910 CAGAACAAAAAGGTGAAGGAAGG + Intronic
984556263 4:181217789-181217811 GAGAATGAACAATTGGAGAATGG + Intergenic
984556380 4:181218902-181218924 GAGAATGAACAATTGGAGAATGG - Intergenic
986420075 5:7571411-7571433 CAGAACAGAAAGGTGGAGGAAGG - Intronic
986757734 5:10853803-10853825 TAGAATAAAAAGGTAGAGGAAGG + Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987103483 5:14613774-14613796 CAGACTAAGCTGGTGGAGGATGG + Intronic
987565601 5:19581096-19581118 CAGAATAAACACTTCTAGCAAGG - Intronic
988828049 5:34960091-34960113 CAGAATATACACTTGAATGAAGG + Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
989697886 5:44225016-44225038 CAGAATCATGAGTTGGAAGAAGG - Intergenic
989794262 5:45447169-45447191 CAAAATAAAAGGATGGAGGAAGG + Intronic
989797800 5:45497560-45497582 CAAAATAAAAGGATGGAGGAAGG - Intronic
989852412 5:46230707-46230729 CAGAGTAAAAAACTGGAGGACGG + Intergenic
989949673 5:50282361-50282383 CAAAATAAAAGGATGGAGGAAGG + Intergenic
990001862 5:50902731-50902753 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
990529289 5:56657774-56657796 CAGAGTAAACAGTTTCAGGTTGG + Intergenic
990909099 5:60836089-60836111 GTGAATAAACAGTTGGATGTTGG - Intronic
991692536 5:69238856-69238878 CAGAATAACAAGTTGCAGGCTGG - Intronic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992574158 5:78094606-78094628 CAGAATAAAGTTATGGAGGAGGG - Intronic
992880708 5:81106526-81106548 CAGAGAAATCAGTTGGAGGCAGG - Intronic
993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG + Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994277883 5:97861022-97861044 AAGGATAAAGAGTGGGAGGAGGG + Intergenic
994636783 5:102353582-102353604 CAAAATAAAGGGATGGAGGAAGG + Intergenic
995288680 5:110423155-110423177 CAGAATTAGAAGTGGGAGGATGG - Intronic
995314191 5:110749203-110749225 AAGAAGAAAAAGTTGGAGTAGGG + Intronic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995463842 5:112430471-112430493 AATAATAAAGAGTTGGAGTAAGG + Intergenic
995483347 5:112614627-112614649 TAGAAGAAAAAGGTGGAGGAAGG - Intergenic
996186967 5:120489510-120489532 CAAAATAAAGGGATGGAGGAAGG - Intronic
996232614 5:121085009-121085031 CAAAATAAAGGGATGGAGGATGG - Intergenic
997321868 5:132984252-132984274 AAGAATAAACAGATGGGGGTGGG - Intergenic
998354354 5:141522383-141522405 CAGAACTCACAGGTGGAGGAAGG - Intronic
999700337 5:154221814-154221836 CAGCATAAAGAGTGGCAGGAAGG - Intronic
999897660 5:156052493-156052515 CAGAATAAACTGTTGGGCCAGGG + Intronic
1000046210 5:157523986-157524008 CAGGAACAGCAGTTGGAGGAAGG - Intronic
1000297122 5:159921615-159921637 CAGAAGAAAGATTTGGAGCAAGG - Intronic
1001303918 5:170557564-170557586 CAAGACAAACAGTTAGAGGATGG + Intronic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1004588889 6:17029864-17029886 CAGAATGGAAAGGTGGAGGAAGG + Intergenic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1005131549 6:22514185-22514207 CAGAATGTGCAGTTGGAAGAAGG + Intergenic
1005300554 6:24466046-24466068 CAAAAGAAACAGATGGAGGCTGG + Intronic
1006234427 6:32616140-32616162 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1006288934 6:33119229-33119251 CAGAATTAATAATTGCAGGAAGG - Intergenic
1007199453 6:40094189-40094211 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG + Intronic
1009063849 6:58432313-58432335 CAGGATAAAAAGTAGAAGGAAGG - Intergenic
1009259354 6:61464264-61464286 CAGGATAAACACTAGAAGGAAGG + Intergenic
1009817105 6:68750604-68750626 CAGAATAAACAGTTAGCAAATGG - Intronic
1012247744 6:96944866-96944888 AAGAATAAACAGTCTTAGGAAGG + Intronic
1012453943 6:99383693-99383715 CAGAATAAAGAGTTTCAGGTGGG - Exonic
1014399299 6:120967212-120967234 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017969049 6:159294705-159294727 CAGAAGAAATAGCTGGAGAAGGG + Intergenic
1018214678 6:161515161-161515183 CAGTAGATGCAGTTGGAGGAAGG - Intronic
1018640935 6:165903510-165903532 CAGAAAAGACAATTGGAGGAAGG + Intronic
1018645435 6:165943645-165943667 TAGAATGAAAAGGTGGAGGAAGG - Intronic
1019165809 6:170097002-170097024 CAGAAAATACACTGGGAGGAGGG + Intergenic
1019224495 6:170498894-170498916 GAGAACAAAAAGTTAGAGGAAGG - Intergenic
1019787150 7:2984280-2984302 TAGAACAAACAGTCAGAGGAAGG + Intronic
1021383243 7:19994654-19994676 GAGGATGAAGAGTTGGAGGAGGG - Intergenic
1021947929 7:25745979-25746001 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1022035431 7:26529578-26529600 CAGAACAAGAGGTTGGAGGAAGG - Intergenic
1022260869 7:28703698-28703720 TAGAAGAAAAAGGTGGAGGAAGG - Intronic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1023134658 7:37039002-37039024 CAAAATATACATTTGGAGGGAGG + Intronic
1023270290 7:38455365-38455387 CAGAATAAAGAATTGTAGGCTGG - Intronic
1023530475 7:41148602-41148624 GTGAATAAACAGGTGGAGGCAGG + Intergenic
1023957406 7:44897896-44897918 AAGTATTAACAGTTGGAGAATGG + Intergenic
1024142470 7:46476041-46476063 CAAAAAAAACAAGTGGAGGATGG + Intergenic
1024401589 7:48929627-48929649 TAGAACAAAAAGTTGAAGGAAGG + Intergenic
1025479361 7:60962735-60962757 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1025488117 7:61077267-61077289 GAAAATAAACAGGTGAAGGAAGG - Intergenic
1025552623 7:62269589-62269611 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1026416396 7:70185407-70185429 CAGAAAAAACAGTTGAATGTTGG - Intronic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1028392210 7:90329512-90329534 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1028875466 7:95818282-95818304 AAAAATAAAATGTTGGAGGAGGG - Intronic
1028929955 7:96401914-96401936 CAGAATAGAAAAGTGGAGGATGG + Intergenic
1029830052 7:103246864-103246886 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1031208229 7:118790201-118790223 AAGAAGAAAGAGGTGGAGGAGGG + Intergenic
1032491240 7:132326136-132326158 TAGAACAAAAAGGTGGAGGAAGG + Intronic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1032670417 7:134077292-134077314 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1033728690 7:144150314-144150336 CAGAAAAAACAGTTCTAAGAGGG + Intergenic
1033836832 7:145324115-145324137 CAGAAGAAAATATTGGAGGAGGG - Intergenic
1033858363 7:145593996-145594018 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1035988108 8:4456909-4456931 CAGGATAAACAGTTGGTGGGTGG - Intronic
1036154300 8:6327536-6327558 TGGAATAAACAGATGGGGGAAGG - Intergenic
1036526203 8:9537162-9537184 TAGAACAAAAAGATGGAGGAAGG + Intergenic
1037273519 8:17155736-17155758 AAGAATAAATAGTTGGTGGAAGG + Intergenic
1037584115 8:20264806-20264828 CAGAATAAAGGGTTGGAGCCTGG - Intronic
1038187720 8:25290904-25290926 CAGAATTACCAGTTGGCAGAGGG + Intronic
1040482271 8:47836914-47836936 CAGCCTAAACAGTGGGATGATGG - Intronic
1040800891 8:51338564-51338586 CAGAAAACACTGTAGGAGGATGG - Intronic
1041102960 8:54415146-54415168 CAGACAACACAGCTGGAGGAGGG - Intergenic
1042401425 8:68352619-68352641 CAGAATAAAAAATTGTAGGAAGG - Intronic
1044948193 8:97410786-97410808 GCGAGCAAACAGTTGGAGGAGGG - Intergenic
1045882975 8:107063133-107063155 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1046012790 8:108570874-108570896 TAGAACAAAAAGATGGAGGAAGG - Intergenic
1046035841 8:108840369-108840391 CAGAACAAAAAGGTGGAGGAAGG - Intergenic
1046047739 8:108984455-108984477 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1046361540 8:113164944-113164966 TAGAATAAACCAATGGAGGAAGG - Intronic
1046531230 8:115448152-115448174 CTGAACAAAGATTTGGAGGATGG - Intronic
1046595531 8:116256900-116256922 TAGAATAAAAAGTCAGAGGAGGG + Intergenic
1046793468 8:118346033-118346055 CAGAATAAACAGATGCACCAAGG - Intronic
1047470533 8:125167307-125167329 CAGAATAAGCAGTTAGGGAAGGG + Intronic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1051810970 9:21049151-21049173 TGGAATAAAAAGGTGGAGGAAGG - Intergenic
1051867070 9:21695248-21695270 CATAAGAGACAGTTGGAAGATGG + Intergenic
1052073857 9:24116959-24116981 CAGAATAAAAATGTGGAGAAGGG - Intergenic
1052078626 9:24176030-24176052 AAGAATGAGAAGTTGGAGGAAGG - Intergenic
1052281936 9:26742855-26742877 AAGAATAAAGAATGGGAGGAAGG + Intergenic
1052644682 9:31218264-31218286 CACATTAAACAATGGGAGGATGG - Intergenic
1052775808 9:32731164-32731186 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1053532038 9:38892026-38892048 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054204263 9:62116435-62116457 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054362764 9:64193156-64193178 CAGGATAAACACTAGAAGGAAGG + Intergenic
1054634100 9:67471929-67471951 GAGAACAAAAAGATGGAGGAAGG - Intergenic
1055502811 9:76918769-76918791 CACAATAAACAATCGCAGGATGG - Intergenic
1055738879 9:79363969-79363991 CAGAAGAAAGAGTAGGAAGAAGG - Intergenic
1056130137 9:83576584-83576606 GAGGATAAAGGGTTGGAGGAGGG - Intergenic
1056240746 9:84644099-84644121 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1058302271 9:103390821-103390843 AAGAACAAAAACTTGGAGGAAGG + Intergenic
1058529781 9:105894229-105894251 CAGAATAAATAGTTAATGGATGG - Intergenic
1059807411 9:117817715-117817737 TAGAAGAAAGAGTGGGAGGAGGG - Intergenic
1059987336 9:119833518-119833540 GAGAAGAAATAATTGGAGGATGG - Intergenic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1061165512 9:128919908-128919930 CAGAATGAACAGTTAGTGGGAGG + Intergenic
1061572889 9:131488561-131488583 AAGAATAAAGAGATGGATGAGGG - Intronic
1061654827 9:132081135-132081157 AACAATAACCAGTTGTAGGAAGG + Intergenic
1062203229 9:135320108-135320130 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1186738938 X:12496958-12496980 TATAATAACGAGTTGGAGGAAGG - Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1187925643 X:24247722-24247744 AAGAATAGCCAGTTGGAAGATGG - Intergenic
1188153306 X:26707175-26707197 CAGTATAAAAAGTATGAGGAAGG + Intergenic
1188242956 X:27810990-27811012 CAGAGTATGCAGTTGGAGGGAGG - Intronic
1189073826 X:37894779-37894801 TAGAACAAAAAGGTGGAGGAAGG + Intronic
1189804026 X:44717737-44717759 TAGAACAAAAAGATGGAGGAAGG - Intergenic
1189843109 X:45103341-45103363 CAGGAAAAAGAGTTGGGGGAAGG - Intronic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1190504560 X:51113995-51114017 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1191263421 X:58355068-58355090 CAGGATAAAAAGTAGGTGGAAGG + Intergenic
1191678816 X:63819845-63819867 CAGCATGAACGGTGGGAGGAGGG - Intergenic
1191799013 X:65056944-65056966 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1192191038 X:68991266-68991288 AAGAACAAAGAGATGGAGGAAGG - Intergenic
1193018036 X:76757841-76757863 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1193542671 X:82790584-82790606 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1194280261 X:91943114-91943136 GAGGATAAACAGTTGGAACATGG + Intronic
1194626871 X:96235568-96235590 TAGAACAAAAAGATGGAGGAAGG + Intergenic
1194674993 X:96783683-96783705 CAGAATCAAGACTGGGAGGAGGG - Intronic
1195478297 X:105313575-105313597 AAGAATAAACAAATGGAGGGGGG - Intronic
1196112819 X:111965108-111965130 CAAAATAAAGGGATGGAGGAAGG + Intronic
1196573967 X:117296935-117296957 GAGAATGAAGAGTGGGAGGAGGG - Intergenic
1196894668 X:120323153-120323175 TAGAACAAATAGCTGGAGGAAGG - Intergenic
1197161578 X:123329109-123329131 CTGAATACACTCTTGGAGGATGG - Intronic
1197444603 X:126535301-126535323 TAAAATAAAAAGTTGGGGGAGGG + Intergenic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic
1197922209 X:131607366-131607388 AAGAATCAACAGTAGGAGCAGGG - Intergenic
1197998588 X:132407825-132407847 CAGAATTAACAGCTGATGGAGGG + Intronic
1198068854 X:133128029-133128051 CCTAATAAACAGGTGGAGGCCGG + Intergenic
1198610209 X:138390814-138390836 CAGAACTATCAGTTGGATGAAGG + Intergenic
1199254914 X:145708737-145708759 CAGTATAAAAAGGTGGGGGAAGG + Intergenic
1199841374 X:151653018-151653040 GAGAATAGACTGTGGGAGGAAGG + Intronic
1200597738 Y:5166608-5166630 GAGGATAAACAGTTGGAACATGG + Intronic
1200836463 Y:7737134-7737156 GAGTATAAACAGTTTGAGAAGGG - Intergenic
1201074659 Y:10177970-10177992 CAGAATCACCAGTTGGGGGTTGG - Intergenic
1201366628 Y:13213507-13213529 CACAATAAACAGATGTAGGCCGG - Intergenic
1201730710 Y:17199776-17199798 TAGAATAAAAAGGTGGAGAAAGG + Intergenic